Cover image of the article: The Effect of Four Weeks of Swimming Training on Insulin Resistance and Hepatokines in Rats with PCOS

Image Credit:J Health Rep Technol

The Effect of Four Weeks of Swimming Training on Insulin Resistance and Hepatokines in Rats with PCOS

Authors

Maryam KhalilinejadMaryam Khalilinejad ORCID1, Mandana GholamiMandana Gholami ORCID2,*, Fereshteh Shahmohammadi DermaniFereshteh Shahmohammadi Dermani ORCID3, Farshad GhazalianFarshad Ghazalian ORCID2
1PhD Student, Department of Physical Education and Sports Sciences, Faculty of Literature, Humanities and Social Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran
2Associate Professor, Department of Physical Education and Sports Sciences, Faculty of Literature, Humanities and Social Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran
3Assistant Professor, Department of Gynecology and Midwifery, Faculty of Medical, Islamic Azad University of Medical Sciences, Tehran, Iran
*Corresponding Author: Department of Physical Education and Sports Sciences, Faculty of Literature, Humanities and Social Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran. Email: [email protected]

Journal of Health Reports and Technology:Vol. 10, issue 1; e140930
Published online:Jan 16, 2024
Article type:Research Article
Received:Sep 16, 2023
Accepted:Dec 08, 2023
How to Cite:Khalilinejad M, Gholami M, Shahmohammadi Dermani F, Ghazalian F. The Effect of Four Weeks of Swimming Training on Insulin Resistance and Hepatokines in Rats with PCOS. J Health Rep Technol. 2024;10(1):e140930. doi: https://doi.org/10.5812/jhrt-140930

Abstract

Background:

Polycystic Ovary Syndrome (PCOS) is a common endocrine and metabolic disorder in women. Several factors are thought to be affected by exercise, including insulin resistance (IR), FGF-21, and PNPLA3.

Objectives:

This study aimed to determine the effect of swimming training on IR, FGF-21, and PNPLA-3 gene expression in the liver of rats with PCOS.

Methods:

A total of 24 adult female Wistar rats were divided into four groups: Healthy control group, PCOS control group, healthy exercise group, and PCOS exercise group. Submaximal endurance swimming training was performed using different water flow rates from seven to 15 liters/minute for four weeks, five days per week for 60 minutes. The IR level and expression of FGF-21 and PNPLA3 genes were measured from the liver tissue. Data was analyzed using SPSS software (version 25) and one-way ANOVA (P < 0.05).

Results:

Based on the results, a significant difference in the amount of IR (P = 0.001), gene expression of FGF-21 (P = 0.001), and PNPLA-3 (P = 0.001) after four weeks of swimming training was decreased.

Conclusions:

Four weeks of swimming training improves the metabolic pathway and positively affects patients with PCOS.

Highlights

1. Background

Polycystic ovary syndrome (PCOS) is a highly prevalent condition that affects 5–21% of women globally between the ages of 18 and 45 who are fertile (1). Insulin resistance (IR), central obesity, and dyslipidemia are common conditions associated with PCOS (2). According to reports, women with PCOS have an irregular glucose metabolism brought on by IR or hyperinsulinemia, which increases their risk of developing type 2 diabetes (T2D) by five to seven times compared to normal patients (3). Insulin resistance is identified as an impaired biological response to insulin stimulation of target tissues, primarily the liver, muscle, and adipose tissue (4). The IR happens in the majority (65 - 90%) of obese patients and 25 - 45% in non-obese patients (5). IR has long-term effects on the metabolism of patients with PCOS (3). A diminished response to insulin stimulation characterizes it and inhibits hepatic glucose output (6). IR is an impairment of insulin to mediate metabolism in skeletal muscle, adipocytes, and liver (7).
Fibroblast growth factor 21 (FGF-21) is the 21st member of the FGF protein family and plays many biological roles, expressed in liver, muscle, and adipose tissue (8). Studies have shown that FGF-21 levels are increased in T2D, PCOS, metabolic syndrome, obesity, and cardiovascular disorders (9). FGF-21 levels are involved in inflammation and oxidative stress as well as post-exercise changes (10) and increase insulin content in pancreatic β-cells (11, 12). Studies show that FGF-21 is strongly associated with exercise intervention and improves metabolic status (8). However, high resting FGF-21 concentrations indicate resistance to FGF-21 (13). According to the results, long-term exercise reduces circulating FGF-21 levels in obese people (8). Therefore, this information suggests that FGF-21 resistance due to hepatic fat accumulation is an important risk factor for metabolic diseases (13).
The PNPLA-3 (patatin-like phospholipase domain-contained-3) gene, also known as adipanotrin, is a major determinant of interindividual and racial differences in liver fat content. The results showed that the PNPLA-3 gene is closely related to fat accumulation in hepatocytes (14), plays a major role in the occurrence of none alcoholic fatty liver disease (NAFLD) (15), and is significantly associated with the development of the disease (14). The PNPLA-3 gene encodes a 481 amino acid protein (16) and is highly expressed in liver and adipose tissues (17). The PNPLA3 protein has lipase activity and can hydrolyze triglycerides (18). Hyperandrogenism plays an essential role in fatty liver in women with PCOS (2). This protein is expressed in the endoplasmic reticulum and lipid membrane of liver cells and adipose tissue (14), which may be reversible with weight loss, exercise, and proper diets (6).

