1. Background
Pulmonary tuberculosis (TB) caused by Mycobacterium tuberculosis (MTB), is still a public health concern, and leading cause of morbidity and mortality throughout the world, especially in Africa and Asia (1). Based on the world health organization report, the incidence and mortality rates from tuberculosis were 9.6 million new cases and 1.5 million deaths in 2014 (1). Approximately one third of the world’s population has been latently infected with TB, while 10% of the infected individuals developed active TB, which indicates that host genetic factors play a critical role in developing clinical symptom of TB (2-4). Several cytokines participate in control of MTB infection. Interleukine-12 (IL-12) is an important immunoregulatory cytokine that is naturally produced by phagocytic cells such as dendritic cells, macrophages and neutrophils in response to antigenic stimulation (5). It induced IFN-γ production from T cells and has an important role in macrophage activation for controlling mycobacterium infection (6). Interleukine-12 takes part in differentiation and development of T cells into Th1 cells and forms a link between innate and acquired immune responses (5). Interleukine-12 made of two subunit, p35 (light chain) and p40 (heavy chain), that is encodes by two separate genes IL-12A and IL-12B, respectively. The IL-12A gene is located on chromosome 3 (3p12), whereas IL12B gene is located on chromosome 5 (5q31) (7). IL-12R is a heterodimeric receptor expressed on NK cells and activated Th1 cells. It consists of IL-12R-β1 and beta IL-12R-β2 subunits. These subunits are responsible for signaling through the JAK/STAT pathway (8). Reduced expression of IL12Rβ can cause immunodeficiency of MTB patients (9). Several studies have shown the association among IL-12A, IL12-B and its receptor polymorphism with the risk of TB but the results were controversial (10-13). Therefore, the present case-control study was designed to investigate the possible association between IL12A rs568408, IL12B rs3212227 and IL-12R rs383483 polymorphisms and PTB in a sample of southeast Iranian population.
2. Methods
This case-control study was conducted on 174 patients with PTB (newly diagnosed PTB cases and underwent treatment subjects for PTB) who referred to university-affiliated hospital center for TB (Bou-Ali hospital, Zahedan, Iran) from February to October 2012. The study was approved by the local ethics committee of Zahedan University of Medical Sciences (Ir.zaums.Rec.1390.1240) and written informed consent was taken from all subjects participated in the study according to guidelines from the ethical committee. Pulmonary tuberculosis was confirmed by clinical symptoms, radiological evidence and positive sputum smear for acid-fast bacilli (14-16). The control group consisted of 177 healthy subjects with no history of TB or pulmonary disease and had no inflammatory disease or a history of the chronic infectious disease. All patients with PTB and healthy individuals were from the same geographical origin (Zahedan, southeast Iran). Blood samples were collected in tubes containing EDTA and genomic DNA was extracted from whole blood using the salting out method as described previously (17). Genotyping of polymorphisms was performed by the tetra amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) method, which is a simple and reliable method for recognition of single nucleotide polymorphism (SNP) (18, 19). For detection of each polymorphism four primers, two external primers (forward outer, reverse outer) and two allele-specific internal primers were used. The primers were used for T-ARMS-PCR are shown in Table 1. For genotyping of each variant we used two external primers (forward outer and reverse outer) and two inner primers (forward inner and reverse inner). The amplification was performed using commercially available PCR premix (AccuPower PCR PreMix, BIONEER, Daejeon, South Korea). Polymerase chain reactions (PCRs) were performed in 0.2 mL PCR tube AccuPower PCR PreMix containing 1 μL template DNA (~ 100 ng/μL), 1 μL of each primer (10 μM) and 15 μL DNase-free water. The amplification program was as follows: 94°C for 5 minutes, 30 cycles of 94°C for 30 seconds, 64°C for 30 seconds and 72°C for 30 seconds, with a final 5-min extension at 72°C. The PCR products were monitored by electrophoresis on a 2% agarose gel containing 0.5 μg/mL ethidium bromide.
