Cover image of the article: The Occurrence and Characterization of Class I, II, and III Integrons Among Carbapenemase-Producing Clinical Strains of Acinetobacter baumannii in Tehran, Iran

Image Credit:Jundishapur J Microbiol

The Occurrence and Characterization of Class I, II, and III Integrons Among Carbapenemase-Producing Clinical Strains of Acinetobacter baumannii in Tehran, Iran

Authors

Omid Azizi1, 2, Sepideh Fereshteh3, Omid Nasiri3, Mohammad GhorbaniMohammad Ghorbani ORCID2, 4, Seyed Mahmoud Barzi3, Farzad Badmasti3, 5,*
1Department of Laboratory Sciences, School of Paramedical Sciences, Torbat Heydariyeh University of Medical sciences, Torbat Heydariyeh, Iran
2Health Sciences Research Center, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran
3Department of Bacteriology, Pasteur Institute of Iran, Tehran, Iran
4Department of Public Health, School of Health, Torbat Heydariyeh University of Medical Sciences, Torbat Heydariyeh, Iran
5Microbiology Research Center (MRC), Pasteur Institute of Iran, Tehran, Iran
*Corresponding Author: Department of Bacteriology, Pasteur Institute of Iran, Tehran, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 14, issue 6; e117766
Published online:Aug 21, 2021
Article type:Research Article
Received:Jul 10, 2021
Accepted:Aug 09, 2021
How to Cite:Azizi O, Fereshteh S, Nasiri O, Ghorbani M, Barzi SM, et al. The Occurrence and Characterization of Class I, II, and III Integrons Among Carbapenemase-Producing Clinical Strains of Acinetobacter baumannii in Tehran, Iran. Jundishapur J Microbiol. 2021;14(6):e117766. doi: https://doi.org/10.5812/jjm.117766

Abstract

Background:

Acinetobacter baumannii has emerged as a critical pathogen with high morbidity and mortality in long-term hospitalized patients who stay in intensive care units. Carbapenemases and integrons are two critical DNA elements that contribute to the emergence of multidrug-resistant (MDR) A. baumannii.

Objectives:

The current study aimed at characterization and molecular detection of class 1, 2, and 3 integrons among carbapenemase-producing A. baumannii strains recovered from a clinical setting in Tehran, Iran.

Methods:

A total of 65 non-replicated clinical strains were considered in this study. Class 1, 2, and 3 carbapenemase genes and clonal relatedness of the isolates were investigated by PCR assay.

Results:

The prevalence of carbapenemases was as follows: blaOXA23 (92.31%), blaVIM (69.23%), and blaNDM (1.54%). In addition, PCR sequencing confirmed the presence of gene cassette arrays consisting of aacA4-catB8-aadA1 (12/46, 26.09%), aadB-aadA1 (26.09%, 12/46), arr2-cm1A5 (30.43%, 14/46), and dfrA1-aadA1 (7.39%, 8/46) in class 1 integron and dfrA1-sat2 (52.94%, 9/17), and sat2-aadA1 (47.06%, 8/17) in class 2 integron. Sequence-based typing of both blaOXA-51-like and ampC revealed the following distribution of three different clone types among isolates: clonal complex (CC) 10 (46.15%, 30/65), CC2 (40%, 26/65), and CC3 (13.85%, 9/65). Statistical analysis showed that the presence of the intI1, blaOXA23, blaVIM, or blaNDM genes can significantly increase the acquiring MDR phenotypes in A. baumannii isolates.

Conclusions:

High prevalence of carbapenemase-producing A. baumannii harboring integrons is alarming public health. It seems that class 1 integron can be served as a predictive biomarker for the presence of MDR phenotypes in the clinical setting. However, integrons do not carry carbapenemases in these strains.

1. Background

Antimicrobial resistance (AMR) has become a significant problem with the increasing burden for healthcare systems worldwide. In recent years, antibiotic resistance has been associated with considerable morbidity and mortality rates due to prolonged hospitalization (1). Although the occurrence of antibiotic resistance is a natural phenomenon in bacteria, it is exacerbated by the misuse of antibiotics in humans and animals (2). A significant reason for the rapid spread of antibiotic resistance is the highly mobile genetic elements. These elements can replicate and pass among bacterial species (3). Acinetobacter baumannii is a common nosocomial pathogen that causes different infections, such as ventilator-associated pneumonia, bacteremia, urinary tract infections, surgical site infections, and secondary meningitis in hospitalized patients, especially those with immunodeficiency (4). The relatively recent emergence and increased prevalence of multidrug-resistant (MDR) A. baumannii has been an issue of great concern. The World Health Organization (WHO) lists A. baumannii as a critical pathogen, highlighting the need to develop new and effective antibiotics (5).
Miserably, the number of MDR A. baumannii isolates has increased significantly worldwide. Also, A. baumannii can acquire or upregulate resistance genes through genomic plasticity, limiting effective therapeutic options and increasing mortality rates. This phenomenon can increase resistance to multiple antibiotics, including those used as a last resort, such as carbapenems, reserved for cases where all alternatives have been depleted (6). The enzymes IMP, VIM, GIM, SIM, and NDM are classified as class (B) Metallo-β-lactamases (MBLs), and their genes are mostly found in transmissible plasmids (7).
In Acinetobacter spp., the acquisition and spread of an antimicrobial-resistant determinant in hospitals and communities are often facilitated by horizontal gene transfer of mobile genetic elements, including plasmids, transposons, and integrons. Among these mobile elements, integrons are unique for their ability to carry and express resistance genes (8). It has been suggested that multidrug-resistant strains acquire their antibiotic-resistant genes via integrons that take single or multiple gene cassettes (9). Integrons carrying different cassette arrays have been reported in several studies from South America to Far East Asia (10).

2. Objectives

The current study aimed at characterizing class 1, 2, and 3 integrons among clinical carbapenemase-producing A. baumannii isolates from hospitalized patients in Tehran, Iran, followed by the genotypic analysis of these isolates.

3. Methods

3.1. Collection and Identification of Bacterial Isolates

In this cross-sectional study, a total of 103 consecutive non-duplicate A. baumannii isolates collected from clinical specimens in hospitalized patients from an educational hospital in Tehran, Iran, from November 2019 to July 2020 were investigated. The isolates were obtained from sputum, tracheal aspirate, wound, catheter, and cerebrospinal fluid (CSF). Standard microbiological and biochemical tests, including triple sugar iron agar (TSI), indole, methyl red (MR), Voges–Proskauer (VP), citrate (IMVIC), and oxidase test were used to identify A. baumannii isolates. All K/K colonies on TSI and oxidase negative coccobacilli (11) were genotypically confirmed as A. baumannii by the presence of the blaOXA-51-like (1) and rpoB PCR sequencing (12).

