Antifungal Susceptibility of Candida Species Isolated from Cancer Patients with Oral Lesions Undergoing Chemotherapy

Author(s):
Zahra JabalameliZahra Jabalameli1, Ali-Mohammad SabzghabaeeAli-Mohammad Sabzghabaee2, Mohammad-Ali MohagheghMohammad-Ali Mohaghegh1, Mehrnoosh MaherolnaghshMehrnoosh Maherolnaghsh1, 3, Hossein SafavizadehHossein Safavizadeh4, Parvin DehghanParvin Dehghan1,*
1Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2Isfahan Clinical Toxicology Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
3Department of Medical Mycoparasitology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
4Rahjuyan Institute of Health, Isfahan, Iran

International Journal of Infection:Vol. 4, issue 4; e14178
Published online:Jun 07, 2017
Article type:Research Article
Received:Jan 07, 2017
Accepted:Jan 14, 2017
How to Cite:Jabalameli Z, Sabzghabaee A, Mohaghegh M, Maherolnaghsh M, Safavizadeh H, et al. Antifungal Susceptibility of Candida Species Isolated from Cancer Patients with Oral Lesions Undergoing Chemotherapy. Int J Infect. 2017;4(4):e14178. doi: https://doi.org/10.5812/iji.14178

Abstract

Background:

Oral candidiasis is the most common opportunistic infection of the oral cavity in patients undergoing chemotherapy. Identification of Candida species and the corresponding susceptibility to antifungal agents can be helpful in the management of cancer patients.

Objectives:

The purpose of this study was to determine the susceptibility patterns of Candida species against 3 antifungal agents and define clinical practice guidelines for the prevention and treatment of oral candidiasis in cancer patients.

Methods:

A total of 12 positive samples of oral lesions caused by Candida species were isolated from patients undergoing chemotherapy through direct examination and culture on CHROMagar Candida medium. Stock cultures were grown on sabouraud dextrose agar and DNA extracts. Then, polymerase chain reaction (PCR) was performed and the products were sequenced. The microdilution method was applied at different concentrations of fluconazole, amphotericin B, and nystatin. The minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) of each species were compared.

Results:

The species distribution of Candida isolates was as follows: C. albicans, 6 (50%); C. krusei, 3 (25%); and C. tropicalis, 3 (25%). The male-to-female ratio was 8:4, and the mean age of cancer patients was 51.25 years (range, 25-81 years). Overall, 100% and 83% of C. albicans were resistant to nystatin and fluconazole, respectively. All Candida species showed the lowest and highest resistance to amphotericin B (8.3%) and nystatin (66.7%), respectively.

Conclusions:

DNA sequencing showed that C. albicans is the most commonly identified species in the oral cavity of cancer patients. Amphotericin B, compared to fluconazole and nystatin, is a more suitable antifungal drug for oral candidiasis. Oral hygiene involves dental cleaning, and management of poor denture hygiene and xerostomia can be helpful in eliminating Candida species in patients undergoing chemotherapy.

1. Background

Oral candidiasis, as an opportunistic infection of the oral cavity, is recognized as the most common human fungal infection. More than 80% of clinical infections associated with oral candidiasis are caused by Candida species, including C. albicans, C. krusei, C. glabrata, and C. tropicalis (1). The incidence of infection with C. albicans, as the most important fungal pathogen isolated from the oral cavity, has been reported to be 30% - 65% in neonates, children, and healthy adults. Also, the incidence rates have been reported at 65% - 88% and 90% - 95%, respectively in long-term care facilities (with antibiotic prescription) and patients with HIV/AIDS and acute leukemia undergoing chemotherapy (2-4). In the general population, 20-75% of the reported cases have shown no symptoms of infection (1).
Candida infections can also be a marker of malignancy and disease among immunocompromised individuals. Reactive oxygen species seem to cause oral mucositis, given exposure to radiation or chemotherapy (5). Oral microbial flora is stable in healthy people, but changes in cancer patients undergoing chemotherapy. In fact, it may expand through the bloodstream or upper gastrointestinal tract, leading to serious systemic diseases and increased morbidity and mortality rates (up to 79%); therefore, prompt diagnosis and adequate therapy are necessary (2, 6).
Despite the nephrotoxicity (a dose-limiting factor) associated with its use and different infusion-related side effects, amphotericin B is the main drug for the treatment of serious fungal infections. Azoles are effective and safe agents for the treatment of oral lesions caused by Candida species and have gradually replaced amphotericin B (7). In case of resistance to azoles, nystatin can be used as a suitable antifungal agent in cancer patients to eradicate Candida colonization in the mouth (8). However, in Iran, in vitro antifungal testing of clinical isolates is not routinely performed to guide the selection of antifungal therapy.

