Cover image of the article: The Expression of Efflux Pump Genes in Methicillin-Resistant Staphylococcus aureus (MRSA) Strains Isolated from Blood Cultures in Iran

Image Credit:Archives of Clinical Infectious Diseases

The Expression of Efflux Pump Genes in Methicillin-Resistant Staphylococcus aureus (MRSA) Strains Isolated from Blood Cultures in Iran

Authors

Arezoo Bostanmaneshrad1, Jamileh Nowroozi1, Gita Eslami2, Ali HashemiAli Hashemi ORCID2,*
1Department of Microbiology, Faculty of Life Science, North Tehran Branch, Islamic Azad University, Tehran, Iran
2Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
*Corresponding Author: Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Email: [email protected]

Archives of Clinical Infectious Diseases:Vol. 15, issue 5; e99804
Published online:Nov 29, 2020
Article type:Research Article
Received:Dec 28, 2019
Accepted:Oct 11, 2020
How to Cite:Bostanmaneshrad A, Nowroozi J, Eslami G, Hashemi A. The Expression of Efflux Pump Genes in Methicillin-Resistant Staphylococcus aureus (MRSA) Strains Isolated from Blood Cultures in Iran. Arch Clin Infect Dis. 2020;15(5):e99804. doi: https://doi.org/10.5812/archcid.99804

Abstract

Background:

Efflux pump is a significant resistance mechanism in Staphylococcus aureus. A total of 100 patients with bacteremia from Shahid Beheshti University Hospitals of Tehran in Iran were tested for the expression of efflux pump genes, contributing to S. aureus antimicrobial resistance.

Objectives:

This study was conducted to identify antibiotic resistance pattern, and to evaluate the inhibitory effect of efflux pump, MIC of ciprofloxacin, and expression levels of norA, norB, and norC efflux pump genes in the presence of an efflux pump inhibitor against MDR S. aureus.

Methods:

A total of 100 MRSA isolates were investigated in different hospitals of Shahid Beheshti University of Medical Sciences from April 2017 - 2018. Owing to new consensus guidelines from the Clinical and Laboratory Standards Institute (CLSI), both the Kirby-Bauer disk diffusion test and micro-dilution method were used to evaluate antimicrobial susceptibility. Efflux pump activity using carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was identified as a chemical efflux pump inhibitor. E-test was used to determine vancomycin-resistant antibiotic. Broth micro-dilution method for S. aureus isolates resistant to ciprofloxacin has been developed for minimum inhibitory concentration (MIC) of ciprofloxacin and CCCP and their composition. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to investigate the expression level of norA, norB, and norC efflux pump genes.

Results:

A total of 38 of 45 MRSA isolates (84.4%) showed resistance to ciprofloxacin. Moreover, 100% of isolates had the norA and norB genes. Further, 95% of S. aureus isolates had the norC gene. According to this study, ciprofloxacin MIC has decreased by CCCP compared to ciprofloxacin. There was an increase in the expression level of norA, norB, and norC efflux pump genes in methicillin-resistant and ciprofloxacin-resistant S. aureus strains based on RT- PCR. In this study, four different spA types were obtained as the most prevalent type of spA by t037and t790 (23.3%) and t030 (14.1%) and t044 (12.2%).

Conclusions:

This study indicates that the prevalence of ciprofloxacin-resistant S. aureus strains has a rising trend among MRSA clinical isolates. The ability of S. aureus isolates to be converted into drug-resistant strains using efflux pump mechanism has become a widespread concern.

Highlights

1. Background

Staphylococcus aureus, as a Gram-positive round-shaped bacterium is a major human pathogen causing a wide range of nosocomial infections, including wound infections and infective endocarditis. It also results in the development of fatal conditions and life-threatening diseases like bacteremia (1), which if left untreated may lead to the emergence of complications such as systemic inflammatory responses, septic arthritis, and sepsis that, in turn, results in multiple organ damage followed by multiple organ dysfunction syndrome (MOSD). Regarding the management of S. aureus infections in patients with bacteremia, the lack of information on molecular characterization and resistance patterns of S. aureus is taken into account as a major issue (2). This bacterium is known for its unique ability to the acquisition of resistance to antibacterial drugs, especially methicillin. In this regard, methicillin-resistant S. aureus (MRSA) has turned into a major treatment challenge, especially in the Intensive Care Units (ICUs). Methicillin as the first highly-developed therapeutic drug, was administered for the treatment of penicillin-resistant S. aureus infections (3). Resistance to methicillin can be determined according to the expression of mecA gene, which encodes a penicillin-binding protein, known as PBP2a, as a protein with low affinity for β-lactam antibiotics. Moreover, these strains often have a remarkable ability in the acquisition of resistance to a wide range of antibiotics. So far, resistance rates of S. aureus to antibiotics has been a major concern for the treatment of infections. Resistance occurs through drug-inactivating enzymes, modification of antibiotic enzymes, or drug export by efflux pumps. Moreover, S. aureus can encode several multidrug resistance (MDR) efflux pumps (4). Up to now, higher than 10 efflux pumps have been identified, which are encoded by S. aureus. Owing to the presence of fluoroquinolone resistance, extensive use of fluoroquinolone for effective treatment of the infections is restricted (5), which is related to MDR genes, which are chromosomally encoded by norA, norB, and norC, and are widely observed in various isolates and could be specific for a particular substrate or mobilize various antibiotics classes (6, 7). The prevalence of ciprofloxacin resistance in MRSA strains has significantly increased throughout the world, but its resistance in methicillin-susceptible S. aureus (MSSA) has been reported to be low (8, 9).