2. Objectives

This study aimed to investigate the effect of four weeks of swimming training on insulin resistance and hepatokines in rats with PCOS.

3. Methods

In this experimental study, 24 adult Wistar rats (weighing approximately 180 ± 20 grams) were maintained at 23 ± 2 degrees and a humidity of 40 to 60% with a circadian rhythm of 12 to 12 hours and the same conditions. Additionally, a hormonal stimulation with estradiol valerate (4mg in 0.2 mL sesame oil) was injected intramuscularly into the animals to induce PCOS. Vaginal smear testing is performed daily for sixty days until changes in the estrous cycle and its abnormalities reach the Persistent Vaginal Cornification (PVC) Pap smear stage. After confirmation of polycystic disease, PCOS and healthy mice were randomly divided into four experimental groups (six mice per group). Group 1: Healthy controls. Group 2: PCOS control group. Group 3: Healthy exercise group and group 4: PCOS exercise group. Swimming training is conducted for four weeks, five sessions per week, after two weeks of adaptation to the new environment. According to the procedure, 60 minutes was assigned until the end of the program, and the water flow rate was increased from seven to 15L/M (19) (Table 1). Specialized swimming pool for mice, fiberglass water tank with dimensions: 110 cm length, 35 cm height, 50 cm width, and a capacity of 200 liters with the body material is polyethylene. All rats were anesthetized and operated on by sequential intraperitoneal injection of Ketamine (90 mg/kg) and Xylazine (10 mg/kg) 48 hours after the last training session and after 12 to 14 hours of fasting. Blood samples were measured using enzymatic calorimetry using glucose oxidase technology using a glucose kit (Yakhte Pajohan Sarai, Iran). Fasting serum insulin concentrations were measured using the Elisa Rat Insulin kit manufactured by Elabscience, USA, using the sandwich ELISA method. Regarding sensitivity, the minimum measurement value is 0.19mg/mL, and its detection range is 20 - 30 mg/mL. In addition, the HOMA_IR method was used to calculate the insulin resistance index:
HOMA IR = (Fasting insulin (μU/mL) × Fasting blood sugar (mmol/L)) 22.5.
Table 1.
Four Weeks of Swimming Training Program
DaysDuration (Min)
Water Speed 7L/MWater Speed 15L/M
First WeekSecond WeekThird_4th Weeks
First103560
Second154060
Third204560
Fourth255060
Fifth305560
Liver tissue was cut off and stored in a laboratory refrigerator until RNA extraction, and the Roje RT-ROSET kit was used to generate cDNA. Real-time PCR was performed using the ∆∆Ct calculation method (Table 2). The ethical code of this study is IR.IAU.SRB.REC.1400.187.
Table 2.
Genes Primer Forwarding
GenesAccession NumberProduct Size (bp)ReverseForward
PNPLA-3NM_001282324.1159GCATCCACCACTTCGTCTTTGCAACATTAACAAGTGCGTCAGAG
FGF-21NM_130752.1128GGTGTCCTGGTCGTCATCTGGTCTCCTGCTGCCTGTCTTC
Abbreviations: FGF21, fibroblast growth factor 21; PNPLA3, patatin-like phospholipase domain-containe3.
Statistical analysis was performed using SPSS software version 25.0. The normality of the quantitative data was confirmed by the Shapiro-Wilk test. One-way analysis of variance (ANOVA) was used to determine gene expression, and all variables with P < 0.5 were achieved.

