1. Background
Seizures arise from abnormal electrical activity in brain neurons, leading to impaired neuronal signaling and synaptic transmission, which often result in altered consciousness and involuntary movements (1, 2). The recurrent occurrence of seizures defines epilepsy (3), a neurological disorder affecting approximately 50 million people worldwide, making it one of the most prevalent neurological conditions globally (4). Epilepsy imposes a significant burden on healthcare systems and is associated with increased risks of disability and mortality (5). Despite the availability of numerous antiepileptic drugs, many patients experience adverse effects, drug resistance, and inadequate seizure control (6, 7). Highlighting the urgent need for novel and effective therapeutic strategies (8). Recently, considerable attention has focused on natural and plant-derived compounds as potential therapeutic agents (9). Eucalyptol (1,8-cineole) is a monocyclic monoterpene ether present in various essential oils, particularly from the genus Eucalyptus. It has demonstrated therapeutic potential in treating respiratory disorders such as bronchitis, sinusitis, and asthma, partly through reducing inflammatory mediators in experimental models (10, 11). Furthermore, eucalyptol exhibits antioxidative, and neuroprotective properties, with reported benefits in brain injury and Alzheimer’s disease (12, 13). Notably, it has been shown to modulate seizure onset and protect against neuronal damage in pilocarpine-induced seizure models (14).
Nitric oxide (NO) is a versatile signaling molecule in the central nervous system, involved in neuromodulation, neuroinflammation, neurotransmission, and neurotoxicity. Its role in seizures is complex and influenced by factors such as regional brain distribution, NO production levels, and receptor interactions (15). Nitric oxide is synthesized from L-arginine by three nitric oxide synthase (NOS) isoforms: Inducible (16), endothelial (eNOS), and neuronal (nNOS) (17). Dysregulation of NOS isoforms has been implicated in seizure pathophysiology (18).
2. Objectives
The present study aimed to evaluate the anti-seizure effects of eucalyptol in a pentylenetetrazol (PTZ)-induced seizure model in mice and to investigate whether these effects are mediated through the NO pathway.
3. Methods
3.1. Animals
Seventy-two male NMRI mice (20 - 30 g, approximately 8 weeks old) were obtained from the Pasteur Institute, Tehran, Iran. Animals were housed under standard laboratory conditions at the Animal Science Center of Shahr-e-Kord University of Medical Sciences, with a 12-hour light/dark cycle, temperature of 21 ± 5°C, humidity of 50 ± 2%, and free access to food and water. All procedures complied with the National Guide for the Care and Use of Laboratory Animals (9th edition, 2021) and were approved by the ethics committee of the university. Mice were randomly assigned to nine groups (n = 8 per group): Control (normal saline, 1 mL/kg), PTZ + eucalyptol (30, 100, 300, and 600 mg/kg), PTZ + L-NAME (10 mg/kg), PTZ + L-arginine (45 mg/kg), PTZ + L-NAME + eucalyptol (30 mg/kg), and PTZ + L-arginine + eucalyptol (600 mg/kg)
3.2. Pentylenetetrazol-Seizure Induce Protocol and Eucalyptol Administration
Eucalyptol was dissolved in physiological saline and administered intraperitoneally at doses of 30, 100, 300, and 600 mg/kg, 30 minutes prior to seizure induction. L-NAME and L-arginine were administered 45 minutes before the PTZ injection. Seizures were induced by intravenous infusion of PTZ dissolved in physiological saline. A 30-gauge winged infusion set was carefully inserted into the tail vein of conscious, freely moving mice. Proper needle placement was confirmed by blood reflux. Pentylenetetrazol was infused at 5 mg/mL using a pump until the onset of forelimb clonus, followed by generalized clonus, considered as the seizure threshold. The minimal PTZ dose inducing generalized clonus was recorded as the seizure threshold (19). Seizure threshold (mg/kg) was calculated as (20):
After experiments, mice were anesthetized with ketamine (20 mg/kg) and xylazine (10 mg/kg) intraperitoneally. Blood was collected via cardiac puncture, and hippocampal tissues were dissected and stored at -70°C until analysis.