2. Objectives

In Iran, there is insufficient information about the extent of expression of efflux pump genes in S. aureus strains, which are isolated from blood samples; therefore, this study was conducted to identify antibiotic resistance pattern, and to evaluate the inhibitory effect of efflux pump, MIC of ciprofloxacin, and expression levels of norA, norB, and norC efflux pump genes in the presence of an efflux pump inhibitor against MDR S. aureus.

3. Methods

3.1. Isolation of the Bacteria and Their Characterization

This study was conducted with a cross-sectional design during a complete year (from the first of April 2017 to the end of April 2018). A total of 100 strains of S. aureus were evaluated, which were obtained from the culture of blood samples of the patients referred to different wards in the hospital affiliated with the Shahid Beheshti University of Medical Sciences. Age range of the patients was from 1 to 90 years old. Also, 47% of the patients were female, and the rest of them (53%) were male. Clinical samples were collected using diphasic blood culture media. Suspected positive samples were sub-cultured on a specific medium containing chocolate agar (Merck, Germany) and also MacConkey agar media (Merck, Germany). S. aureus strains were identified by laboratory microbiologic tests like fermentation on salt agar and deoxyribonuclease (DNase) test (Merck, Germany), catalase and rabbit plasma coagulase testing (8).

3.2. Evaluation of the Resistance to Methicillin

Isolates of MRSA were examined using 30 µg cefoxitin disc (MAST DISKSTM, UK) on Mueller-Hinton agar plates supplemented with 4% NaCl, according to the CLSI guidelines (8).

3.3. Antimicrobial Susceptibility Testing

A test was done to assess antimicrobial susceptibility using chloramphenicol (CC 30 µg), linezolid (LZD 30 µg), ciprofloxacin (CIP 5µg), trimethoprim-sulfamethoxazole (1.25/23.75 µg), clindamycin (CD 2 µg), ampicillin (AP 10 µg), erythromycin(E 15 µg), and antimicrobial disks using Kirby-Bauer method (MAST DISKSTM, UK) in accordance with CLSI guidelines (8). In addition, S. aureus subsp. ATCC 25923 was applied as a control strain.

3.4. Evaluation of MIC in Staphylococcus aureus Isolates

The Liofilchem® MIC Test Strip (MTS) (Liofilchem Co., Roseto, Italy) was used to specify MIC of S. aureus isolates in accordance with the manufacturer's instructions. The standard reference strain of S. aureus ATCC 25923 was applied as a control strain. MIC breakpoints for vancomycin were determined as follows according to the CLSI guidelines: resistant, ≥ 16 μg/mL; intermediate, 4 ± 8 μg/mL, and susceptible, ≤ 2 μg/mL (8).

3.5. Treatment of Efflux Pump Inhibitor

To find an active efflux pump system, CCCP as an efflux pump inhibitor (from Sigma Aldrich) was supplemented to each M-H agar plate containing 0.5 - 128 μg/mL of ciprofloxacin. The final concentration of carbonyl cyanide 3-chlorophenyl hydrazone (CCCP) in the M-H agar was equal to 25 μg/mL (9). After repetitions several times, MIC was determined for ciprofloxacin with great accuracy (10). A free-antibiotics plate containing carbonyl cyanide m-chlorophenylhydrazone was used as the control. The criterion for positive results regarding the existence of active efflux pump would be a decrease in at least 4 folds of ciprofloxacin MIC after CCCP addition (11).

3.6. Extraction of Genomic DNA

Genomic DNA was extracted using a commercial Kit (Roche, Germany, and Lot. No.10362400) based on the manufacturer’s protocols. Lysostaphin (Sigma-Aldrich, USA) was used at a final concentration of 15 µg/mL for cell wall lysis. Finally, DNA concentration was evaluated using the NanoDrop instrument.