3.2. Antibiotic Susceptibility Testing

According to the Clinical and Laboratory Standards Institute (CLSI), the antibiotic susceptibility profiles of A. baumannii isolates were determined using the disk diffusion method. In this step, the results were interpreted with criteria published in CLSI 2019 (13). For this purpose, various antibiotic disks, such as ampicillin/sulbactam (SAM, 10 µg), minocycline (MN, 30 µg), meropenem (MEM, 10 µg), amikacin (AN, 30 µg), ciprofloxacin (CIP, 5 µg), trimethoprim-sulfamethoxazole (SXT, 1.25 + 23.75 µg), and ceftazidime (CAZ, 30 µg) were used. In the next step, minimum inhibitory concentrations (MICs) were determined for imipenem in carbapenem-resistant isolates using E-test (bioMérieux). Antibiotic susceptibility was interpreted based on CLSI clinical breakpoints. The Escherichia coli ATCC 25922 was used as a quality control strain. The categorizations of multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan-drug resistant (PDR) A. baumannii were performed based on Magiorakos criteria (14).

3.3. Detection of Genes Encoding β-lactamase, Integrases, and Clonal Complex Analysis

DNAs of bacterial isolates were extracted as previously described (15). A PCR experiment was used to determine the presence of genes producing carbapenemases and integrases using primers targeting blaOXA-23-like, blaVIM, blaNDM, intI1, intI2, and intI3 genes (Table 1). The PCR conditions were based on the mentioned reference (16). All isolates were confirmed as A. baumannii by sequencing of the blaOXA-51-like, an intrinsic enzyme marker, and ropB, as described previously (15). Determination of the allele number and detection of the clonal complex (CC) for each isolate were performed by a combination of sequence-based typing (SBT) of blaOXA-51-like and ampC as reported previously (15).
Table 1.
Primer Pairs Used for PCR Amplification and Sequencing
TargetPrimer Sequence (5ˊ - 3ˊ)Product Size (bp)Reference
rpoB1024(12)
FCTGACTTGACGCGTGA
RTGTTTGAACCCATGAGC
blaOXA-51-like 501(17)
FGATCGGATTGGAGAACCAGA
RATTTCTGACCGCATTTCCAT
blaNDM155(18)
FGCGCAACACAGCCTGACTTT
RCAGCCACCAAAAGCGATGTC
blaVIM518(19)
FGGGAGCCGAGTGGTGAGT
RGGCACAACCACCGTATAG
intI1250(20)
FTCTCGGGTAACATCAAGG
RAGGAGATCCGAAGACCTC
intI2789(21)
FCACGGATATGCGACAAAAAGGT
RGTAGCAAACGAGTGACGAAATG
intI3980(21)
FGCCTCCGGCAGCGACTTTCAG
RACGGATCTGCCAAACCTGACT
Conserved segment of class 1 integronsVariable(21)
5′-CSGGCATCCAAGCAGCAAG
3′-CSAAAGCAGACTTGACCTGA or GAAGCGGCGTCGGCTTGA
Conserved segment of class 2 integronsVariable(21)
5′-CSACCTTTTTGTCGCATATCCGTG
3′-CSTACCTGTTCTGCCCGTATCT

3.4. PCR Amplification and Sequencing of Integrons Internal Variable Region

All integron–positive MDR A. baumannii strains were assessed for variable regions of Class 1 - 2 integrons by the primers 5′-CS/3′-CS. The PCR conditions were based on the mentioned reference (9). Sequencing of the purified PCR amplicons was performed using DNA analyzers (Applied Biosystems, Inc.). The nucleotide sequence analysis was performed by the BLAST tool at the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (22). The sequences were manually analyzed using CLC main workbench software version 20 (CLC Bio, Aarhus, Denmark).

3.5. Statistical Analyses

The normality of continuous data distribution was assessed by the Kolmogorov-Smirnov test. Numerical data were summarized as means and standard deviations or median and interquartile range as appropriate. Categorical data were summarized as frequencies and proportions. The association of variables was analyzed using one-way analysis of variance, student t-test, and Mann-Whitney U Kruskal-Wallis tests as appropriate. All statistical analyses were conducted with STATA 12.0 (StataCorp LP, College Station, TX, USA), SPSS for Windows version 24.0 (IBM Corp., Armonk, NY), and GraphPad Prism software version 8.0 (GraphPad Software Inc., La Jolla, CA, USA). A P < 0.05 was defined as statistical significance in all tests.