4. Results

According to the Shapiro-Wilk test results and the observed significance level, the data distribution of IR, FGF-21, and PNPLA-3 genes in the groups is normal. In addition, the variance homogeneity of the study was estimated by Levine's test. The results of the one-way ANOVA test showed that the level of IR (P = 0.001) and the expression of the FGF-21 (P = 0.001), PNPLA3 (P = 0.001) genes was significant (Table 3) (Figures 1 , 2 and 3).
Table 3.
One-way ANOVA Results
VariablesSum of SquaresDFMean SquareFSig.
PNPLA3
Between groups2.24130.747187.2540.001
Within groups0.080200.004
Total2.32023
FGF_21
Between groups1.51830.506109.8640.001
Within groups0.092200.005
Total1.61023
IR
Between groups4.16131.38732.0560.001
Within groups0.865200.043
Total5.02623
Abbreviations: PNPLA3, patatin-like phospholipase domain-containe3; FGF21, fibroblast growth factor 21. IR, insulin resistance; DF, degree of freedom.
Changes in FGF-21 gene expression in the studied groups. All groups significantly decreased compared with PCOS control.
Figure 1.
Changes in FGF-21 gene expression in the studied groups. All groups significantly decreased compared with PCOS control.
Changes in PNPLA-3 gene expression in the studied groups. All groups significantly decreased compared with PCOS control.
Figure 2.
Changes in PNPLA-3 gene expression in the studied groups. All groups significantly decreased compared with PCOS control.
Changes in IR in the studied groups. All groups significantly decreased compared with PCOS control.
Figure 3.
Changes in IR in the studied groups. All groups significantly decreased compared with PCOS control.

5. Discussion

According to the induction of PCOS, the amount of IR, FGF-21, and PNPLA-3 increased. In this case, several investigations have found that PCOS women exhibited higher levels of fasting insulin, HOMA-IR (20), FGF21 (7), and PNPLA3, which were directly related to liver disease (14). The result shows four weeks of swimming training dramatically lowered the levels of IR and expression of FGF-21 and PNPLA-3 genes. In this sense, Jurczewska et al. showed that physical activity controls IR in women with PCOS (20). Additionally, Jungari et al. demonstrated that 85 - 90% of PCOS-affected women benefit from the combination therapy of physical activity, calorie restriction, and a high-protein diet (21). According to Stine et al., patients with NASH exhibited a significant reduction in serum FGF21 following aerobic exercise training (22) and improved the metabolism in skeletal muscle and liver (7). Studies have shown that serum FGF-21 concentrations in overweight middle-aged women were significantly reduced after a 3-month combined exercise program (resistance and endurance training) (13). Additionally, Matsui et al. found that after aerobic exercise (12 weeks/three times per week), plasma glucose and serum FGF-21 concentrations decreased in overweight/obese men (23). In this case, studies have indicated that exercise is associated with weight loss, BMI, IR, and inflammatory factors, which play a crucial role in reducing inflammation and increasing insulin sensitivity in PCOS patients (23-25) and FGF-21 as a hepatokine during aerobic exercise (26) regulates carbohydrate, lipid, and energy metabolism (22) that seems similar findings appear in our study. Researchers showed that five weeks of resistance training increased VO2max and decreased liver fat content, reducing FGF-21 levels (13). Further, Matsui et al. show that exercise training reduces plasma glucose and serum FGF21 concentrations (23). Nevertheless, the source of FGF21 is essential, and in this study, we confirmed that the expression of FGF21 was reduced in the liver. Additionally, Shabkhiz et al. demonstrated 12 weeks of resistance training-induced FGF-21 in older men with and without T2DM (27). However, previous studies have shown that the type of exercise, intensity (28), and duration (29) are effective in PCOS. Ma et al. demonstrate that, in mice suffering from myocardial infarction, different types of exercise training enhance the production of FGF-21 (30). Also, Jürimäe et al. show single endurance rowing training significantly increases FGF-21 levels in national-level female rowers (31). Meanwhile, the results of Motahari Rad et al. showed that 12 weeks of concurrent training did not influence FGF-21 of T2DM patients (32). Concurrent training probably sensitizes FGF-21 actions without changing the concentrations of FGF-21 in T2DM patients and could also relate to the training type. In addition, regular endurance exercise also reduces liver fat content and improves FGF-21 resistance (13), but the changes are different for different people during the same exercise (8). Moreover, Long-term (12 weeks) (33) and short-term (3 days) (34) physical interventions increased the expression of KLB, FGFR1, and FGFR2 in obese mice (33). Studies have revealed that exercise lowers blood sugar, which affects the circulation of FGF21 (23) and improves FGF-21 resistance (34). Furthermore, PNPLA-3 plays a vital role in the occurrence of NAFLD (17). In this case, Cinque et al. showed the PNPLA3 GG genotype abolished the effect of lifestyle and appeared as an independent risk factor for weight gain and NAFLD (35). In addition, Wang et al. concluded that physical activity and inactivity may modify the effects of PNPLA-3 type on NAFLD in children (36). Swimming can effectively improve insulin sensitivity and even prevent IR by influencing the expression of proteins involved in lipid metabolism and insulin signaling (37). During aerobic exercise, biochemical adaptations induce a cascade of physiological stimuli that increase oxygen uptake, free fatty acid oxidation, and circulating glucose as an energy source (38). Exercise provides positive clinical outcomes for women with PCOS. However, more knowledge about the molecular mechanisms facilitates this improvement (39). Studies have shown the importance of lifestyle in women with PCOS (40), and lifestyle factors such as diet and exercise can alter DNA methylation. Exercise is an effective non-pharmacological strategy to treat PCOS (38) and may reduce clinical symptoms in the long term (41).