3.7. Technique Used for PCR-Sequencing

Efflux pump genes such as norA and norB as well as norC, gmK, and spA genes were detected using the primers presented in Table 1 (12). According to the procedure proposed by Hu, et al., 2011), PCR was done on a 25-μL mixture containing 1 μL (20 ng) of genomic DNA and 10.5 μL of 2× Master Mix (SinaClon-Iran, CAT. No., PR901638) including 1.5 × PCR buffer, 0.5 mmol/L of dNTPs, 4 mmol/L of MgCl2, and 0.08 IU of Taq DNA polymerase, 1 μL of 10 pmol of each primer and 11.5 μL of sterile distilled water. Amplification was accomplished on a thermal cycler (Eppendorf, Master Cycler Gradient, and Germany). PCR was performed according to the following thermal protocol for each cycle: primary denaturation for 5 min at 95°C, 30 cycles of amplification composed of 30 s at 94°C, annealing at 60°C for 30 s, according to the primers for each gene and at 72°C for 30 s, followed by an extra extension step at 72°C for 5 minutes. Amplified products were electrophoresed by 1 - 1.5% agarose gel. The results were visualized by DNA Safe staining, and images were taken under UV irradiation. The PCR products were purified using a kit (Bioneer Co., Korea), and then, nucleotide sequencing of amplicons was done by an ABI PRISM 3700 sequencer (Macrogen Co., Korea). Sequenced data were analyzed using Chromas software Ver. 1.45 and Nucleotide BLAST program (http://www.ncbi.nlm.nih.gov/nucleotide/).
Table 1.
Oligonucleotide Primers Used in This Study
GenPrimerPrimer Sequence (5′-3′)Product Size (bp)Reference
norAnorA-FGACATTTCACCAAGCCATCAA102(12)
norA-RTGCCATAAATCCACCAATCC
gmKgmK-FTCAGGACCATCTGGAGTAGGTAAAG108(12)
gmK-RTTCACGCATTTGACGTGTTG
norBnorB-FATGTTTGTCGTTGGAGCAGG117(12)
norB-RAATACACGCTGCTGATACGC
norCnorC-FATGAATGAAACGTATCGCGG130In this study
norC-RGTCTGCACCAAAACTTTGTTGTAAA
spAspA-FTAAAGACGATCCTTCAGTGAGCvariable(12)
spA-RCAGCAGTAGTGCCGTTTGCTT

3.8. Preparation of RNA and qRT-PCR

Isolates of MRSA were assessed to determine the expression of norA, norB, and norC efflux pump genes. GmK, as an S. aureus housekeeping gene, was used as an internal control. Strains were grown on LB broth overnight (13). Total RNA extraction Kit RNX- Plus (Cat. No., RN7713C, Sinacolon, Iran) was used to extract total RNA according to the manufacturer’s guidelines. Extra DNA was removed from RNA by RNase-free DNase I (Fermentas, USA). Integrity and purity of total RNA were specified using the NanoDrop (WPA Biowave II Nano spectrophotometer, USA). Briefly, cDNA synthesis was performed using the Takara Kit (Japan) (Table 2). Quantitative real-time PCR (qRT-PCR) was performed on synthesized cDNA through the use of the Power SYBR Green PCR Master Mix (Bioneer, Daejeon, Korea) with a Corbett Rotor-Gene 6000 real-time rotary analyzer (Corbett Life Science, Australia). Amplification was performed in the following condition: firstly, 10 min denaturation at 94°C, followed by 40 cycles of 20 s at 94°C and 45 s at 59°C. Samples were run in triplicate. Controls were run without the use of reverse transcriptase to confirm the absence of contaminating cDNA in any of the samples. The expression levels of norA, norB, and norC genes were normalized using the gmK housekeeping gene as an internal control, as calculated based on 2−ΔΔCT method. The results were expressed as relative expression of the mRNA with respect to S. aureus ATCC 25923. The Ct parameter (threshold cycle) was defined as the cycle number at which the first detectable fluorescence signal of the reaction crosses the threshold, which began to increase exponentially by binding of SYBR Green I dye to the minor groove of double-stranded DNA.
Table 2.
Primers Used for Quantitative Real-time PCR
GenePrimerPrimer Sequence (5′-3′)PurposeProduct Size (bp)Comment
norAnorA-FGACATTTCACCAAGCCATCAAqRT–PCR102Target gene
norA-RTGCCATAAATCCACCAATCCqRT–PCR
gmKgmK-FTCAGGACCATCTGGAGTAGGTAAAGqRT–PCR108Internal control
gmK-RTTCACGCATTTGACGTGTTGqRT–PCR

3.9. SpA Typing

Molecular epidemiological analysis was performed by spA typing according to the study by Harmsen, et al. (14). When positive spA PCR products were purified using Kit (Roche, Germany), they were tested by DNA sequence analysis and nucleotide sequences were determined on both strands using ABI Prism 377 automated sequencer (Applied Biosystems, Perkin-Elmer Co., Foster City, CA). Chromas software (version 1.45, Australia) was used to edit obtained sequences. Edited sequences were assigned to specific spa types according to the guidelines described by the Ridom spA server database (http://www.spaserver.ridom.de).