4. Results

4.1. Collection and Identification of Bacterial Isolates

A total of 65 non-repetitive isolates were collected and confirmed as MDR A. baumannii by phenotypic and genotypic antimicrobial methods. The isolates were recovered from clinical specimens, including tracheal aspirate (n = 57/65; 87.69%), sputum (n = 3/65; 4.62%), catheter (n = 3/65; 4.62%), CSF (n = 1/65; 1.54%), and wound (n = 1/65; 1.54%). The mean age of the patients was 48.25 ± 21.09 years (ranging from 5 to 96). Also, 41 patients (63.1%) were male, and 24 cases (36.9%) were female (Table 2). Antimicrobial susceptibility results for the 65 A. baumannii isolates are shown in Table 2. The isolates showed MDR phenotypes and resistance to most of the tested antibiotics by the disk diffusion method, in particular high-level resistance to AN (n = 64; 98.46%), SXT (n = 63; 96.92%), CIP (n = 62; 95.38%), MEM (n = 60; 92.31%), and CAZ (n = 57; 87.69%) (Figure 1). The imipenem MIC90 for all isolates was ≥16 mg/L. Quite alarmingly, 5 isolates (7.69%) were resistant to all antibiotics tested. Surprisingly, 55 (84.62%) and 35 (53.85%) out of 65 isolates were susceptible to MN and SAM, respectively. Notably, the frequency of MDR isolates was higher in non-ICU wards rather than ICU (Figure 2).
Table 2.
Demographic Data on Samples and 65 Non-duplicated Multidrug-Resistant Acinetobacter baumannii Isolates Recovered from Hospitalized Patients
Isolate No.Age/SexWardOutcomeIsolation sourceResistance PatternsMICIMPblaOXA23blaVIMblaNDMintI1Class 1 Integron Cassette ArraysintI2Class 2 Integron Cassette ArraysIntI3Clonal Complex
142/MPoisoning wardNDSSAM-MEM-AN-CIP-SXT- CAZ8+--+aadB-aadA1---CC2
263/MNeurosurgery ICUDeathTMEM-AN-CIP-SXT- CAZ> 64-+-+aadB-aadA1---CC10
350/MEmergency ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ16+--+dfrA1-aadA1---CC2
450/FEmergency ICUDeathTMN-SAM-MEM-AN-CIP-SXT- CAZ16+--+dfrA1-aadA1+sat2-aadA1-CC2
540/MPoisoning ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ32++-+arr2-cm1A5+dfrA1-sat2-CC3
641/MPoisoning ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ> 64++-+dfrA1-aadA1---CC10
775/MGeneral ICUDeathTSAM-AN-CIP-SXT- CAZ8++-+arr2-cm1A5---CC10
850/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ16++-+aacA4-catB8-aadA1---CC10
942/MGeneral ICUDischargeTMEM-AN-CIP-SXT- CAZ8---+dfrA1-aadA1+sat2-aadA1-CC3
1025/FGeneral ICUDeathTMEM-AN-CIP-SXT- CAZ32++------CC10
1125/FGeneral ICUDeathTMEM-AN-CIP-SXT- CAZ> 64++-+dfrA1-aadA1---CC3
1237/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ> 64++---+dfrA1-sat2-CC3
1322/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ16++-+arr2-cm1A5---CC10
1437/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ> 64++-+dfrA1-aadA1---CC10
1529/MNeurosurgery ICUDischargeTMEM-AN-CIP-SXT- CAZ32+--+arr2-cm1A5+dfrA1-sat2-CC3
1618/FPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ> 64++-+arr2-cm1A5---CC10
1725/FGeneral ICUDeathCMN-MEM-AN-CIP-SXT- CAZ> 64++-+arr2-cm1A5---CC2
1849/MNeurosurgery ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ16++-+arr2-cm1A5+dfrA1-sat2-CC2
1940/FNeurosurgery wardDischargeCSAM-MEM-AN-CIP-SXT- CAZ16+----+sat2-aadA1-CC2
2096/MInfectious wardDeathTSAM-MEM-AN-CIP-SXT- CAZ32++-+dfrA1-aadA1---CC2
2132/FGeneral ICUDeathTMEM-AN-CIP-SXT- CAZ> 64++-+arr2-cm1A5+dfrA1-sat2-CC10
2280/MNeurosurgery ICUDischargeTMEM-AN-CIP-SXT- CAZ16+--+dfrA1-aadA1---CC10
235/MGeneral ICUDischargeTSAM-MEM-AN-CIP-SXT- CAZ32++-+aacA4-catB8-aadA1---CC10
2460/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ16+--+arr2-cm1A5---CC2
2532/FPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ32++-+arr2-cm1A5---CC10
2665/FEmergency ICUDeathTMEM-AN-CIP-SXT- CAZ> 64+-------CC2
2775/MGeneral ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ16++-+arr2-cm1A5+sat2-aadA1-CC10
2894/MInfectious wardDeathTMN-SAM-MEM-AN-CIP-SXT- CAZ> 64++-+aacA4-catB8-aadA1+sat2-aadA1-CC2
2958/MPoisoning ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ16++-+aacA4-catB8-aadA1---CC10
3033/FGeneral ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ32++-+aadB-aadA1---CC2
3129/MNeurosurgery ICUDischargeTMEM-AN-CIP-SXT8+-------CC10
3280/MNeurosurgery ICUDischargeSMEM-AN-CIP-SXT- CAZ>64++------CC10
3316/FPoisoning ICUDischargeTMN-MEM-AN-CIP-SXT- CAZ16+-------CC2
3474/FGeneral ICUDeathTSAM-MEM-AN-CIP-SXT8+--+aacA4-catB8-aadA1---CC10
3525/MPoisoning ICUDischargeTSAM-MEM-AN-CIP-SXT- CAZ16++------CC3
3658/MPoisoning ICUDeathTSAM-AN-SXT> 64++-+aadB-aadA1+sat2-aadA1-CC10
3755/MPoisoning ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ> 64++------CC10
3874/FGeneral ICUDeathTMEM-AN-CIP-SXT- CAZ8+--+aadB-aadA1---CC10
3933/FGeneral ICUDeathTMEM-AN-CIP-SXT- CAZ32++------CC2
4040/MNeurosurgery ICUDischargeTMN-MEM-AN-CIP-SXT8+-------CC2
419/FGeneral ICUDischargeTMEM-AN-CIP-SXT- CAZ16++------CC10
4262/FGeneral ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ32++------CC10
4344/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ16+--+aadB-aadA1+sat2-aadA1-CC10
4440/FPoisoning ICUDeathTSAM-MEM-AN-CIP-SXT- CAZ32++------CC2
4569/MGeneral ICUDischargeTMEM-AN-CIP-SXT- CAZ32+--+aadB-aadA1+sat2-aadA1-CC2
4640/FPoisoning ICUDeathTMEM-AN-CIP-SXT8++------CC2
4769/FGeneral ICUDischargeTMEM-AN-CIP-SXT- CAZ> 64++-+aacA4-catB8-aadA1---CC2
4880/MPoisoning ICUDischargeTMEM-AN-CIP-SXT- CAZ> 64++------CC10
4941/MPoisoning ICUDischargeTMN-SAM-MEM-AN-CIP-SXT- CAZ16++------CC2
5092/MGeneral ICUDeathTMN-MEM-AN-CIP-SXT- CAZ32++---+dfrA1-sat2-CC2
5145/MNeurosurgery ICUDischargeWMEM-AN-CIP- CAZ8+--+arr2-cm1A5---CC2
5250/FPoisoning ICUDischargeTSAM-MEM-AN-CIP-SXT- CAZ16++------CC10
5355/MPoisoning ICUDischargeTSAM-MEM-AN-CIP-SXT- CAZ32++-+aacA4-catB8-aadA1---CC2
5445/MNeurosurgery ICUDischargeTSAM-MEM-AN-CIP-SXT- CAZ> 64++-+arr2-cm1A5---CC2
5569/MPoisoning ICUDeathSMEM-AN-CIP-SXT- CAZ16+--+arr2-cm1A5+dfrA1-sat2-CC10
5668/FNeurology wardDischargeCAN-CIP-SXT- CAZ32-+-+aacA4-catB8-aadA1---CC3
5719/MNeurosurgery wardDischargeTSAM-MEM-AN-CIP-SXT- CAZ16++-+aacA4-catB8-aadA1---CC3
5865/MPoisoning ICUDischargeTMEM-AN-CIP- CAZ8--++aadB-aadA1---CC10
5958/MNeurosurgery wardDischargeCFSAM-MEM-AN-CIP-SXT- CAZ> 64++-+aadB-aadA1---CC10
6046/FPoisoning ICUDeathTMN-MEM-AN-CIP-SXT- CAZ> 64++-+aacA4-catB8-aadA1+dfrA1-sat2-CC2
6155/MPoisoning ICUDeathTMEM-AN-CIP-SXT- CAZ32++-+aadB-aadA1---CC10
6258/FNeurosurgery ICUNDTSAM-MEM-AN-CIP-SXT- CAZ16+--+aadB-aadA1---CC10
6317/MPoisoning ICUDischargeTMN-SAM-MEM-AN-CIP-SXT- CAZ32++-+aacA4-catB8-aadA1+dfrA1-sat2-CC2
6435/MNeurosurgery ICUDischargeTCIP-SXT- CAZ32-+-+aadB-aadA1---CC3
6531/FGeneral ICUDeathTMN-SAM-MEM-AN-CIP-SXT- CAZ> 64++-+aacA4-catB8-aadA1---CC2
Abbreviations: SAM, ampicillin/sulbactam; MN, minocycline; MEM, meropenem; AN, amikacin; CIP, ciprofloxacin; SXT, trimethoprim- sulfamethoxazole; CZ, ceftazidime; ND, not determined; S, sputum; T, tracheal; CF, CSF; C, catheter; W, wound.
Antibiotics resistance patterns in <i>Acinetobacter baumannii</i> isolates. Notably, out of 65 isolates, 10 (15.38%) and 30 (46.15%) strains were susceptible to MN and SAM, respectively. Bars represent mean ± standard deviation (SD). The numbers on the bars represent percentages.
Figure 1.
Antibiotics resistance patterns in Acinetobacter baumannii isolates. Notably, out of 65 isolates, 10 (15.38%) and 30 (46.15%) strains were susceptible to MN and SAM, respectively. Bars represent mean ± standard deviation (SD). The numbers on the bars represent percentages.
The prevalence of <i>Acinetobacter baumannii</i> isolates obtained from different ICU and non-ICU wards. General ICU had the highest share of clinical samples (72%), while the emergency ICU had the least share of clinical samples (50%). Bars represent mean ± standard deviation (SD). The numbers on the bars represent percentages. ICU, intensive care unit.
Figure 2.
The prevalence of Acinetobacter baumannii isolates obtained from different ICU and non-ICU wards. General ICU had the highest share of clinical samples (72%), while the emergency ICU had the least share of clinical samples (50%). Bars represent mean ± standard deviation (SD). The numbers on the bars represent percentages. ICU, intensive care unit.