2. Objectives

The purpose of this study was to determine the susceptibility patterns of Candida species against 3 antifungal agents and define clinical practice guidelines for the prevention and treatment of oral candidiasis in cancer patients.

3. Methods

3.1. Sampling and Culture Conditions

A total of 12 positive samples of oral lesions caused by Candida species were isolated from patients undergoing chemotherapy at Seyed Al-Shohada hospital, Isfahan, Iran. All patients completed the consent forms, and the study was approved by the research ethics committee of Isfahan University of Medical Sciences. Also, a questionnaire was developed to record the medical history of patients, type of cancer, and demographic data.
All the specimens from the oral lesions were collected using 2 sterile swabs and were transferred to tubes containing 0.5 mL of saline solution. The swabs were used for direct examination and culture studies with incubation at 35°C for 48 hours on CHROMagar Candida medium (CHROMagar Company, France). Stock cultures were grown on sabouraud dextrose agar (SDA; Biolife, Italy) and were incubated at 35°C for 24 hours.

3.2. DNA Extraction and Polymerase Chain Reaction (PCR) Amplification

DNA extraction was performed using the bulling method. For molecular identification, PCR was performed using the following primers as described by Shokohi et al. (9): ITS1, 5’ TCCGTAGGTGAACCTTGC GG3’ and ITS4, 5’ TCCTCCGCTTATTGATATGC3’. The amplified products were visualized through 1.5% agarose gel electrophoresis in tris/borate/EDTA (TBE) buffer.

3.3. DNA Sequencing

To confirm the identified Candida species, 12 PCR products were sequenced and compared with the available sequences in GenBank, using the BLAST algorithm and the national center for biotechnology information database (www.ncbi.nlm.nih.gov).

3.4. Antifungal Susceptibility Testing

The antifungal drugs, including amphotericin B, fluconazole, and nystatin, were supplied as standard powders (Sigma-Aldrich, USA). Stock solutions of the drugs were prepared in dimethyl sulfoxide (DMSO) and methanol. The susceptibility patterns of the isolates were determined using broth microdilution assay, according to the clinical and laboratory standards institute (CLSI) M27-A3 guidelines (10); the tests were performed in triplicate. The final concentrations ranged from 0.0313 to 16 μg/mL for amphotericin B and nystatin and from 0.125 to 64 μg/mL for fluconazole.
The aliquots (100 μL) of each antifungal drug at a concentration twice as high as the target final concentration were dispensed in 96 wells of sterile microdilution plates. Yeast inoculum (at least 5 colonies) was suspended in 5 mL of sterile saline (0.85%). The turbidity of each suspension was adjusted spectrophotometrically at 530 nm to match 0.5 McFarland standard (corresponding to 1 - 5 × 106 cells/mL). The inoculum was diluted in RPMI 1640 medium (supplemented with L-glutamine and glucose), resulting in 5.0 × 102 - 2.5 × 103 cells/mL.
A constant volume (100 μL) of the inoculum was added to each microdilution well, containing 100 μL of the serial dilution of antifungal agent to reach the final concentration. Also, 1 negative control with no fungal suspensions and 1 positive control with no drugs were used in each series. The plates were sealed and incubated at 35°C for 48 hours. Finally, the visual minimum inhibitory concentration (MIC) endpoints were determined. The MICs for amphotericin B, fluconazole, and nystatin were compared with the CLSI interpretative guidelines on antifungal susceptibility testing.
Fungal growth was considered susceptible at fluconazole doses ≤ 8 μg/mL, susceptible-dose-dependent at doses of 16 - 32 μg/mL, and susceptible at doses ≥ 64 μg/mL. Moreover, for amphotericin B, fungal growth was considered susceptible at doses < 1 μg/mL and resistant at doses ≥ 2 μg/mL. Also, for nystatin, fungal growth was considered susceptible at doses ≤ 16 μg/mL and resistant at doses > 16 μg/mL. Finally, the minimum fungicidal concentration (MFC) was measured.