Table 1.
Primer Sequence for Detection of IL12A G/A rs568408, IL12B A/C rs3212227 and IL-12 Receptor A/G rs383483 Gene Polymorphisms
| Primer | Sequence (5`-> 3`) | Ampelicon Size, bp |
|---|---|---|
| IL12A rs568408 | 566 | |
| Forward outer | AATTTTGGAATACCATGTAAGTCATGCT | |
| Reverse outer | AGTTAGCTCAGATGCTTTCATGATTACC | |
| Forward inner (A allele) | GAAGGATGGGACTATTACATCCACCTA | 271 |
| Reverse inner (G allele) | AAATGTCAAAAATACTTGATCAGAGGTCTC | 352 |
| IL12B rs3212227 | 304 | |
| Forward outer | ATTAAGCAAAATGTTTAAAGACACAACG | |
| Reverse outer | GATGGATCAGGTCATAAGAGTATGAAAC | |
| Forward inner (C allele) | AATGATATCTTTGCTGTATTTGTATAGCTC | 217 |
| Reverse inner (A allele) | GATGGATCAGGTCATAAGAGTATGAAAC | 143 |
| IL-12Receptor rs383483 | 245 | |
| Forward outer | ATGGGAAGGGGTATGGAGCACT | |
| Reverse outer | AGCTCCTCTCACTGGTCCCCTT | |
| Forward inner (A allele) | AATGCGTAACCCTTGTCCATCG | 117 |
| Reverse inner (G allele) | TCCAAGTCTTTTTATTGGGTGCAAAT | 175 |
2.1. Statistical Analysis
Data were analyzed using the statistical package SPSS 20 software (SPSS for Windows, SPSS Inc., Illinois, USA) and the level of significance was set to a P value of < 0.05. Differences between genotype distribution and allele frequency were analyzed using the Fisher’s exact test and association between polymorphisms and risk of tuberculosis was estimated by calculation of odds ratio (OR) and 95% confidence intervals (95% CI) from logistic regression analysis.
3. Results
The study groups consisted of 174 PTB patients (58 males and 98 females) and 177 control subjects (67 males and 87 females). Mean age of the PTB patients and control group were 50.17 ± 20.17 and 46.88 ± 15.45, respectively. There was no significant difference between the PTB patient and healthy individuals regarding sex and age (P > 0.050). The frequency distribution of IL12A rs568408 genotypes in PTB patients and normal subjects is shown in Table 2. There was no significant difference between the case and control groups regarding IL12A rs568408 polymorphism (χ2 = 0.299, P = 0.861). The IL12A rs568408 variant was not a risk factor for susceptibility to PTB in codominant, dominant and recessive tested inheritance models (Table 2). Moreover, the allele frequency of IL12A rs568408 was not different between the two groups (OR = 1.07, 95% CI = 0.74 - 1.55, P = 0.70). As shown in Table 3, there was no significant difference between the case and control groups regarding IL12B rs3212227 (χ2 = 0.763, P = 0.682). The IL12B rs3212227 polymorphism was not associated with PTB in any inheritance models tested (codominant, dominant and recessive). In addition, the rs3212227 C allele was not associated with PTB (OR = 1.14, 95% CI = 0.82 - 1.58, P = 0.453).
Table 2.