5.1. Limitations

Although a decrease in FGF-21 and PNPLA-3 was observed after swimming exercise, morphological examination of the liver provided a more precise connection of the molecular cell layers. Therefore, hepatic NAFLD should be investigated in future research.

5.2. Conclusions

Submaximal endurance swimming training can decrease IR and the expression of FGF-21 and PNPLA-3 genes. Swimming training seems to positively affect PCOS patients by improving the metabolic pathway.

Footnotes

  • Authors' Contribution: Study concept and design: M. Kh.; analysis and interpretation of data: M. Kh, and M. Gh.; drafting of the manuscript: M. Gh, and F. Sh.; critical revision of the manuscript for important intellectual content: M. Gh.; statistical analysis: M. Kh. and F. Gh.

  • Conflict of Interests: We confirm no relevant financial or non-financial competing interests to this study.

  • Ethical Approval: This study was approved by the Ethics Committee of the Islamic Azad University Science and Research Branch. Tehran. Iran (IR.IAU.SRB.REC.1400.187 ).

  • Funding/Support: No funding was received for this study.

References

  • 1.
    Genazzani AD, Genazzani AR. Polycystic Ovary Syndrome as Metabolic Disease: New Insights on Insulin Resistance. TouchREV Endocrinol. 2023;19(1):71-7. [PubMed ID: 37313240]. [PubMed Central ID: PMC10258623]. https://doi.org/10.17925/EE.2023.19.1.71.
  • 2.
    Salva-Pastor N, Chavez-Tapia NC, Uribe M, Nuno-Lambarri N. Understanding the association of polycystic ovary syndrome and non-alcoholic fatty liver disease. J Steroid Biochem Mol Biol. 2019;194:105445. [PubMed ID: 31381969]. https://doi.org/10.1016/j.jsbmb.2019.105445.
  • 3.
    Hansen SL, Svendsen PF, Jeppesen JF, Hoeg LD, Andersen NR, Kristensen JM, et al. Molecular Mechanisms in Skeletal Muscle Underlying Insulin Resistance in Women Who Are Lean With Polycystic Ovary Syndrome. J Clin Endocrinol Metab. 2019;104(5):1841-54. [PubMed ID: 30544235]. https://doi.org/10.1210/jc.2018-01771.
  • 4.
    Freeman AM, Acevedo LA, Pennings N. Insulin Resistance. StatPearls. Treasure Island (FL); 2023.
  • 5.
    Anwar AA, Abdullah N, Padjalangi AN, Hamid F, Mappeware NA, Lukas E. Serum Leptin Concentration is Correlated to Insulin Resistance in Polycystic Ovary Syndrome (PCOS) Patients. Molecular and Cellular Biomedical Sciences. 2021;5(2). https://doi.org/10.21705/mcbs.v5i2.203.
  • 6.
    da Silva Rosa SC, Nayak N, Caymo AM, Gordon JW. Mechanisms of muscle insulin resistance and the cross-talk with liver and adipose tissue. Physiol Rep. 2020;8(19). e14607. [PubMed ID: 33038072]. [PubMed Central ID: PMC7547588]. https://doi.org/10.14814/phy2.14607.
  • 7.
    Anwar S, Shikalgar N, Ashraf N, Khan R. Exercise to Combat the Effect of Insulin Resistance in PCOS: A Narrative Review. Current Women s Health Reviews. 2023;19(4). https://doi.org/10.2174/1573404819666221128121141.
  • 8.
    Guo C, Zhao L, Li Y, Deng X, Yuan G. Relationship between FGF21 and drug or nondrug therapy of type 2 diabetes mellitus. J Cell Physiol. 2021;236(1):55-67. [PubMed ID: 32583417]. https://doi.org/10.1002/jcp.29879.
  • 9.
    Bednarska S, Fryczak J, Siejka A. Serum beta-Klotho concentrations are increased in women with polycystic ovary syndrome. Cytokine. 2020;134:155188. [PubMed ID: 32673996]. https://doi.org/10.1016/j.cyto.2020.155188.