4.2. Detection of β-lactamases Encoding Genes

The detected carbapenemase (blaOXA23) and Metallo-β-lactamases (blaVIM and blaNDM) are listed in Table 2. The blaOXA23 was detected in 92.31% (60/65) isolates using PCR amplification. The blaVIM and blaNDM were detected in 69.23% (45/65) and 1.54% (1/65) of the isolates, respectively. Data analysis showed that the presence of blaOXA23 in strains caused a 4- (95% CI, 1.07 - 14.57) and 14-fold (95% CI, 4.22 - 47.50) increase (significantly) in the odds of resistance to SAM and MEM and also the presence of blaVIM caused a 3.5- (95% CI, 1.48 - 8.59) and 11-fold (95% CI, 3.90 - 33.67) increase (significantly) in the odds of resistance to SAM and MEM, respectively.

4.3. PCR Amplification and Characterization of Class 1-3 Integrons

The presence of integrase genes, intI1, intI2, and intI3 were detected by PCR in 70.77% (46/65), 26.15% (17/65), and 0% (0/65) of MDR A. baumannii isolates, respectively. The class 1 and 2 integrons were widespread among clinical isolates. The intI3 was not detected in any of the strains. Cassette arrangements of class 1 and 2 integrons were characterized by PCR sequencing of gene cassettes in the internal variable regions of integrons. Sequencing confirmed the presence of cassette arrays consisting of aacA4-catB8-aadA1 (12/46, 26.09%), aadB-aadA1 (12/46, 26.09%), arr2-cm1A5 (14/46, 30.43%), and dfrA1-aadA1 (8/46, 7.39%) in class 1 integron and dfrA1-sat2 (9/17, 52.94%) and sat2-aadA1 (8/17, 47.06%) in class 2 integron (Figure 3).
The genetic maps of class 1 and 2 integrons in clinical isolates. PCR sequencing confirmed the presence of gene cassette arrays consisting of <i>aacA4-catB8-aadA1</i> (12/46, 26.09%), <i>aadB-aadA1</i> (12/46, 26.09%), <i>arr2-cm1A5</i> (14/46, 30.43%), and <i>dfrA1-aadA1</i> (8/46, 7.39%) in class 1 integron (left hand) and <i>dfrA1-sat2</i> (9/17, 52.94%) and <i>sat2-aadA1</i> (8/17, 47.06%) in class 2 integron (right hand).
Figure 3.
The genetic maps of class 1 and 2 integrons in clinical isolates. PCR sequencing confirmed the presence of gene cassette arrays consisting of aacA4-catB8-aadA1 (12/46, 26.09%), aadB-aadA1 (12/46, 26.09%), arr2-cm1A5 (14/46, 30.43%), and dfrA1-aadA1 (8/46, 7.39%) in class 1 integron (left hand) and dfrA1-sat2 (9/17, 52.94%) and sat2-aadA1 (8/17, 47.06%) in class 2 integron (right hand).
There was no significant difference in resistance to the studied antibiotics among intI1-positive and intI1-negative isolates. The intI1 negative isolates displayed 26.7%, 29.7%, 29%, 30.2%, 24.6%, and 40% resistance rate to SAM, AN, CIP, SXT, CAZ, and MN, respectively, compared with intI1-positive isolates. On the other hand, there was a statistically significant relationship (P < 0.05) between resistance to the tested antibiotics and the lack of the intI2 gene. The intI2-negative isolates displayed 73.3%, 73.4%, 74.2%, 73%, 71.9%, and 50% resistance rate to SAM, AN, CIP, SXT, CAZ, and MN, respectively, compared with intI2 positive isolates. Also, the rate of MDR phenotype in A. baumannii isolates positive for the intI1, blaOXA23, blaVIM, and blaNDM was statistically significant. In addition, although the probability of acquired MDR phenotype for the intI2-positive isolates was 2.7-fold (95% CI, 0.8-8.6) higher than intI2-negative isolates, the latter value was not statistically significant (P > 0.05) (Figure 4).
Odds ratio and 95% confidence interval of risk factors (having the <i>intI1</i>, <i>bla</i><sub>OXA23</sub>, <i>bla</i><sub>VIM</sub>, <i>bla</i><sub>NDM</sub>, or <i>intI2</i>) for acquiring multidrug-resistant phenotypes in <i>Acinetobacter baumannii</i> isolates. The numbers on the bars show the probability of acquired MDR phenotype in each considered risk factor. All of these risk factors were statistically significant except <i>intI2</i>. The dotted vertical line shows a significance threshold.
Figure 4.
Odds ratio and 95% confidence interval of risk factors (having the intI1, blaOXA23, blaVIM, blaNDM, or intI2) for acquiring multidrug-resistant phenotypes in Acinetobacter baumannii isolates. The numbers on the bars show the probability of acquired MDR phenotype in each considered risk factor. All of these risk factors were statistically significant except intI2. The dotted vertical line shows a significance threshold.

4.4. Sequence-Based Typing of blaOXA-51-like and ampC Alleles

Sequence-based typing of both blaOXA-51-like and ampC is a discriminatory and reliable method that can distinguish Acinetobacter isolates at the level of clonal complex (23). The SBT results revealed the following distribution of three different clone types among MDR isolates, including CC10 (46.15%, 30/65), CC2 (40%, 26/65), and CC3 (13.85%, 9/65), as shown in Table 2. Overall, 25 out of 30 isolates (83.33%) in CC10, 22 out of 26 isolates (84.62%) in CC2, and 8 out of 9 isolates (88.89%) in CC3 showed MIC ≥16 mg/L for imipenem. Therefore, CC2 and CC10 showed a high level of imipenem resistance. Data analysis showed a heterogenic structure in integron cassette arrays within CCs. The distribution of cassette arrays in class 1 and 2 integrons within clonal complexes is shown in Table 2.