3.10. Statistical Analysis

SPSS software, ver. 22.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses. A P value of ≤ 0.05 was considered statistically significant.

4. Results

4.1. Patients and Bacterial Isolates

A total of 100 samples of S. aureus isolates were collected from the patients that were referred to different wards in the hospital affiliated to Shahid Beheshti University of Medical Sciences from April 2017 - 2018 of which 53 belonged to males and 47 belonged to females (male:female ratio = 1.12). The patients aged between 1 - 90 years old. All the isolates were prepared from blood samples. Figure 1 presents age of the patients.

4.2. Antibiotic Susceptibility Profile

MRSA isolates were resistant to ampicillin (100%), erythromycin (91.1), cefazolin (82.2%), ciprofloxacin (84.4%), clindamycin (80%), chloramphenicol 8.8%), and TMP-SMX (20%). Interestingly, all MRSA and MSSA isolates showed the highest susceptibility of 100% to linezolid. Table 3 shows the antibiotic susceptibility of the isolates. Among 100 analyzed S. aureus isolates, all isolates were susceptible to vancomycin based on MIC results.
Of ciprofloxacin-resistant isolates, 8 isolates had an active efflux pump, according to CCCP results. Table 4 shows the effect of a pump inhibitor (CCCP) on the treatment of efflux pump.
Distribution of the subjects by age (n = 100)
Figure 1.
Distribution of the subjects by age (n = 100)
Table 3.
Antibiotic Susceptibility of the Staphylococcus aureus Clinical Isolates (n = 100)
AntibioticsMRSA/(%), N=45MSSA/Resistant (%), N=55
RISRIS
Clindamycin36 (80)09 (20)7 (12.7)1 (1.8)47 (85.4)
Linezolid0045 (100)0055 (100)
Chloramphenicol4 (8.8)041 (91.1)2 (3.6)053 (96.3)
Cefazolin37 (82.2)8 (17.7)2 (3.6)053 (96.3)
Erythromycin41 (91.1)3 (6.6)1 (2.2)7 (12.7)6 (10.8)42 (76.3)
Ampicillin45 (100)0051 (92.7)04 (7.27)
Ciprofloxacin38 (84.4)07 (15.5)3 (5.54)2 (3.6)50 (90.9)
Trimethoprim/Sulfamethoxazole9 (20)036 (80)5 (9)050 (90.9)
Abbreviations: R, resistant; I, intermediate; S, sensitive.
Table 4.
Effects of CCCP on the Ciprofloxacin MIC in MRSA Isolates with Active Efflux Pumps
Isolate NumberMIC CiprofloxacinMIC Ciprofloxacin + CCCP
6282
100164
87324
38648
16416
156416
3112832
3912832

4.3. Prevalence of Resistance Genes

Staphylococcus aureus was identified by 16SrRNA. In this regard, norA and norB were present in 100% of the isolates, and norC, gmK, and spA were present in 95%, 98%, and 99% of the isolates, respectively.

4.4. Gene Expression Analysis of norA, norB, norC, and spA Typing

To assess the expression of norA, norB, and norC efflux system in MRSA ciprofloxacin-resistant isolates (MIC ≥ 4 μg/mL), qRT-PCR analysis was performed. According to the results, of 100 S. aureus strains, the norA gene was found as the most commonly overexpressed gene that was present in 7 (63.6%) strains. Only 2 strains (18.2%) showed overexpressed norB gene and 2 strains had overexpressed norC gene. The strains with overexpressed norA, norB, and norC genes were ciprofloxacin-resistant to MRSA. Analysis of 41 ciprofloxacin-resistant S. aureus strains showed norA overexpression, which was more common between ciprofloxacin-resistant strains to MRSA than ciprofloxacin-resistant strains to MSSA. Analysis of 11 MRSA strains resistant to ciprofloxacin showed that increased expression of norA, norB, and norC is associated with a decrease in CCCP of the ciprofloxacin MIC. The results revealed four different types of spA, and the most common types were t037 and t790 (23.3%), followed by t030 (14.1%) and t044 (12.2%).