  • 10.
    Larsen EL, Poulsen HE, Michaelsen C, Kjaer LK, Lyngbaek M, Andersen ES, et al. Differential time responses in inflammatory and oxidative stress markers after a marathon: An observational study. J Sports Sci. 2020;38(18):2080-91. [PubMed ID: 32530734]. https://doi.org/10.1080/02640414.2020.1770918.
  • 11.
    Yan J, Nie Y, Cao J, Luo M, Yan M, Chen Z, et al. The Roles and Pharmacological Effects of FGF21 in Preventing Aging-Associated Metabolic Diseases. Front Cardiovasc Med. 2021;8:655575. [PubMed ID: 33869312]. [PubMed Central ID: PMC8044345]. https://doi.org/10.3389/fcvm.2021.655575.
  • 12.
    Bookout AL, de Groot MH, Owen BM, Lee S, Gautron L, Lawrence HL, et al. FGF21 regulates metabolism and circadian behavior by acting on the nervous system. Nat Med. 2013;19(9):1147-52. [PubMed ID: 23933984]. [PubMed Central ID: PMC3769420]. https://doi.org/10.1038/nm.3249.
  • 13.
    Taniguchi H, Tanisawa K, Sun X, Kubo T, Higuchi M. Endurance Exercise Reduces Hepatic Fat Content and Serum Fibroblast Growth Factor 21 Levels in Elderly Men. J Clin Endocrinol Metab. 2016;101(1):191-8. [PubMed ID: 26562755]. https://doi.org/10.1210/jc.2015-3308.
  • 14.
    Lisboa QC, Nardelli MJ, Pereira PA, Miranda DM, Ribeiro SN, Costa RSN, et al. PNPLA3 and TM6SF2 polymorphisms in Brazilian patients with nonalcoholic fatty liver disease. World J Hepatol. 2020;12(10):792-806. [PubMed ID: 33200017]. [PubMed Central ID: PMC7643213]. https://doi.org/10.4254/wjh.v12.i10.792.
  • 15.
    Huh Y, Cho YJ, Nam GE. Recent Epidemiology and Risk Factors of Nonalcoholic Fatty Liver Disease. J Obes Metab Syndr. 2022;31(1):17-27. [PubMed ID: 35332111]. [PubMed Central ID: PMC8987457]. https://doi.org/10.7570/jomes22021.
  • 16.
    Tortora R, Rispo A, Alisi A, Imperatore N, Crudele A, Ferretti F, et al. PNPLA3 rs738409 Polymorphism Predicts Development and Severity of Hepatic Steatosis but Not Metabolic Syndrome in Celiac Disease. Nutrients. 2018;10(9). [PubMed ID: 30189691]. [PubMed Central ID: PMC6163162]. https://doi.org/10.3390/nu10091239.
  • 17.
    Xiang H, Wu Z, Wang J, Wu T. Research progress, challenges and perspectives on PNPLA3 and its variants in Liver Diseases. J Cancer. 2021;12(19):5937-5929. [PubMed ID: 34476007]. https://doi.org/10.7150/jca.57951.
  • 18.
    Pingitore P, Pirazzi C, Mancina RM, Motta BM, Indiveri C, Pujia A, et al. Recombinant PNPLA3 protein shows triglyceride hydrolase activity and its I148M mutation results in loss of function. Biochim Biophys Acta. 2014;1841(4):574-80. [PubMed ID: 24369119]. https://doi.org/10.1016/j.bbalip.2013.12.006.
  • 19.
    Mirdar S, Arab A, Hedayati M, Hajizade A. The effect of pregnant rat swimming on hypoxia-inducible factor-1α levels of neonatal lung. Tehran University Medical Journal. 2012;69(12).
  • 20.
    Jurczewska J, Ostrowska J, Chelchowska M, Panczyk M, Rudnicka E, Kucharski M, et al. Physical Activity, Rather Than Diet, Is Linked to Lower Insulin Resistance in PCOS Women-A Case-Control Study. Nutrients. 2023;15(9). [PubMed ID: 37432289]. [PubMed Central ID: PMC10180891]. https://doi.org/10.3390/nu15092111.
  • 21.