4.5. Nucleotide Accession Numbers

DNA sequences of gene cassette arrays consisting of aacA4-catB8-aadA1 (GenBank accession number = MZ508285), aadB-aadA1 (MZ508283), arr2-cm1A5 (MZ508286), and dfrA1-aadA1 (MZ508284), in class 1 integron and dfrA1-sat2 (MZ508287) and sat2-aadA1 (MZ508288) in class 2 integron were deposited in GenBank database.

5. Discussion

Infections associated with MDR bacterial strains have become one of the leading causes of morbidity and mortality worldwide (24). Integrons as transposon-like genetic elements are conserved and encode antibiotic resistance determinants and have a high capacity for chromosomal integration in bacteria (25, 26). To date, several classes of integrons have been described, of which class 1 and 2 integrons are commonly reported from MDR A. baumannii strains (27). Carbapenems are usually the antibiotic of choice against A. baumannii strains. However, the rate of resistance to carbapenems in this bacterium is increasing day by day. Resistance to carbapenems can be due to various mechanisms, such as producing the enzymes, including Metallo-β-lactamase and oxacillinase (28, 29).
According to our results, most MDR A. baumannii isolates were obtained from the tracheal aspirate samples. Consistent with our research, in a study conducted by Souza et al., A. baumannii was the most frequently isolated bacterial species in the tracheal secretion of patients with ventilator-associated pneumonia (30). However, Barbier et al. reported that the most frequent pathogens associated with ventilator-associated pneumonia were Staphylococcus aureus, Pseudomonas aeruginosa, and Enterobacteriaceae (31). The ICU has been described as the main center of antibiotic resistance development, with increasingly resistant isolates complicating the treatment of MDR infections in ICU patients (32). Surprisingly, the frequency of MDR A. baumannii isolates was higher in non-ICU wards rather than ICU. This is alarming and indicates that MDR isolates have been circulated in our hospital, and urgent attention and application of preventive protocols are needed to reduce such a fearful threat in hospitalized patients. In this study, the highest antibiotic resistance was related to amikacin, trimethoprim + sulfamethoxazole, and ciprofloxacin, respectively. Also, A. baumannii strains producing aminoglycoside modifying enzymes (AMEs) are highly resistant to different aminoglycosides, such as gentamicin, amikacin, and tobramycin. Similar to our findings, Cho et al. reported aminoglycoside resistance genes in 81% Acinetobacter isolates from two Korean hospitals (33).
In this study, the imipenem MIC90 for all isolates was ≥ 16 mg/L and showed resistance to carbapenems. According to a study conducted by Lee et al., isolates with MIC ≤ 4 mg/L were susceptible to carbapenem, and those with MIC ≥ 8 mg/L were resistant in patients with A. baumannii bacteremia (34). Consistent with our results, Akbari Dehbalaei et al. reported that resistant to carbapenems was up to 85% in A. baumannii isolates (35). Unfortunately, in this study, 7.69% of the isolates were resistance to all tested antibiotics, which will be a significant obstacle to effective treatment in the future. Therefore, antibiotic usage should be controlled to prevent this serious threat. On the other hand, 84.62% and 53.85% of isolates were susceptible to MN and SAM, respectively. This result indicated that these two antibiotics could be effective for the treatment of A. baumannii infections in combination form. However, excessive usage of these two antibiotics can also increase antibiotic resistance against them.
In this study, blaOXA-23, blaVIM, and blaNDM were detected with high frequency in A. baumannii isolates. The blaOXA-23-like gene is one of the most prevalent β-lactamase genes in the carbapenem-resistant A. baumannii genome, mostly on plasmids (36). Specific and quick identification of A. baumannii and strains containing the blaOXA-23-like gene will reference information on treatment and control measures for carbapenem resistance (37). Ning et al. showed that ST191 and ST195 isolates of OXA-23-producing A. baumannii could spread in a hospital and became potential nosocomial outbreak strains. In this regard, they suggested that antimicrobial management and surveillance of imipenem-resistant A. baumannii should be improved (38). Moreover, in the study by Akbari Dehbalaei et al., the blaOXA-23 gene was detected in 81.81% of the isolates.
This study concluded that highly resistant blaOXA-23 gene-harboring endemic clones of A. baumannii were disseminated in the ICUs of two studied hospitals (35). The blaVIM is another β-lactamases encoding genes with a frequency of 69.23% in this study. The frequency of this gene was reported to be 17.44% and 18.18% in other studies conducted in Iran in 2014 and 2016, respectively (39, 40). Comparison of these results showed that the frequency of this gene had increased significantly in recent years in Iran (39, 40). Therefore, it seems necessary to find new treatments to deal with this problem. In this study, only one isolate harbored the blaNDM-1 gene. Pillonetto et al. presented the first instance of A. baumannii sequence type 25 generating blaNDM-1, isolated from the urinary tract of a 71-year-old man in Brazil (41). Bonnin et al. recently suggested that A. baumannii may accept resistant genes and act as a gene donor passing resistance genes to other bacteria, including Enterobacteriaceae (42). It seems that the MDR phenotype in A. baumannii is associated with the cooperation of carbapenemases, class 1 integrons, and possibly efflux pumps.
The presence of integrase genes, intI1 and intI2, was detected by PCR in 70.77% and 26.15% of A. baumannii isolates, respectively. These data indicated that class 1 and 2 integrons were widely distributed among clinical isolates of A. baumannii. The intI3 was not detected in any of the strains. Similar to our study, Goudarzi and Azimi reported class 1 and 2 integrons in 66.7% and 20% of isolates, respectively. However, the class 3 integron was detected in three A. baumannii strains (8). Moreover, Nourbakhsh et al. reported the frequency of class 1, 2, and 3 integrons to be 100%, 44%, and 3%, respectively, among A. baumannii isolates (43). The sequence-based typing results of blaOXA-51-like and ampC alleles revealed the following distribution of three different clone types among MDR isolates, including CC10 (46.15%), CC2 (40%), and CC3 (13.85%). In the study by Nazari et al., a comparison of clonal relatedness between clinical and non-clinical isolates illustrated that widespread clones, including CC2, CC3, and CC10 were common clonal complexes among clinical and non-clinical strains (15). In addition, a systematic review on clonal relatedness of A. baumannii isolated from the Middle East showed that CC2 was the most prevalent clonal complex isolated from Lebanon, Palestine, Saudi Arabia, Turkey, Yemen, Iran, Iraq, and Kuwait. In this study, CC2 and CC10 showed a high-level imipenem resistance (44).