5. Discussion

The emergence and prevalence of antibiotic-resistant bacteria have resulted in the discovery of new antibacterial agents and modulators of antibiotic resistance. Different mechanisms exist for antibiotic resistance in S. aureus. Efflux pumps, as one of the prominent mechanisms that causes extraction of antibiotics and decrease intracellular concentration of antibiotic (13, 15). In the case of S. aureus, the MDR efflux pumps, namely norA, norB, and norC , which are encoded chromosomally, are observed in different strains, and they have been identified based on their ability to acquire resistance to fluoroquinolones (12). The results of the study demonstrated that resistance to MRSA isolates, including ciprofloxacin (84.4%), erythromycin (91.1%), clindamycin (80%), ampicillin (100%), and cefazolin (82.2%) was relatively high, while approximately less than half of the strains showed resistance to chloramphenicol (8.8%) and trimethoprim-sulfamethoxazole (20%), which is in accordance with the findings reported in the study by Ko et al. who investigated 74 MRSA strains isolated from a total of 12 Asian countries (15). To date, due to the significance of the efflux pump in antibiotic resistance mainly in MDR S. aureus, researchers have conducted several studies in this field. For instance, in the present study, the prevalence of ciprofloxacin-resistance was equal to 84.4% in MRSA isolates, while it has been reported between 29 - 99% in other studies (16, 17) conducted in Tehran. All MRSA isolates showed susceptibility to linezolid and vancomycin; hence, yet these antimicrobial drugs can be administered for severe MRSA-induced infections in Iran, as reported in the studies carried out by Valadan Tahbaz et al. (18). In the current study, a high rate of resistance was observed to ciprofloxacin, which is related to the effect of permeability, efflux pump, and the decrease in the availability of quinolones at the target site (19). Frempong-Manso et al. introduced norA as the gene most commonly found in the isolates, which its overexpression resulted in low-to-moderate increases in the MICs of fluoroquinolones that, in turn, led to the emergence of high-level target-based resistance in vitro (20). In another study, norB was identified as the most commonly overexpressed MDR efflux pump gene in the isolates prepared from clinical samples from patients in Korea. In a previous study, overexpression of norA gene has been reported in only 2 strains (3.2%) and overexpression of norC has not been found (12). In this study, overexpression of the norA and norB efflux pump genes increased in the presence of inhibitors. DeMarco et al. stated that among S. aureus isolates collected from blood samples, 25.4% of them showed norB overexpression, followed by 22.8 and 16.7% overexpression in norA and norC genes, respectively. It has been found when an overexpression occurs in a single efflux pump gene, it mainly belongs to norA, whereas overexpression of norB and norC genes occurs mostly when two or more efflux pump genes are overexpressed (21). Similar to the study conducted by Kwak et al., in this study, all clinical isolates with overexpressed efflux pump genes showed overexpression in a single gene. In a prior study, only one isolate (0.9%) showed overexpression in both norA and norB genes. In addition, norC has been identified as the only gene, which no overexpression was detected for it among clinical isolates (12). Kosmidis et al. in a study found that overexpression of MDR efflux pump genes changed temporarily and with respect to geographical locations in the isolates collected from clinical samples. They also revealed the predominance of overexpression only for norB in strains isolated from the patients in San Francisco, USA, to the extent greater than any other location (22). Further studies are needed to determine norA, norB, and norC genes overexpression in order to see whether severe effects have occurred on biocide and fluoroquinolone resistance in S. aureus strains (22, 23). Inhibitors causing resistance to bacteria tend to exhibit a likelihood for the treatment of the patients suffered from antibiotic-resistant infections. Applying inhibitors may provide the chance of another treatment for the patients undergone treatment with ineffective antibiotics in health centers and also protects them against new MDR strains (23). Khan observed that the presence of active efflux pumps in all S. aureus isolates is associated with an increase in the ethidium bromide uptake and a decrease in the antibiotic MICs when there are efflux pump inhibitors, e.g. CCCP and reserpine (24). In the present study, among ciprofloxacin-resistant isolates, 11 samples had active efflux pumps according to CCCP results. According to the spA typing results, four different types of spA were determined among 45 MRSA isolates. Although the distribution of spA types in S. aureus strains was different with respect to geographical location. The findings of the studies conducted in Iran demonstrated great dissemination of spA types of t790, t030, t037, and t044 in S. aureus clinical isolates (25-27). The t037 and t790 were the first commonly identified spA types in the current study, accounting for more than 50% of all isolates. These spA types have been reported as predominant spA types in the studies conducted by Goudarzi et al. (28, 29). SpA types of t037 and t790 were found as resistant to methicillin. The t030 was the second commonly identified spA type in the current study, which was found in a single strain. In contrast with prior studies conducted in Iran (30, 31), in this study, a low frequency of t030 and t044 spA types was also found between the isolates.

5.1. Conclusion

Findings of the current study showed significant roles of norA, norB, and norC efflux pump genes in the acquisition of resistance to ciprofloxacin in the S. aureus isolates collected from clinical samples. Seemingly, it is necessary to assess resistance and virulence of genes in different molecular types of S. aureus in order to administer proper antibiotic agents.

Footnotes

  • Authors' Contribution: Arezoo Bostanmaneshrad, Jamileh Nowroozi, Gita Eslami, Ali Hashemi: design of study and data analysis. Arezoo Bostanmaneshrad and Ali Hashemi: data collecting and writing paper.

  • Conflict of Interests: The authors have no conflict of interest relevant to this paper.