3.3. Brain and Serum Total Antioxidant Capacity
Total antioxidant capacity (TAC) in plasma and hippocampal tissue was measured using the ferric-reducing ability of plasma (FRAP) assay. Samples were incubated with 2,4,6-tripyridyl-s-triazine (TPTZ) reagent, sodium acetate buffer, and ferric chloride solution at 37°C for 30 minutes. Antioxidants reduce Fe3⁺ to Fe2⁺, forming a blue complex measured spectrophotometrically at 593 nm. The TAC values were determined by comparison to a standard curve and expressed as µmol/L (21, 22).
3.4. Brain and Serum Malondialdehyde Level
Malondialdehyde levels in serum and hippocampal tissue were quantified via the thiobarbituric acid (TBA) assay. Samples reacted with TBA in acidic conditions and were heated to 95°C, forming an MDA-TBA complex with a pink color, measured at 532 nm. Concentrations were calculated from an MDA standard curve and expressed as µg/mL (23, 24).
3.5. Nitric Oxide Content of the Hippocampus
The NO levels in hippocampal samples were determined by Griess assay, which quantifies nitrite (NO2-), a stable NO metabolite. Fifty microliters of the sample were mixed with 50 μL Griess reagent (sulfanilamide and NED solutions) in a 96-well plate and incubated for 10 minutes. Absorbance was read at 520 - 550 nm within 30 minutes. Nitrite concentration was calculated using a standard curve (25).
3.6. Real-time PCR
Expression of iNOS and nNOS genes was measured by quantitative real-time PCR. Total RNA was extracted from hippocampal tissues using RNX-Plus reagent (Sinaclon Co., Cat. No.: Ex6101). Complementary DNA (cDNA) was synthesized with the PrimeScript RT reagent kit (Takara Bio, Japan). The PCR amplification was performed using SYBR Premix Ex Taq (Takara Bio) on a LightCycler system (Roche Diagnostics). Reactions were run in triplicate and repeated twice for accuracy. Beta-2 microglobulin (B2M) served as the housekeeping gene. Relative gene expression was calculated using the 2-ΔΔCt method (26). Primer sequences are listed in Table 1.
Table 1.The Sequence of Primer Utilization in PCR Administration
| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| B2m | GGAAGTTGGGCTTCCCATTCT | CGTGATCTTTCTGGTGCTTGTC |
| iNOS | CCAACAGGAGAAGGGGACGAA | GGACATCAAAGGTCTCACAGG |
| nNOS | GGCTGTGCTTTGATGGAGATG | AGAATAGGAGGAGACGCTGTTGA |
Abbreviation: B2m, beta-2 microglobulin.
3.7. Statistical Analysis
Data were analyzed using GraphPad Prism software and expressed as mean ± SEM. One-way ANOVA followed by Tukey’s post hoc test was used for multiple group comparisons. Two-way ANOVA assessed the interaction effect of NO modulation on eucalyptol’s anti-seizure activity. Statistical significance was set at P < 0.05.
4. Results
4.1. Eucalyptol Increased the Seizure Threshold
Figure 1 illustrates the effect of administering different doses of eucalyptol 30 minutes prior to PTZ infusion on the latency to clonus onset in mice. Statistical analysis revealed that treatment with eucalyptol at doses of 300 and 600 mg/kg significantly increased the seizure threshold compared to the saline-treated PTZ group (P < 0.01 and P < 0.001, respectively).
Figure 1.
Effect of eucalyptol at various doses on seizure threshold. Data are presented as mean ± SEM. Statistical comparisons were performed using one-way ANOVA followed by Tukey’s multiple comparison test. E: Eucalyptol doses in mg/kg. ** P < 0.01, **** P < 0.0001 versus the saline-treated pentylenetetrazol (PTZ) group.
4.2. The Role of the Nitric Oxide Pathway in Eucalyptol’s Anti-seizure Effects
The second phase of the study aimed to determine whether the anti-seizure effects of eucalyptol are mediated through the NO pathway. To explore this, the non-selective NOS inhibitor L-NAME and the NO precursor L-arginine were administered both alone and in combination with eucalyptol prior to PTZ-induced seizure induction. Additionally, nitrite levels were measured in isolated hippocampal tissue samples.