    Jungari M, Choudhary A, Gill NK. Comprehensive Management of Polycystic Ovary Syndrome: Effect of Pharmacotherapy, Lifestyle Modification, and Enhanced Adherence Counseling. Cureus. 2023;15(2). e35415. [PubMed ID: 36994287]. [PubMed Central ID: PMC10042521]. https://doi.org/10.7759/cureus.35415.
  • 22.
    Stine JG, Welles JE, Keating S, Hussaini Z, Soriano C, Heinle JW, et al. Serum Fibroblast Growth Factor 21 Is Markedly Decreased following Exercise Training in Patients with Biopsy-Proven Nonalcoholic Steatohepatitis. Nutrients. 2023;15(6). [PubMed ID: 36986211]. [PubMed Central ID: PMC10056327]. https://doi.org/10.3390/nu15061481.
  • 23.
    Matsui M, Kosaki K, Myoenzono K, Yoshikawa T, Park J, Kuro OM, et al. Effect of Aerobic Exercise Training on Circulating Fibroblast Growth Factor-21 Response to Glucose Challenge in Overweight and Obese Men: A Pilot Study. Exp Clin Endocrinol Diabetes. 2022;130(11):723-9. [PubMed ID: 35850467]. https://doi.org/10.1055/a-1902-3872.
  • 24.
    Jafari S, Taghian F. The effect of aerobic exercise training on biochemical and inflammatory markers among young females suffering from polycystic ovary syndrome. Journal of Midwifery and Reproductive Health. 2020;8(2):2194-202.
  • 25.
    Kahraman S, Altinova AE, Yalcin MM, Gulbahar O, Arslan B, Akturk M, et al. Association of serum betatrophin with fibroblast growth factor-21 in women with polycystic ovary syndrome. J Endocrinol Invest. 2018;41(9):1069-74. [PubMed ID: 29363048]. https://doi.org/10.1007/s40618-018-0831-2.
  • 26.
    Porflitt-Rodriguez M, Guzman-Arriagada V, Sandoval-Valderrama R, Tam CS, Pavicic F, Ehrenfeld P, et al. Effects of aerobic exercise on fibroblast growth factor 21 in overweight and obesity. A systematic review. Metabolism. 2022;129:155137. [PubMed ID: 35038422]. https://doi.org/10.1016/j.metabol.2022.155137.
  • 27.
    Shabkhiz F, Khalafi M, Rosenkranz S, Karimi P, Moghadami K. Resistance training attenuates circulating FGF-21 and myostatin and improves insulin resistance in elderly men with and without type 2 diabetes mellitus: A randomised controlled clinical trial. Eur J Sport Sci. 2021;21(4):636-45. [PubMed ID: 32345132]. https://doi.org/10.1080/17461391.2020.1762755.
  • 28.
    Ramanjaneya M, Abdalhakam I, Bettahi I, Bensila M, Jerobin J, Aye MM, et al. Effect of Moderate Aerobic Exercise on Complement Activation Pathways in Polycystic Ovary Syndrome Women. Front Endocrinol (Lausanne). 2021;12:740703. [PubMed ID: 35250845]. [PubMed Central ID: PMC8892582]. https://doi.org/10.3389/fendo.2021.740703.
  • 29.
    Santos IKD, Nunes F, Queiros VS, Cobucci RN, Dantas PB, Soares GM, et al. Effect of high-intensity interval training on metabolic parameters in women with polycystic ovary syndrome: A systematic review and meta-analysis of randomized controlled trials. PLoS One. 2021;16(1). e0245023. [PubMed ID: 33465123]. [PubMed Central ID: PMC7815156]. https://doi.org/10.1371/journal.pone.0245023.
  • 30.
    Ma Y, Kuang Y, Bo W, Liang Q, Zhu W, Cai M, et al. Exercise Training Alleviates Cardiac Fibrosis through Increasing Fibroblast Growth Factor 21 and Regulating TGF-beta1-Smad2/3-MMP2/9 Signaling in Mice with Myocardial Infarction. Int J Mol Sci. 2021;22(22). [PubMed ID: 34830222]. [PubMed Central ID: PMC8623999]. https://doi.org/10.3390/ijms222212341.
  • 31.