  • Ethical Approval: This descriptive study was approved by the Research and Ethics Committee of the Science and Research Branch of Islamic Azad University, Tehran, Iran. In order to maintain patients' confidentiality participants were anonymous, and no personal information was disclosed in the study.

  • Funding/Support: No funding or financial support was granted for this research.

References

  • 1.
    Tong SY, Davis JS, Eichenberger E, Holland TL, Fowler VJ. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015;28(3):603-61. [PubMed ID: 26016486]. [PubMed Central ID: PMC4451395]. https://doi.org/10.1128/CMR.00134-14.
  • 2.
    Holubar M, Meng L, Deresinski S. Bacteremia due to Methicillin-Resistant Staphylococcus aureus: New Therapeutic Approaches. Infect Dis Clin North Am. 2016;30(2):491-507. [PubMed ID: 27208769]. https://doi.org/10.1016/j.idc.2016.02.009.
  • 3.
    Dulon M, Haamann F, Peters C, Schablon A, Nienhaus A. MRSA prevalence in European healthcare settings: a review. BMC Infect Dis. 2011;11:138. [PubMed ID: 21599908]. [PubMed Central ID: PMC3128047]. https://doi.org/10.1186/1471-2334-11-138.
  • 4.
    Deng X, Sun F, Ji Q, Liang H, Missiakas D, Lan L, et al. Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus. J Bacteriol. 2012;194(7):1753-62. [PubMed ID: 22267518]. [PubMed Central ID: PMC3302473]. https://doi.org/10.1128/JB.06582-11.
  • 5.
    Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect. 2007;13(3):222-35. [PubMed ID: 17391376]. https://doi.org/10.1111/j.1469-0691.2006.01573.x.
  • 6.
    Blumberg HM, Rimland D, Carroll DJ, Terry P, Wachsmuth IK. Rapid development of ciprofloxacin resistance in methicillin-susceptible and -resistant Staphylococcus aureus. J Infect Dis. 1991;163(6):1279-85. [PubMed ID: 2037793]. https://doi.org/10.1093/infdis/163.6.1279.
  • 7.
    Coronado VG, Edwards JR, Culver DH, Gaynes RP, National Nosocomial Infections Surveillance S. Ciprofloxacin resistance among nosocomial Pseudomonas aeruginosa and Staphylococcus aureus in the United States. Infect Control Hosp Epidemiol. 1995;16(2):71-5. [PubMed ID: 7759821]. https://doi.org/10.1086/647059.
  • 8.
    Ferraro MJ. Performance standards for antimicrobial disk susceptibility tests. NCCLS; 2000.
  • 9.
    Goudarzi M, Eslami G, Rezaee R, Heidary M, Khoshnood S, Sajadi Nia R. Clonal dissemination of Staphylococcus aureus isolates causing nosocomial infections, Tehran, Iran. Iran J Basic Med Sci. 2019;22(3):238-45. [PubMed ID: 31156782]. [PubMed Central ID: PMC6528716]. https://doi.org/10.22038/ijbms.2018.30067.7245.
  • 10.
    Pumbwe L, Glass D, Wexler HM. Efflux pump overexpression in multiple-antibiotic-resistant mutants of Bacteroides fragilis. Antimicrob Agents Chemother. 2006;50(9):3150-3. [PubMed ID: 16940115]. [PubMed Central ID: PMC1563565]. https://doi.org/10.1128/AAC.00141-06.
  • 11.
    Ardebili A, Talebi M, Azimi L, Rastegar Lari A. Effect of Efflux Pump Inhibitor Carbonyl Cyanide 3-Chlorophenylhydrazone on the Minimum Inhibitory Concentration of Ciprofloxacin in Acinetobacter baumannii Clinical Isolates. Jundishapur J Microbiol. 2014;7(1). e8691. [PubMed ID: 25147654]. [PubMed Central ID: PMC4138672]. https://doi.org/10.5812/jjm.8691.
  • 12.
    Kwak YG, Truong-Bolduc QC, Bin Kim H, Song KH, Kim ES, Hooper DC. Association of norB overexpression and fluoroquinolone resistance in clinical isolates of Staphylococcus aureus from Korea. J Antimicrob Chemother. 2013;68(12):2766-72. [PubMed ID: 23928023]. [PubMed Central ID: PMC3820107]. https://doi.org/10.1093/jac/dkt286.
  • 13.
    Taherpour A, Hashemi A. Detection of OqxAB efflux pumps, OmpK35 and OmpK36 porins in extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae isolates from Iran. Hippokratia. 2013;17(4):355-8. [PubMed ID: 25031516]. [PubMed Central ID: PMC4097418].
  • 14.
    Harmsen D, Claus H, Witte W, Rothganger J, Claus H, Turnwald D, et al. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J Clin Microbiol. 2003;41(12):5442-8. [PubMed ID: 14662923]. [PubMed Central ID: PMC309029]. https://doi.org/10.1128/jcm.41.12.5442-5448.2003.
  • 15.
    Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, et al. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol. 2005;43(1):421-6. [PubMed ID: 15635004]. [PubMed Central ID: PMC540159]. https://doi.org/10.1128/JCM.43.1.421-426.2005.
  • 16.
    Pourmand MR, Yousefi M, Salami SA, Amini M. Evaluation of expression of NorA efflux pump in ciprofloxacin resistant Staphylococcus aureus against hexahydroquinoline derivative by real-time PCR. Acta Medica Iranica. 2014:424-9.