5.1. Conclusions

The high prevalence of carbapenemase-producing A. baumannii isolates in the ICU requires a rigorous antimicrobial stewardship and infection control program. Class 1 and 2 integrons in clinical strains are repertoires of aminoglycoside-modifying enzymes. Class 1 integron can be served as a predictive biomarker for the presence of MDR bacteria in the clinical setting. However, hoarding of carbapenemases on the integron apparatus is not widespread among A. baumannii strains. Continuous surveillance MDR A. baumannii and elucidation of their AMR mechanisms in the clinical setting are clearly necessary to help develop effective therapy regimens and to prevent the further dissemination of these superbug bacteria. Further studies are required to elaborate the association of gene pools in A. baumannii and antibiotic resistance patterns with epidemic and clinical outcomes of infection.

Footnotes

  • Authors' Contribution: Omid Azizi, Sepideh Fereshteh, and Seyed Mahmmoud Barzi collected the samples and their data; Sepideh Fereshteh, Seyed Mahmmoud Barzi, and Omid Nasiri carried out other phenotypic and genotypic tests; Mohammad Ghorbani: Analyzed the data; Omid Azizi, Sepideh Fereshteh, and Farzad Badmasti wrote the manuscript; Farzad Badmasti, supervised the project and wrote and revised the manuscript.

  • Conflict of Interests: The authors declared that they have no conflicts of interest.

  • Data Reproducibility: The data presented in this study are openly available in one of the repositories or will be available on request from the corresponding author by this journal representative at any time during submission or after publication. Otherwise, all consequences of possible withdrawal or future retraction will be with the corresponding author.

  • Ethical Approval: This project was done based on ethical rules as already endorsed by the Pasteur Institute of Iran (Ethic No.: IR.PII.REC.1397.015). The consent form was not obtained from patients since the clinical isolates were collected from the clinic lab, and the data were obtained in a blind way.

  • Funding/Support: No funding was allocated for this study.