The Genotypes and Allele Distribution of the IL12A G/A rs568408 Polymorphism in Pulmonary Tuberculosis Patients and Control Groupsa
| Polymorphism | Patients | Normal | OR (95% CI) | P Value | OR (95% CI) | P Value |
|---|---|---|---|---|---|---|
| Codominant | ||||||
| GG | 104 (59.8) | 109 (61.6) | 1.00 | 1.00 | ||
| GA | 67 (38.5) | 66 (37.3) | 1.06 (0.69 - 1.64) | 0.78 | 1.08 (0.70 - 1.69) | 0.72 |
| AA | 3 (1.7) | 2 (1.1) | 1.57 (0.26 - 9.60) | 0.62 | 1.48 (0.24 - 9.17) | 0.67 |
| Dominant | 0.68 | |||||
| GG | 104 (59.8) | 109 (61.6) | 1.00 | 1.00 | ||
| GA + AA | 70 (40.2) | 68 (38.4) | 1.08 (0.70 - 1.66) | 0.73 | 1.09 (0.71 - 1.70) | |
| Recessive | 0.70 | |||||
| GG + GA | 171 (98.3) | 175 (65.5) | 1.00 | 1.00 | ||
| AA | 3 (1.7) | 2 (1.1) | 1.53 (0.25 - 9.30) | 0.64 | 1.43 (0.23 - 8.81) | |
| Alleles | ||||||
| G | 275 (79) | 284 (80.2) | 1.00 | |||
| A | 73 (21) | 70 (19.8) | 1.07 (0.74 - 1.55) | 0.70 |
aValues are expressed as No. (%).
Table 3.
The Genotypes and Allele Distribution of the IL12B A/C rs3212227 Polymorphism in Pulmonary Tuberculosis Patients and Control Groupsa
| Polymorphism | Patients | Normal | OR (95% CI) | P Value | OR (95% CI) | P Value |
|---|---|---|---|---|---|---|
| Codominant | ||||||
| AA | 82 (47.1) | 90 (50.8) | 1.00 | 1.00 | ||
| AC | 79 (45.4) | 77 (43.5) | 1.13 (0.73 - 1.73) | 0.592 | 0.94 (0.58 - 1.53) | 0.816 |
| CC | 13 (7.5) | 10 (5.7) | 1.43 (0.59 - 3.43) | 0.427 | 1.35 (0.55 - 3.26) | 0.511 |
| Dominant | 0.99 | |||||
| AA | 82 (47.1) | 90 (50.8) | 1.00 | 1.00 | ||
| AC + CC | 92 (52.9) | 87 (49.2) | 1.16 (0.76 - 1.76) | 0.486 | 1.00 (0.63 - 1.58) | |
| Recessive | 0.467 | |||||
| AA + AC | 161 (92.5) | 167 (94.3) | 1.00 | 1.00 | ||
| CC | 13 (7.5) | 10 (5.7) | 1.34 (0.57 - 3.16) | 0.492 | 1.38 (0.58 - 3.26) | |
| Alleles | ||||||
| A | 243 (69.8) | 257 (72.6) | 1.00 | |||
| C | 105 (30.2) | 97 (27.4) | 1.14 (0.82 - 1.58) | 0.453 |
aValues are expressed as No. (%).
The analysis of the PTB patients and healthy controls revealed no statistically significant difference between the groups concerning the IL-12R rs383483 polymorphism (χ2 = 1.627, P = 0.443). The results of the current study showed that the IL-12R rs383483 polymorphism was not a risk factor for PTB in codominant, dominant and recessive tested inheritance models (Table 4).
Table 4.
The Genotypes and Allele Distribution of the IL-12 Receptor rs383483 Polymorphism in Pulmonary Tuberculosis Patients and Control Groupsa
| Polymorphism | Patients | Normal | OR (95% CI) | P Value | OR (95% CI) | P Value |
|---|---|---|---|---|---|---|
| Codominant | ||||||
| AA | 61 (39.1) | 62 (40.2) | 1.00 | 1.00 | ||
| AG | 49 (31.4) | 39 (25.3) | 1.27 (0.73 - 2.21) | 0.383 | 1.27 (0.73 - 2.20) | 0.391 |
| GG | 46 (29.5) | 53 (34.5) | 0.88 (0.52 - 1.50) | 0.643 | 0.91 (0.53 - 1.54) | 0.722 |
| Dominant | 0.79 | |||||
| AA | 61 (39.1) | 62 (40.2) | 1.00 | 1.00 | ||
| AG + GG | 95 (60.9) | 92 (59.8) | 1.05 (0.66 - 1.65) | 0.83 | 1.06 (0.67 - 1.68) | |
| Recessive | 0.42 | |||||
| AA + AG | 158 (70.5) | 157 (65.5) | 1.00 | 1.00 | ||
| GG | 46 (29.5) | 53 (34.5) | 0.80 (0.49 - 1.29) | 0.35 | 0.82 (0.51 - 1.33) | |
| Alleles | ||||||
| A | 171 (54.8) | 163 (52.9) | 1.00 | |||
| G | 141 (45.2) | 145 (47.1) | 1.07 (0.79 - 1.48) | 0.687 |
aValues are expressed as No. (%).