As shown in Figure 2A, treatment with L-NAME alone did not produce a significant change in seizure threshold. However, when combined with a sub-effective dose of eucalyptol (30 mg/kg), L-NAME significantly enhanced the anti-seizure effect compared to the saline-treated PTZ group [F(1,16) = 14.18, P = 0.0017].
Conversely, Figure 2A shows that L-arginine alone did not significantly affect seizure threshold. Nevertheless, co-administration of L-arginine with an effective dose of eucalyptol (600 mg/kg) notably augmented eucalyptol’s anti-seizure effect relative to the saline-treated PTZ group [F(1,16) = 6.62, P = 0.02].
Figure 2B depicts the hippocampal nitrite levels across experimental groups. Both 300 and 600 mg/kg doses of eucalyptol significantly decreased NO levels compared to the saline-treated PTZ group (P < 0.001). Significant reductions were also observed in groups treated with L-NAME alone, L-NAME combined with eucalyptol (30 mg/kg), and L-arginine combined with eucalyptol (600 mg/kg), compared to the saline-treated PTZ group (P < 0.01, P < 0.001, and P < 0.001, respectively).
Figure 2.
Mediation of eucalyptol’s anti-seizure effect via the nitric oxide (NO) pathway. Data are presented as mean ± SEM and analyzed by one-way ANOVA followed by Tukey’s post-hoc test. A, effects of L-NAME or L-arginine, alone and combined with eucalyptol, on pentylenetetrazol (PTZ)-induced seizure threshold; B, brain nitrite content across groups. Statistical significance is indicated as follows: * P < 0.05, *** P < 0.001, **** P < 0.0001 versus saline-treated PTZ group; ####P < 0.0001 versus eucalyptol (30 mg/kg)-treated PTZ group; # P < 0.05 versus eucalyptol (600 mg/kg)-treated PTZ group; $$$$P < 0.0001 versus L-NAME-treated PTZ group.
4.3. Eucalyptol Increased Total Antioxidant Capacity in the Brain and Serum
Figure 3A shows that administration of eucalyptol at doses of 300 and 600 mg/kg significantly increased TAC in the brain compared to the saline-treated PTZ group (P < 0.001). Similarly, as illustrated in Figure 3B, the 600 mg/kg dose of eucalyptol significantly restored serum TAC levels in convulsive animals relative to the saline-treated PTZ group (P < 0.001).
Figure 3.
Effect of eucalyptol on total antioxidant capacity (TAC) in A, brain; and B, serum. Data are presented as mean ± SEM and analyzed using one-way ANOVA with Tukey’s multiple comparison test. E: Eucalyptol at indicated doses. * P < 0.05, *** P < 0.001 versus saline-treated pentylenetetrazol (PTZ) group.
4.4. Eucalyptol Decreased Malondialdehyde Levels in the Brain and Serum
Eucalyptol significantly reduced MDA levels in both brain and serum tissues. As shown in Figure 4A, administration of eucalyptol at doses of 100, 300, and 600 mg/kg resulted in significant reductions in brain MDA levels compared to the saline-treated PTZ group (P < 0.001, P < 0.01, and P < 0.001, respectively).
Similarly, Figure 4B illustrates that serum MDA levels were significantly decreased in animals treated with 100, 300, and 600 mg/kg of eucalyptol relative to the saline-treated PTZ group (P < 0.01 and P < 0.001, respectively).
Figure 4.
Effect of eucalyptol on MDA levels in the A, brain; and B, serum. Data are presented as mean ± SEM and were analyzed using one-way ANOVA followed by Tukey’s multiple comparison test. E: Eucalyptol at different doses. ** P < 0.01 and *** P < 0.001 compared to the saline-treated pentylenetetrazol (PTZ) group.
4.5. Eucalyptol Downregulated the Expression of iNOS and nNOS Genes
Real-time PCR results measuring the expression levels of iNOS and nNOS genes are presented in Figure 5A and B. The saline-treated PTZ group showed significant overexpression of both iNOS and nNOS genes compared to the control group (P < 0.001).
Statistical analysis revealed that administration of 600 mg/kg eucalyptol significantly reduced iNOS gene expression compared to the saline-treated PTZ group (Figure 5 P < 0.01). However, as shown in Figure 5B, eucalyptol did not significantly suppress nNOS gene expression at the effective doses when compared to the saline-treated PTZ group.