References

  • 1.
    Gholami M, Haghshenas M, Moshiri M, Razavi S, Pournajaf A, Irajian G, et al. Frequency of 16S rRNA methylase and aminoglycoside-modifying enzyme genes among clinical isolates of acinetobacter baumannii in Iran. Iran J Pathol. 2017;12(4):329-38. [PubMed ID: 29563928]. [PubMed Central ID: PMC5844677].
  • 2.
    Elshamy AA, Aboshanab KM. A review on bacterial resistance to carbapenems: epidemiology, detection and treatment options. Future Sci OA. 2020;6(3):FSO438. [PubMed ID: 32140243]. [PubMed Central ID: PMC7050608]. https://doi.org/10.2144/fsoa-2019-0098.
  • 3.
    Mirshekar M, Shahcheraghi F, Azizi O, Solgi H, Badmasti F. Diversity of class 1 integrons, and disruption of carO and dacD by insertion sequences among Acinetobacter baumannii isolates in Tehran, Iran. Microb Drug Resist. 2018;24(4):359-66. [PubMed ID: 28972863]. https://doi.org/10.1089/mdr.2017.0152.
  • 4.
    Piran A, Shahcheraghi F, Solgi H, Rohani M, Badmasti F. A reliable combination method to identification and typing of epidemic and endemic clones among clinical isolates of Acinetobacter baumannii. Infect Genet Evol. 2017;54:501-7. [PubMed ID: 28827174]. https://doi.org/10.1016/j.meegid.2017.08.018.
  • 5.
    Wasfi R, Rasslan F, Hassan SS, Ashour HM, Abd El-Rahman OA. Co-existence of carbapenemase-encoding genes in Acinetobacter baumannii from cancer patients. Infect Dis Ther. 2021;10(1):291-305. [PubMed ID: 33180321]. [PubMed Central ID: PMC7954895]. https://doi.org/10.1007/s40121-020-00369-4.
  • 6.
    Sarshar M, Behzadi P, Scribano D, Palamara AT, Ambrosi C. Acinetobacter baumannii: an ancient commensal with weapons of a pathogen. Pathogens. 2021;10(4). [PubMed ID: 33804894]. [PubMed Central ID: PMC8063835]. https://doi.org/10.3390/pathogens10040387.
  • 7.
    Al-Hassan L, Zafer MM, El-Mahallawy H. Multiple sequence types responsible for healthcare-associated Acinetobacter baumannii dissemination in a single centre in Egypt. BMC Infectious Diseases. 2019;19(1). https://doi.org/10.1186/s12879-019-4433-1.
  • 8.
    Goudarzi M, Azimi H. Dissemination of classes 1, 2, and 3 integrons in Acinetobacter baumannii strains recovered from intensive care units using polymerase chain reaction-restriction fragment length polymorphism. Jundishapur J Microbiol. 2017;10(5). https://doi.org/10.5812/jjm.13100.
  • 9.
    Hu Q, Hu Z, Li J, Tian B, Xu H, Li J. Detection of OXA-type carbapenemases and integrons among carbapenem-resistant Acinetobactor baumannii in a Teaching Hospital in China. J Basic Microbiol. 2011;51(5):467-72. https://doi.org/10.1002/jobm.201000402.
  • 10.
    Deng Y, Bao X, Ji L, Chen L, Liu J, Miao J, et al. Resistance integrons: Class 1, 2 and 3 integrons. Ann Clin Microbiol Antimicrob. 2015;14:45. [PubMed ID: 26487554]. [PubMed Central ID: PMC4618277]. https://doi.org/10.1186/s12941-015-0100-6.
  • 11.
    Karakece E. Culture media for detection of Acinetobacter baumannii selective media for detection of A baumannii. J Microbiol Exp. 2015;2(3). https://doi.org/10.15406/jmen.2015.02.00046.
  • 12.
    Abhari SS, Azizi O, Modiri L, Aslani MM, Assmar M, Fereshteh S, et al. Two new rapid PCR-based methods for identification of Acinetobacter baumannii isolated from clinical samples. Mol Cell Probes. 2021;58:101732. [PubMed ID: 33878387]. https://doi.org/10.1016/j.mcp.2021.101732.
  • 13.
    CLSI. Performance standards for antimicrobial susceptibility testing, CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2019.
  • 14.
    Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-81. [PubMed ID: 21793988]. https://doi.org/10.1111/j.1469-0691.2011.03570.x.
  • 15.
    Nazari M, Azizi O, Solgi H, Fereshteh S, Shokouhi S, Badmasti F. Emergence of carbapenem resistant Acinetobacter baumannii clonal complexes CC2 and CC10 among fecal carriages in an educational hospital. Int J Environ Health Res. 2021:1-11. https://doi.org/10.1080/09603123.2021.1892036.
  • 16.
    Firoozeh F, Mahluji Z, Khorshidi A, Zibaei M. Molecular characterization of class 1, 2 and 3 integrons in clinical multi-drug resistant Klebsiella pneumoniae isolates. Antimicrob Resist Infect Control. 2019;8:59. [PubMed ID: 30976386]. [PubMed Central ID: PMC6440154]. https://doi.org/10.1186/s13756-019-0509-3.
  • 17.
    Ramoul A, Loucif L, Bakour S, Amiri S, Dekhil M, Rolain JM. Co-occurrence of blaNDM-1 with blaOXA-23 or blaOXA-58 in clinical multidrug-resistant Acinetobacter baumannii isolates in Algeria. J Glob Antimicrob Resist. 2016;6:136-41. [PubMed ID: 27530856]. https://doi.org/10.1016/j.jgar.2016.05.003.
  • 18.
    Diene SM, Bruder N, Raoult D, Rolain JM. Real-time PCR assay allows detection of the New Delhi metallo-beta-lactamase (NDM-1)-encoding gene in France. Int J Antimicrob Agents. 2011;37(6):544-6. [PubMed ID: 21497063]. https://doi.org/10.1016/j.ijantimicag.2011.02.006.
  • 19.
    Oh EJ, Lee S, Park YJ, Park JJ, Park K, Kim SI, et al. Prevalence of metallo-beta-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-beta-lactamase. J Microbiol Methods. 2003;54(3):411-8. [PubMed ID: 12842488]. https://doi.org/10.1016/s0167-7012(03)00090-3.
  • 20.
    Leverstein-Van Hall MA, Paauw A, Box AT, Blok HE, Verhoef J, Fluit AC. Presence of integron-associated resistance in the community is widespread and contributes to multidrug resistance in the hospital. J Clin Microbiol. 2002;40(8):3038-40. [PubMed ID: 12149373]. [PubMed Central ID: PMC120645]. https://doi.org/10.1128/JCM.40.8.3038-3040.2002.
  • 21.
    Ploy MC, Denis F, Courvalin P, Lambert T. Molecular characterization of integrons in Acinetobacter baumannii: description of a hybrid class 2 integron. Antimicrob Agents Chemother. 2000;44(10):2684-8. [PubMed ID: 10991844]. [PubMed Central ID: PMC90135]. https://doi.org/10.1128/AAC.44.10.2684-2688.2000.
  • 22.
    Woodsmall RM, Benson DA. Information resources at the National Center for Biotechnology Information. Bull Med Libr Assoc. 1993;81(3):282-4. [PubMed ID: 8374583]. [PubMed Central ID: PMC225790].
  • 23.
    Abhari SS, Badmasti F, Modiri L, Aslani MM, Asmar M. Circulation of imipenem-resistant Acinetobacter baumannii ST10, ST2 and ST3 in a university teaching hospital from Tehran, Iran. J Med Microbiol. 2019;68(6):860-5. [PubMed ID: 31050632]. https://doi.org/10.1099/jmm.0.000987.
  • 24.
    Basak S, Singh P, Rajurkar M. Multidrug resistant and extensively drug resistant bacteria: A study. J Pathog. 2016;2016:4065603. [PubMed ID: 26942013]. [PubMed Central ID: PMC4749793]. https://doi.org/10.1155/2016/4065603.
  • 25.
    Halaji M, Rezaei A, Zalipoor M, Faghri J. Investigation of class I, II, and III integrons among Acinetobacter baumannii isolates from hospitalized patients in Isfahan, Iran. Oman Med J. 2018;33(1):37-42. [PubMed ID: 29467997]. [PubMed Central ID: PMC5798801]. https://doi.org/10.5001/omj.2018.07.
  • 26.
    Amin M, Navidifar T, Saleh Shooshtari F, Goodarzi H. Association of the genes encoding Metallo-beta-Lactamase with the presence of integrons among multidrug-resistant clinical isolates of Acinetobacter baumannii. Infect Drug Resist. 2019;12:1171-80. [PubMed ID: 31190906]. [PubMed Central ID: PMC6526166]. https://doi.org/10.2147/IDR.S196575.
  • 27.
    Martins N, Picao RC, Adams-Sapper S, Riley LW, Moreira BM. Association of class 1 and 2 integrons with multidrug-resistant Acinetobacter baumannii international clones and Acinetobacter nosocomialis isolates. Antimicrob Agents Chemother. 2015;59(1):698-701. [PubMed ID: 25348522]. [PubMed Central ID: PMC4291415]. https://doi.org/10.1128/AAC.02415-14.
  • 28.
    Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2010;65(2):233-8. [PubMed ID: 19996144]. https://doi.org/10.1093/jac/dkp428.
  • 29.
    Aygun G, Demirkiran O, Utku T, Mete B, Urkmez S, Yilmaz M, et al. Environmental contamination during a carbapenem-resistant Acinetobacter baumannii outbreak in an intensive care unit. J Hosp Infect. 2002;52(4):259-62. [PubMed ID: 12473469]. https://doi.org/10.1053/jhin.2002.1300.
  • 30.
    Souza LCD, Mota V, Carvalho A, Correa R, Liberio SA, Lopes FF. Association between pathogens from tracheal aspirate and oral biofilm of patients on mechanical ventilation. Braz Oral Res. 2017;31. e38. [PubMed ID: 28591237]. https://doi.org/10.1590/1807-3107BOR-2017.vol31.0038.
  • 31.
    Barbier F, Andremont A, Wolff M, Bouadma L. Hospital-acquired pneumonia and ventilator-associated pneumonia: recent advances in epidemiology and management. Curr Opin Pulm Med. 2013;19(3):216-28. [PubMed ID: 23524477]. https://doi.org/10.1097/MCP.0b013e32835f27be.
  • 32.
    Lob SH, Hoban DJ, Young K, Motyl MR, Sahm DF. Activity of imipenem/relebactam against Gram-negative bacilli from global ICU and non-ICU wards: SMART 2015-2016. J Glob Antimicrob Resist. 2018;15:12-9. [PubMed ID: 29857057]. https://doi.org/10.1016/j.jgar.2018.05.017.
  • 33.
    Cho YJ, Moon DC, Jin JS, Choi CH, Lee YC, Lee JC. Genetic basis of resistance to aminoglycosides in Acinetobacter spp. and spread of armA in Acinetobacter baumannii sequence group 1 in Korean hospitals. Diagn Microbiol Infect Dis. 2009;64(2):185-90. https://doi.org/10.1016/j.diagmicrobio.2009.02.010.
  • 34.
    Lee YT, Chiang MC, Kuo SC, Wang YC, Lee IH, Chen TL, et al. Carbapenem breakpoints for Acinetobacter baumannii group: Supporting clinical outcome data from patients with bacteremia. PLoS One. 2016;11(9). e0163271. [PubMed ID: 27644087]. [PubMed Central ID: PMC5028070]. https://doi.org/10.1371/journal.pone.0163271.
  • 35.
    Akbari Dehbalaei M, Najar-Peerayeh S, Behmanesh M, Taherikalani M. Polyclonal distribution of blaOXA-23 gene among Acinetobacter baumannii isolated from intensive care unit patients in Tehran; Pulsed-field gel electrophoresis analysis. Jundishapur J Microbiol. 2017;11(1). e58032. https://doi.org/10.5812/jjm.58032.
  • 36.
    Rezaei A, Fazeli H, Moghadampour M, Halaji M, Faghri J. Determination of antibiotic resistance pattern and prevalence of OXA-type carbapenemases among Acinetobacter baumannii clinical isolates from inpatients in Isfahan, central Iran. Infez Med. 2018;26(1):61-6. [PubMed ID: 29525799].
  • 37.
    Hu S, Niu L, Zhao F, Yan L, Nong J, Wang C, et al. Identification of Acinetobacter baumannii and its carbapenem-resistant gene blaOXA-23-like by multiple cross displacement amplification combined with lateral flow biosensor. Sci Rep. 2019;9(1). https://doi.org/10.1038/s41598-019-54465-8.
  • 38.
    Ning NZ, Liu X, Bao CM, Chen SM, Cui EB, Zhang JL, et al. Molecular epidemiology of bla OXA-23 -producing carbapenem-resistant Acinetobacter baumannii in a single institution over a 65-month period in north China. BMC Infect Dis. 2017;17(1):14. [PubMed ID: 28056839]. [PubMed Central ID: PMC5217423]. https://doi.org/10.1186/s12879-016-2110-1.
  • 39.
    Fallah F, Noori M, Hashemi A, Goudarzi H, Karimi A, Erfanimanesh S, et al. Prevalence of blaNDM, blaPER, blaVEB, blaIMP, and blaVIM genes among Acinetobacter baumannii isolated from two hospitals of Tehran, Iran. Scientifica. 2014;2014:1-6. https://doi.org/10.1155/2014/245162.
  • 40.
    Tarashi S, Goudarzi H, Erfanimanesh S, Pormohammad A, Hashemi A. Phenotypic and molecular detection of metallo-beta-lactamase genes among imipenem resistant Pseudomonas aeruginosa and Acinetobacter baumannii strains isolated from patients with burn injuries. Arch Clin Infect Dis. 2016;11(4). https://doi.org/10.5812/archcid.39036.
  • 41.
    Pillonetto M, Arend L, Vespero EC, Pelisson M, Chagas TPG, Carvalho-Assef APD, et al. First report of NDM-1-producing Acinetobacter baumannii sequence Type 25 in Brazil. Antimicrob Agents Chemother. 2014;58(12):7592-4. https://doi.org/10.1128/aac.03444-14.
  • 42.
    Bonnin RA, Poirel L, Nordmann P. New Delhi metallo-β-lactamase-producing Acinetobacter baumannii: a novel paradigm for spreading antibiotic resistance genes. Future Microbiol. 2014;9(1):33-41. [PubMed ID: 24328379]. https://doi.org/10.2217/fmb.13.69.
  • 43.
    Nourbakhsh F, Nourbakhsh V, Jafakesh MT. [Prevalence of class I, II and III integrons in the antibiotic-resistant isolates of A. baumannii detected from patients hospitalized in medical centers of Shahrekord]. Feyz. 2016;20(5):461-8. Persian.
  • 44.
    Bolourchi N, Azizi O, Tabrizi AMA, Esmaeili S, Fereshteh S, Badmasti F. Clonal relatedness of Acinetobacter baumannii isolated from the middle east: A systematic review. Rev Med Microbiol. 2020. https://doi.org/10.1097/MRM.0000000000000238.