  • 17.
    Farhadian A. Determination of Vancomycin and Methicillin Resistance in Clinical Isolates of Staphylococcus aureus in Iranian Hospitals. British Microbiology Research Journal. 2014;4(4):454-61. https://doi.org/10.9734/bmrj/2014/4836.
  • 18.
    Valadan Tahbaz S, Azimi L, Nowroozi J, Armin S, Fallah F. Multilocus sequence typing and antibiotic resistant patterns of the meticillin-resistant Staphylococcus aureus isolates from different clinical specimens. Reviews in Medical Microbiology. 2019;30(2):77-82. https://doi.org/10.1097/mrm.0000000000000176.
  • 19.
    Hashem RA, Yassin AS, Zedan HH, Amin MA. Fluoroquinolone resistant mechanisms in methicillin-resistant Staphylococcus aureus clinical isolates in Cairo, Egypt. J Infect Dev Ctries. 2013;7(11):796-803. [PubMed ID: 24240036]. https://doi.org/10.3855/jidc.3105.
  • 20.
    Frempong-Manso E, Raygada JL, DeMarco CE, Seo SM, Kaatz GW. Inability of a reserpine-based screen to identify strains overexpressing efflux pump genes in clinical isolates of Staphylococcus aureus. Int J Antimicrob Agents. 2009;33(4):360-3. [PubMed ID: 19097759]. https://doi.org/10.1016/j.ijantimicag.2008.10.016.
  • 21.
    DeMarco CE, Cushing LA, Frempong-Manso E, Seo SM, Jaravaza TA, Kaatz GW. Efflux-related resistance to norfloxacin, dyes, and biocides in bloodstream isolates of Staphylococcus aureus. Antimicrob Agents Chemother. 2007;51(9):3235-9. [PubMed ID: 17576828]. [PubMed Central ID: PMC2043220]. https://doi.org/10.1128/AAC.00430-07.
  • 22.
    Kosmidis C, Schindler BD, Jacinto PL, Patel D, Bains K, Seo SM, et al. Expression of multidrug resistance efflux pump genes in clinical and environmental isolates of Staphylococcus aureus. Int J Antimicrob Agents. 2012;40(3):204-9. [PubMed ID: 22766161]. https://doi.org/10.1016/j.ijantimicag.2012.04.014.
  • 23.
    Stavri M, Piddock LJ, Gibbons S. Bacterial efflux pump inhibitors from natural sources. J Antimicrob Chemother. 2007;59(6):1247-60. [PubMed ID: 17145734]. https://doi.org/10.1093/jac/dkl460.
  • 24.
    Khan SA. Molecular Characterization of Fluoroquinolone Resistance of Methicillin –Resistant Clinical Staphylococcus aureus Isolates from Rawalpindi, Pakistan. Medical Research Archives. 2015;2(2). https://doi.org/10.18103/mra.v2i2.260.
  • 25.
    Mashouf RY, Hosseini SM, Mousavi SM, Arabestani MR. Prevalence of Enterotoxin Genes and Antibacterial Susceptibility Pattern of Staphylococcus aureus Strains Isolated from Animal Originated Foods in West of Iran. Oman Med J. 2015;30(4):283-90. [PubMed ID: 26366263]. [PubMed Central ID: PMC4561649]. https://doi.org/10.5001/omj.2015.56.
  • 26.
    Garbacz K, Piechowicz L, Podkowik M, Mroczkowska A, Empel J, Bania J. Emergence and spread of worldwide Staphylococcus aureus clones among cystic fibrosis patients. Infect Drug Resist. 2018;11:247-55. [PubMed ID: 29503574]. [PubMed Central ID: PMC5826090]. https://doi.org/10.2147/IDR.S153427.
  • 27.
    Goudarzi M, Goudarzi H, Sa Figueiredo AM, Udo EE, Fazeli M, Asadzadeh M, et al. Molecular Characterization of Methicillin Resistant Staphylococcus aureus Strains Isolated from Intensive Care Units in Iran: ST22-SCCmec IV/t790 Emerges as the Major Clone. PLoS One. 2016;11(5). e0155529. [PubMed ID: 27171373]. [PubMed Central ID: PMC4865093]. https://doi.org/10.1371/journal.pone.0155529.
  • 28.
    Goudarzi M, Seyedjavadi SS, Nasiri MJ, Goudarzi H, Sajadi Nia R, Dabiri H. Molecular characteristics of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from patients with bacteremia based on MLST, SCCmec, spa, and agr locus types analysis. Microb Pathog. 2017;104:328-35. [PubMed ID: 28159661]. https://doi.org/10.1016/j.micpath.2017.01.055.
  • 29.
    Goudarzi M, Fazeli M, Goudarzi H, Azad M, Seyedjavadi SS. Spa Typing of Staphylococcus aureus Strains Isolated From Clinical Specimens of Patients With Nosocomial Infections in Tehran, Iran. Jundishapur Journal of Microbiology. 2016;9(7). https://doi.org/10.5812/jjm.35685.
  • 30.
    Ohadian Moghadam S, Pourmand MR, Mahmoudi M, Sadighian H. Molecular characterization of methicillin-resistant Staphylococcus aureus: characterization of major clones and emergence of epidemic clones of sequence type (ST) 36 and ST 121 in Tehran, Iran. FEMS Microbiol Lett. 2015;362(8):fnv043. [PubMed ID: 25795589]. https://doi.org/10.1093/femsle/fnv043.
  • 31.
    Alkharsah KR, Rehman S, Alnimr A, Diab A, Hawwari A, Tokajian S. Molecular typing of MRSA isolates by spa and PFGE. Journal of King Saud University - Science. 2019;31(4):999-1004. https://doi.org/10.1016/j.jksus.2018.07.018.