    Jurimae J, Vaiksaar S, Purge P, Tillmann V. Irisin, Fibroplast Growth Factor-21, and Follistatin Responses to Endurance Rowing Training Session in Female Rowers. Front Physiol. 2021;12:689696. [PubMed ID: 34149463]. [PubMed Central ID: PMC8212044]. https://doi.org/10.3389/fphys.2021.689696.
  • 32.
    Motahari Rad M, Bijeh N, Attarzadeh Hosseini SR, Raouf Saeb A. The effect of two concurrent exercise modalities on serum concentrations of FGF21, irisin, follistatin, and myostatin in men with type 2 diabetes mellitus. Arch Physiol Biochem. 2023;129(2):424-33. [PubMed ID: 33044849]. https://doi.org/10.1080/13813455.2020.1829649.
  • 33.
    Willis SA, Sargeant JA, Thackray AE, Yates T, Stensel DJ, Aithal GP, et al. Effect of exercise intensity on circulating hepatokine concentrations in healthy men. Appl Physiol Nutr Metab. 2019;44(10):1065-72. [PubMed ID: 31453723]. https://doi.org/10.1139/apnm-2018-0818.
  • 34.
    Geng L, Liao B, Jin L, Huang Z, Triggle CR, Ding H, et al. Exercise Alleviates Obesity-Induced Metabolic Dysfunction via Enhancing FGF21 Sensitivity in Adipose Tissues. Cell Rep. 2019;26(10):2738-2752 e4. [PubMed ID: 30840894]. https://doi.org/10.1016/j.celrep.2019.02.014.
  • 35.
    Cinque F, Cespiati A, Lombardi R, Costantino A, Maffi G, Alletto F, et al. Interaction between Lifestyle Changes and PNPLA3 Genotype in NAFLD Patients during the COVID-19 Lockdown. Nutrients. 2022;14(3). [PubMed ID: 35276911]. [PubMed Central ID: PMC8838646]. https://doi.org/10.3390/nu14030556.
  • 36.
    Wang S, Song J, Shang X, Chawla N, Yang Y, Meng X, et al. Physical activity and sedentary behavior can modulate the effect of the PNPLA3 variant on childhood NAFLD: a case-control study in a Chinese population. BMC Med Genet. 2016;17(1):90. [PubMed ID: 27905898]. [PubMed Central ID: PMC5134284]. https://doi.org/10.1186/s12881-016-0352-9.
  • 37.
    Song A, Wang C, Ren L, Zhao J. Swimming improves high-fat induced insulin resistance by regulating lipid and energy metabolism and the insulin pathway in rats. Int J Mol Med. 2014;33(6):1671-9. [PubMed ID: 24715199]. https://doi.org/10.3892/ijmm.2014.1738.
  • 38.
    Dos Santos IK, Ashe MC, Cobucci RN, Soares GM, de Oliveira Maranhao TM, Dantas PMS. The effect of exercise as an intervention for women with polycystic ovary syndrome: A systematic review and meta-analysis. Medicine (Baltimore). 2020;99(16). e19644. [PubMed ID: 32311937]. [PubMed Central ID: PMC7220722]. https://doi.org/10.1097/MD.0000000000019644.
  • 39.
    Hiam D, Patten R, Gibson-Helm M, Moreno-Asso A, McIlvenna L, Levinger I, et al. The effectiveness of high intensity intermittent training on metabolic, reproductive and mental health in women with polycystic ovary syndrome: study protocol for the iHIT- randomised controlled trial. Trials. 2019;20(1):221. [PubMed ID: 30992038]. [PubMed Central ID: PMC6469064]. https://doi.org/10.1186/s13063-019-3313-8.
  • 40.
    Mirghafourvand M, Charandabi SM, Lak TB, Aliasghari F. Relationship between health-promoting lifestyle and quality of life in women with polycystic ovarian syndrome. International Journal of Women’s Health and Reproduction Sciences. 2017;5(4):318-23.
  • 41.
    Wright PJ, Corbett CF, Pinto BM, Dawson RM, Wirth M. Resistance Training as Therapeutic Management in Women with PCOS: What is the Evidence? Int J Exerc Sci. 2021;14(3):840-54. [PubMed ID: 34567361]. [PubMed Central ID: PMC8439708].