4. Results

PCR amplification was successfully performed on 12 oral lesions of cancer patients undergoing chemotherapy. Also, DNA sequencing was successfully performed, and the species distribution of Candida isolates was identified: C. albicans, 6 (50%); C. krusei, 3 (25%); and C. tropicalis, 3 (25%). The male-to-female ratio was 8:4, and the mean age of cancer patients was 51.25 years (range, 25 - 81 years).
Comparison of in vitro susceptibilities (MIC and MFC) of Candida isolates to antifungal agents is presented in Table 1. The results showed that 100% and 83% of C. albicans were resistant to nystatin and fluconazole, respectively. All species showed the lowest and highest resistance to amphotericin B (8.3%) and nystatin (66.7%), respectively.
Table 1.Antifungal Susceptibilities of Clinical Candida Isolates from Cancer Patients Undergoing Chemotherapy
Candida speciesAccessions NumberCancer TypeAgeSexAntifungal Agents
FAN
MICMFCSMICMFCS†MICMFCS
C. albicansKY101883.1Leukemia54Male> 64-R*0.0018S> 16-R
KY101874.1Leukemia27Female> 64-R0.0018S> 16-R
KP675681.1Bladder51Male> 64-R64-R> 16-R
KP675109.1Bladder46Male> 64-R132S> 16-R
KP675087.1Lung34Female> 64-R116S> 16-R
KP675450.1Lymphoma25Male18S*0.1251S> 16-R
C. glabrataKP674954.1Breast78Female> 64-R0.0622S8-S
GU199447.1Gastrointestinal tract57Male16-S18S16-S
KP878250.1Lymphoma53Male64-S0.0150.25S216S
C. kruseiEU315756.1Liver59Male16-S18S> 16-R
AB467300.1Lymphoma81Female0.125-S0.2532S0.0641S
EU315751.1Gastrointestinal tract50Male22S0.0010.5S> 16-R

Abbreviations: F, fluconazole; A, amphotericin B; N, nystatin; S, sensitivity; R*, resistant; S*, sensitive.

5. Discussion

Monitoring of antifungal resistance patterns of Candida species in cancer patients can present important information about major differences among different populations in terms of susceptibility patterns and fungal species distribution. Therefore, identification of Candida species and their susceptibility to antifungal agents can be helpful in the management of cancer patients (11).
There are 3 pathways for Candida resistance to drugs in a cancer patient: mutation in susceptible Candida species, infection with an inherently resistant species, and infection with more than 1 Candida species and an inherently resistant species (12). Higher mortality rates have been described in infections caused by organisms resistant to antibiotics and antifungals (13).
In previous research, C. albicans was the predominant organism isolated from cancer patients with oral candidiasis, leading to increased mortality under certain circumstances (14). In the present study, C. albicans was identified using the molecular method and was found to have the highest prevalence among cancer patients; this finding was similar to the results reported in previous studies (4, 15, 16).
The frequency of Candida species in cancer patients is associated with the type of cancer, immune system, and antibiotic resistance rates (17). The increasing incidence of colonization with Candida species due to decreased susceptibility to first-generation azoles (such as fluconazole) suggests the use of newer antifungal drugs. However, fluconazole with good absorption in the gastrointestinal tract and favorable oral safety and nystatin, used as a topical agent with few side effects, have been extensively used for chemoprophylaxis and treatment of fungal infections in severely immunodeficient patients (4, 18).
The importance of non-C. albicans species is associated with increased resistance to azoles, including fluconazole, especially in advanced cancer patients (19, 20). In this study, 100% and 83% of C. albicans and 33.3% and 16.7% of non-C. albicans isolates were resistant to nystatin and fluconazole, respectively. In previous studies, low rates of resistance to both drugs have been reported. In fact, the high resistance rate can be due to the indiscriminate use of antibiotics and antifungal drugs in immunodeficient patients.
Polyene antifungals, including amphotericin B, play a well-defined role as antifungal agents in patients who are unresponsive to broad-spectrum antibiotic therapy. Amphotericin B is not absorbed by the gastrointestinal tract and is used in topical applications for oral candidiasis (1). In the present study, this drug showed substantial activity against isolates with in vitro resistance to fluconazole and nystatin. These results suggest the activity of amphotericin B against oral Candida isolates, particularly those with reduced susceptibility to nystatin and fluconazole; the findings are similar to those reported by Shokohi and colleagues (9).
In conclusion, decreased effectiveness of antifungal drugs is a serious issue, especially in cancer patients. Amphotericin B, compared to fluconazole and nystatin, is a more suitable antifungal drug for oral candidiasis. Oral hygiene involves dental cleaning, and management of poor denture hygiene and xerostomia can be helpful in eliminating Candida infections in patients undergoing chemotherapy.