Copyright

Copyright © 2021, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

14
May
2017

Dissemination of Classes 1, 2, and 3 Integrons in Acinetobacter baumannii Strains Recovered from Intensive Care Units Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism

Mehdi Goudarzi,
Hadi Azimi

Goudarzi M, Azimi H. Dissemination of Classes 1, 2, and 3 Integrons in Acinetobacter baumannii Strains Recovered from Intensive Care Units Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Jundishapur J Microbiol. 2017;10(5):e13100. doi: https://doi.org/10.5812/jjm.13100

17
Jan
2022
High Frequency of Class I and II Integrons and the Presence of aadA2 and dfrA12 Gene Cassettes in the Clinical Isolates of Acinetobacter baumannii from Shiraz, Southwest of Iran

High Frequency of Class I and II Integrons and the Presence of aadA2 and dfrA12 Gene Cassettes in the Clinical Isolates of Acinetobacter baumannii from Shiraz, Southwest of Iran

Seyed Sajjad Khoramrooz,
Saba Eslami,
Mohammad Motamedifar,
Abdoolah Bazargani,
Kamiar Zomorodian

Khoramrooz SS, Eslami S, Motamedifar M, Bazargani A, Zomorodian K. High Frequency of Class I and II Integrons and the Presence of aadA2 and dfrA12 Gene Cassettes in the Clinical Isolates of Acinetobacter baumannii from Shiraz, Southwest of Iran. Jundishapur J Microbiol. 2021;14(12):e119436. doi: https://doi.org/10.5812/jjm.119436

17
Jan
2017

Antibiotic Resistance and Carriage Integron Classes in Clinical Isolates of Acinetobacter Baumannii from Isfahan Hospitals, Iran

Fahimeh Nourbakhsh,
Majid Rajai,
Hassan Momtaz

Nourbakhsh F, Rajai M, Momtaz H. Antibiotic Resistance and Carriage Integron Classes in Clinical Isolates of Acinetobacter Baumannii from Isfahan Hospitals, Iran. Zahedan J Res Med Sci. 2017;19(1):e6009. doi: https://doi.org/10.17795/zjrms-6009

27
Jan
2018
Plasmid-Mediated Class 1 and 2 Integron Carriage in Drug-Resistant Nosocomial Isolates of Acinetobacter baumannii

Plasmid-Mediated Class 1 and 2 Integron Carriage in Drug-Resistant Nosocomial Isolates of Acinetobacter baumannii

Fereshteh Eftekhar,
Fatemeh Altayar,
Hannan Khidaei

Eftekhar F, Altayar F, Khidaei H. Plasmid-Mediated Class 1 and 2 Integron Carriage in Drug-Resistant Nosocomial Isolates of Acinetobacter baumannii. Arch Clin Infect Dis. 2018;13(1):e57813. doi: https://doi.org/10.5812/archcid.57813

1
Jul
2013

Distribution of OXA-Type Class D β-Lactamase Genes Among Nosocomial Multi Drug Resistant Acinetobacter baumannii Isolated in Tehran Hospitals

Afsaneh Karmostaji,
Shahin Najar Peerayeh,
Ali Hatef Salmanian

Karmostaji A, Najar Peerayeh S, Hatef Salmanian A. Distribution of OXA-Type Class D β-Lactamase Genes Among Nosocomial Multi Drug Resistant Acinetobacter baumannii Isolated in Tehran Hospitals. Jundishapur J Microbiol. 2013;6(5):e8219. doi: https://doi.org/10.5812/jjm.8219

More by these authors

Omid AziziPubMedScholar
Sepideh FereshtehPubMedScholar
Omid NasiriPubMedScholar
Mohammad GhorbaniPubMedScholar
Seyed Mahmoud BarziPubMedScholar
Farzad BadmastiPubMedScholar