Copyright

Copyright © 2024, Journal of Health Reports and Technology. This open-access article is available under the Creative Commons Attribution-NonCommercial 4.0 (CC BY-NC 4.0) International License (https://creativecommons.org/licenses/by-nc/4.0/), which allows for the copying and redistribution of the material only for noncommercial purposes, provided that the original work is properly cited.

Similar Articles

28
Jan
2020
The Effect of 12 Weeks of Intense Interval Training on Changes in Adipose Levels and Visceral Adiposity Index in Women with Polycystic Ovary Syndrome

The Effect of 12 Weeks of Intense Interval Training on Changes in Adipose Levels and Visceral Adiposity Index in Women with Polycystic Ovary Syndrome

Bahar Faryadian,
Naser Behpoor,
Vahid Taedibi

Faryadian B, Behpoor N, Taedibi V. The Effect of 12 Weeks of Intense Interval Training on Changes in Adipose Levels and Visceral Adiposity Index in Women with Polycystic Ovary Syndrome. J Health Rep Technol. 2020;6(1):e97401. doi: https://doi.org/10.5812/ijhls.97401

6
Jun
2020
Home Based Aerobic Training and the Changes in Adipsin Levels and Visceral Adiposity Index (VAI) in Women with Polycystic Ovary Syndrome

Home Based Aerobic Training and the Changes in Adipsin Levels and Visceral Adiposity Index (VAI) in Women with Polycystic Ovary Syndrome

Nahid Mohammadi Javid,
Nasser Behpoor,
Vahid Tadibi

Mohammadi Javid N, Behpoor N, Tadibi V. Home Based Aerobic Training and the Changes in Adipsin Levels and Visceral Adiposity Index (VAI) in Women with Polycystic Ovary Syndrome. J Health Rep Technol. 2020;6(2):e97400. doi: https://doi.org/10.5812/ijhls.97400

28
Feb
2010

The Effect of Exercise in PCOS Women Who Exercise Regularly

Afsaneh Khademi,
Ashraf Alleyassin,
Marzieh Aghahosseini,
Leila Tabatabaeefar,
Mehrnoosh Amini

Khademi A, Alleyassin A, Aghahosseini M, Tabatabaeefar L, Amini M. The Effect of Exercise in PCOS Women Who Exercise Regularly. Asian J Sports Med. 2010;1(1):34874. doi: https://doi.org/10.5812/asjsm.34874

9
Feb
2025
The Relationship Between Nutritional Patterns and Physical Activity in Adolescents with Polycystic Ovary Syndrome

The Relationship Between Nutritional Patterns and Physical Activity in Adolescents with Polycystic Ovary Syndrome

Nasim Partash,
Sepideh Rezaii Ghamsari,
Zeinab Eidi Shirinbolagh,
Elham Ebrahimi

Partash N, Rezaii Ghamsari S, Eidi Shirinbolagh Z, Ebrahimi E. The Relationship Between Nutritional Patterns and Physical Activity in Adolescents with Polycystic Ovary Syndrome. J Nurs Midwifery Sci. 2025;12(1):e153735. doi: https://doi.org/10.5812/jnms-153735

3
Feb
2019
The Effect of a Conventional Resistance Training Course on Some of the Inflammatory Factors in Obese Men with Non-Alcoholic Fatty Liver

The Effect of a Conventional Resistance Training Course on Some of the Inflammatory Factors in Obese Men with Non-Alcoholic Fatty Liver

Gholamreza Salvand,
Masoud Nikbakht,
Saeed Shakerian

Salvand G, Nikbakht M, Shakerian S. The Effect of a Conventional Resistance Training Course on Some of the Inflammatory Factors in Obese Men with Non-Alcoholic Fatty Liver. Jundishapur J Chronic Dis Care. 2019;8(2):e87798. doi: https://doi.org/10.5812/jjcdc.87798

More by these authors

Maryam KhalilinejadPubMedScholar
Mandana GholamiPubMedScholar
Fereshteh Shahmohammadi DermaniPubMedScholar
Farshad GhazalianPubMedScholar
Share
Cited by
Metrics