Copyright

Copyright © 2020, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

1
Jul
2014

Microbial Susceptibility and Plasmid Profiles of Methicillin-Resistant Staphylococcus aureus and Methicillin-Susceptible S. aureus

Fatemeh Shahkarami,
Ahmad Rashki,
Zahra Rashki Ghalehnoo

Shahkarami F, Rashki A, Rashki Ghalehnoo Z. Microbial Susceptibility and Plasmid Profiles of Methicillin-Resistant Staphylococcus aureus and Methicillin-Susceptible S. aureus. Jundishapur J Microbiol. 2014;7(7):e16984. doi: https://doi.org/10.5812/jjm.16984

1
Jun
2014

Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains

Seyedeh Mahsan Hoseini Alfatemi,
Mohammad Motamedifar,
Nahal Hadi,
Hadi Sedigh Ebrahim Saraie

Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur J Microbiol. 2014;7(6):e10741. doi: https://doi.org/10.5812/jjm.10741

5
Apr
2020
Staphylococcal Cassette Chromosome mec Typing of Meticillin-Resistant Staphylococcus aureus in Kermanshah Province, West of Iran

Staphylococcal Cassette Chromosome mec Typing of Meticillin-Resistant Staphylococcus aureus in Kermanshah Province, West of Iran

Yahyah Hesari,
Nasrollah Sohrabi,
Ramin Abiri,
Sajjad Babaei,
Zohreh Amiri

Hesari Y, Sohrabi N, Abiri R, Babaei S, Amiri Z. Staphylococcal Cassette Chromosome mec Typing of Meticillin-Resistant Staphylococcus aureus in Kermanshah Province, West of Iran. Jundishapur J Microbiol. 2020;13(3):e98852. doi: https://doi.org/10.5812/jjm.98852

3
Oct
2017

Molecular Characterization and Antimicrobial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus Isolates in Tabriz, Northwest of Iran

Mojtaba Nikbakht,
Mohammad Ahangarzadeh Rezaee,
Alka Hasani,
Mohammad Reza Nahaei,
Javid Sadeghi,
Sirus Jedari Seifi

Nikbakht M, Ahangarzadeh Rezaee M, Hasani A, Nahaei MR, Sadeghi J, et al. Molecular Characterization and Antimicrobial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus Isolates in Tabriz, Northwest of Iran. Arch Pediatr Infect Dis. 2017;5(4):e61620. doi: https://doi.org/10.5812/pedinfect.61620

31
Dec
2024
Methicillin-Resistant Staphylococcus aureus Isolated from Central Region of Iran: Antibiotic Resistance and SCCmecA Types

Methicillin-Resistant Staphylococcus aureus Isolated from Central Region of Iran: Antibiotic Resistance and SCCmecA Types

Seyed Ali Fatehi Fazli,
Mehdi Fatahi-Bafghii,
Mahmoud Vakili,
Maryam Sadeh

Fatehi Fazli SA, Fatahi-Bafghii M, Vakili M, Sadeh M. Methicillin-Resistant Staphylococcus aureus Isolated from Central Region of Iran: Antibiotic Resistance and SCCmecA Types. Jundishapur J Microbiol. 2024;17(12):e156747. doi: https://doi.org/10.5812/jjm-156747

More by these authors

Arezoo BostanmaneshradPubMedScholar
Jamileh NowrooziPubMedScholar
Gita EslamiPubMedScholar
Ali HashemiPubMedScholar