Figure 5.
Downregulation of A, iNOS; and B, nNOS gene expression by eucalyptol. Data are presented as mean ± SEM and analyzed using one-way ANOVA with Tukey’s multiple comparison test. E: Eucalyptol at various doses. ** P < 0.01, **** P < 0.0001 versus saline-treated control group; ## P < 0.01 versus saline-treated pentylenetetrazol (PTZ) group.
5. Discussion
This study investigated the effects of eucalyptol administered at various dose on a mouse model of PTZ-induced seizures. Our findings demonstrate that eucalyptol dose-dependently increased the seizure threshold and improved seizure control. Notably, eucalyptol elevated TAC while reducing MDA and NO levels following seizure induction. Moreover, the effective dose of eucalyptol significantly downregulated inducible NOS (16) gene expression. The anti-seizure effect was enhanced by co-administration with the NOS inhibitor L-NAME, while the NO precursor L-arginine attenuated eucalyptol’s protective properties. Herbal compounds such as eucalyptol are known for their antioxidant properties and neuroprotective potential in preventing seizures (27). In line with this, Hoch et al. reported that eucalyptol reduces neuronal excitability by depolarizing membrane potentials (11). Similarly, other studies have shown that eucalyptol prevents hyperexcitability in pilocarpine-induced seizures through oxidative stress inhibition (14). Sobreira Dantas Nobrega de Figueiredo et al. demonstrated its protective effect in a PTZ-induced seizure model (28). de Almeida et al. also reported anti-seizure effects of Ocimum basilicum, which contains 1,8-cineole (eucalyptol) as a major component (29). Pentylenetetrazol induces seizures primarily via antagonism of GABA_A receptors and imbalance of excitatory and inhibitory neurotransmission, leading to increased oxidative stress and generation of reactive oxygen species (ROS) and reactive nitrogen species (RNS) (30-32). This is associated with increased levels of H2O2, O2−•, nitrite, malonaldehyde, 4-hydroxynonenal. Oxidative stress plays an important role in the seizure pathophysiology (33). Excessive ROS and RNS disrupt redox homeostasis and cause lipid peroxidation, reflected by elevated MDA levels (34-36). Our study confirms that eucalyptol enhances antioxidant defenses, consistent with prior findings that 1,8-cineole attenuates neuronal oxidative stress (12, 37-39). The NO/NOS pathway plays a pivotal role in neurodegeneration and seizure pathophysiology (40-42). While NO serves important physiological functions in neurotransmission and cerebral blood flow (43), its excessive production contributes to neurotoxicity and seizure propagation (44). Pentylenetetrazol-induced seizures may be exacerbated by NO through modulation of NMDA and GABA_A receptor activity (45). Consistent with previous studies, our data show that inhibition of NO synthesis via L-NAME potentiates eucalyptol’s anti-seizure effects, whereas L-arginine mitigates them (18, 46, 47). A limitation of our study is the lack of isoform-specific NOS inhibitors, preventing definitive identification of the NOS isoform involved. However, real-time PCR results indicated that eucalyptol selectively downregulates iNOS expression without a significant effect on neuronal NOS (nNOS). This aligns with reports demonstrating that eucalyptol reduces iNOS expression and associated neural damage, thereby enhancing seizure tolerance (48-51).
It is important to acknowledge that some studies have reported pro-convulsive effects of eucalyptus extracts when inhaled or ingested (52-56). These discrepancies may stem from differences in extract composition, dosage, route of administration, or interactions among multiple bioactive compounds. Since eucalyptol was administered in purified form in our study, our findings specifically reflect its direct effects, which include neuromodulatory, anti-inflammatory, and antioxidant actions that reduce neuronal excitability (11, 27, 28).
5.1. Conclusions
Our results demonstrate that eucalyptol exerts dose-dependent neuroprotective and anti-seizure effects in a PTZ-induced seizure mouse model. These effects are likely mediated through suppression of the NO pathway, particularly via downregulation of iNOS gene expression, along with enhancement of antioxidant capacity and reduction of lipid peroxidation. Eucalyptol administration significantly delayed seizure onset, suggesting potential therapeutic value. Future studies should explore the precise molecular mechanisms involved, including the use of isoform-specific NOS inhibitors.