4. Discussion
Interleukine-12 is an immunoregulatory cytokine, which linked innate and acquired immune responses to mycobacterium through induction of IFN-γ production. In the current study, we investigated the impact of IL12A rs568408, IL12B rs3212227 and IL-12R rs383483 polymorphisms on PTB risk in a sample of Iranian population who were living in southeast of Iran. We found no association between the IL12A rs568408, IL12B rs3212227 as well as IL-12R rs383483 polymorphisms and the risk of PTB in our population. In contrast to our findings, Morris et al. (20) revealed an association between IL12B rs3212227 and PTB risk in Guinea-Bissau and African-Americans population. Morahan et al. (21) showed that the distribution of 3’ UTR genotype of IL12B gene was different between the TB patients and control groups, besides they demonstrated a positive correlation between the expression of IL-12 and this polymorphism. They suggested that this polymorphism can cause increased IL-12 expression. Wang et al. (22) detected that genetic polymorphism of rs2243115 in IL12A was associated with a significantly decreased risk of TB in a population of China while they found no association between two other SNPs rs568408 and rs3212227 of IL12 and the risk of TB. In agreement with our study, Selvaraj et al. (23) showed no significant difference in IL-12B 1188 A/C (rs3212227) between the PTB patients and normal healthy subjects. However, they found that the expression of IL-12B varies with different genotypes in both cases and controls. They demonstrated that IL-12B levels decreased in normal subjects with AA genotype, whereas in the PTB patients with the CC genotype the IL-12B levels are increased compared to other genotypes. They deducted that this polymorphism of IL-12B gene may regulate IL-12B production and has a key role on controlling mycobacterium infection and acquired immunity to tuberculosis (23). Sahiratmadja et al. (11) in a study on Indonesian population compared 6 polymorphisms of IL-12B and IL12RB in PTB patients and controls. They reported no significant association between alleles or genotypes and susceptibility to Prabhu Anand et al. (24) and Ma et al. (25) found that allelic as well as genotypic frequencies of IL-12B 1188 A/C (rs3212227) did not differ significantly between the patients and normal subjects. Lee et al. (12) in a study on Korean population found no significant association between PTB and the IL-12R polymorphism while, Remus et al. (13) showed a positive correlation between IL-12R polymorphism and susceptibility to TB and pointed out that the polymorphism in IL12-R may affect the risk of PTB development. Interleukine-12 influence on macrophage to controlling MTB (26) and polymorphism in IL-12 and its receptors may affect its production.
One of the limitations of the current study is the relatively small sample size. In addition, we did not determine the gene environmental interactions.
There is no clear reason for controversial findings among various studies. The discrepancies may be related to genetic and environmental differences between the populations investigated.
In conclusion, the findings of the present study showed that IL12A rs568408, IL12B rs3212227 and IL-12R rs383483 polymorphisms were not major genetic factors for resistance or susceptibility to PTB in a sample of southeast Iranian population. The discrepancies observed among various populations may be due to sample size and different ethnic groups. A large-scale association study with different ethnicity and functional analysis is necessary to validate our findings.