Acknowledgments

Footnotes

References

  • 1.
    Akpan A, Morgan R. Oral candidiasis. Postgrad Med J. 2002;78(922):455-9. [PubMed ID: 12185216].
  • 2.
    Fraser VJ, Jones M, Dunkel J, Storfer S, Medoff G, Dunagan WC. Candidemia in a tertiary care hospital: epidemiology, risk factors, and predictors of mortality. Clin Infect Dis. 1992;15(3):414-21. [PubMed ID: 1520786].
  • 3.
    Jackson BE, Wilhelmus KR, Mitchell BM. Genetically regulated filamentation contributes to Candida albicans virulence during corneal infection. Microb Pathog. 2007;42(2-3):88-93. [PubMed ID: 17241762]. https://doi.org/10.1016/j.micpath.2006.11.005.
  • 4.
    Maheronnaghsh M, Tolouei S, Dehghan P, Chadeganipour M, Yazdi M. Identification of Candida species in patients with oral lesion undergoing chemotherapy along with minimum inhibitory concentration to fluconazole. Adv Biomed Res. 2016;5:132. [PubMed ID: 27656601]. https://doi.org/10.4103/2277-9175.187394.
  • 5.
    Sonis ST, Elting LS, Keefe D, Peterson DE, Schubert M, Hauer-Jensen M, et al. Perspectives on cancer therapy-induced mucosal injury: pathogenesis, measurement, epidemiology, and consequences for patients. Cancer. 2004;100(9 Suppl):1995-2025. [PubMed ID: 15108222]. https://doi.org/10.1002/cncr.20162.
  • 6.
    Meurman JH, Uittamo J. Oral micro-organisms in the etiology of cancer. Acta Odontol Scand. 2008;66(6):321-6. [PubMed ID: 18821087]. https://doi.org/10.1080/00016350802446527.
  • 7.
    Shokohi T, Bandalizadeh Z, Hedayati M, Mayahi S. In vitro antifungal susceptibility of Candida species isolated from oropharyngeal lesions of patients with cancer to some antifungal agents. Jundishapur J Microbiol. 2011;4(2):19-26.
  • 8.
    Badiee P, Alborzi A, Davarpanah MA, Shakiba E. Distributions and antifungal susceptibility of Candida species from mucosal sites in HIV positive patients. Arch Iran Med. 2010;13(4):282-7. [PubMed ID: 20597560].
  • 9.
    Shokohi T, Hashemi Soteh MB, Saltanat Pouri Z, Hedayati MT, Mayahi S. Identification of Candida species using PCR-RFLP in cancer patients in Iran. Indian J Med Microbiol. 2010;28(2):147-51. [PubMed ID: 20404462]. https://doi.org/10.4103/0255-0857.62493.
  • 10.
    institute C. Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard- third edition M27-A3, 2008. Pennsylvania, USA: National Committee for Clinical Laboratory Standards, Wayne; 2008.
  • 11.
    Ma CF, Li FQ, Shi LN, Hu YA, Wang Y, Huang M, et al. Surveillance study of species distribution, antifungal susceptibility and mortality of nosocomial candidemia in a tertiary care hospital in China. BMC Infect Dis. 2013;13:337. [PubMed ID: 23875950]. https://doi.org/10.1186/1471-2334-13-337.
  • 12.
    Rex JH, Rinaldi MG, Pfaller MA. Resistance of Candida species to fluconazole. Antimicrob Agents Chemother. 1995;39(1):1-8. [PubMed ID: 7695288].
  • 13.
    Mohaghegh M, Ghazvini K, Jafari R, Alikhani M, Safari M, Azari-Garamjan G. Retrospective study on the prevalence and antibiotic resistance pattern of staphylococcus aureus and staphylococcus epidermidis among patients suspicious of bacteremia during 2006-2011. Int J Enteric Pathog. 2015;3(2).
  • 14.
    Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev. 2003;67(3):400-28. table of contents. [PubMed ID: 12966142].
  • 15.
    Davies AN, Brailsford SR, Beighton D. Oral candidosis in patients with advanced cancer. Oral Oncol. 2006;42(7):698-702. [PubMed ID: 16527512]. https://doi.org/10.1016/j.oraloncology.2005.11.010.
  • 16.
    Davies AN, Brailsford SR, Beighton D, Shorthose K, Stevens VC. Oral candidosis in community-based patients with advanced cancer. J Pain Symptom Manage. 2008;35(5):508-14. [PubMed ID: 18242047]. https://doi.org/10.1016/j.jpainsymman.2007.07.005.
  • 17.
    Bhatt VR, Viola GM, Ferrajoli A. Invasive fungal infections in acute leukemia. Ther Adv Hematol. 2011;2(4):231-47. [PubMed ID: 23556092]. https://doi.org/10.1177/2040620711410098.
  • 18.
    Gotzsche PC, Johansen HK. Nystatin prophylaxis and treatment in severely immunodepressed patients. Cochrane Database Syst Rev. 2002;(4). CD002033. [PubMed ID: 12519566]. https://doi.org/10.1002/14651858.CD002033.
  • 19.
    Bagg J, Sweeney MP, Lewis MA, Jackson MS, Coleman D, Al MA, et al. High prevalence of non-albicans yeasts and detection of anti-fungal resistance in the oral flora of patients with advanced cancer. Palliat Med. 2003;17(6):477-81. [PubMed ID: 14526879]. https://doi.org/10.1191/0269216303pm793oa.
  • 20.
    Davies A, Brailsford S, Broadley K, Beighton D. Resistance amongst yeasts isolated from the oral cavities of patients with advanced cancer. Palliat Med. 2002;16(6):527-31. [PubMed ID: 12465701]. https://doi.org/10.1191/0269216302pm583oa.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles