Serogroup and Pathogenicity Island Marker Distributions Among Uropathogenic Escherichia coli Isolates in Rasht, Iran

Authors

Ali Moradpoor Shamami1, Masumeh Anvari1, Hassan Pourmoshtagh2, Seyedeh Tooba Shafighi1, Hadi Seddigh Ebrahim-SaraieHadi Seddigh Ebrahim-Saraie ORCID3,*
1Department of Biology, Faculty of Science, Rasht Branch, Islamic Azad University, Rasht, Iran
2Department of Pediatrics, Loghman-Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3Department of Microbiology, School of Medicine, Guilan University of Medical Sciences, Rasht, Iran
*Corresponding Author: Department of Microbiology, School of Medicine, Guilan University of Medical Sciences, Rasht, Iran. Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 16, issue 1; e132754
Published online:Apr 10, 2023
Article type:Research Article
Received:Nov 09, 2022
Accepted:Mar 02, 2023
How to Cite:Moradpoor Shamami A, Anvari M, Pourmoshtagh H, Shafighi ST, Seddigh Ebrahim-Saraie H. Serogroup and Pathogenicity Island Marker Distributions Among Uropathogenic Escherichia coli Isolates in Rasht, Iran. Jundishapur J Microbiol. 2023;16(1):e132754. doi: https://doi.org/10.5812/jjm-132754

Abstract

Background:

Urinary tract infections (UTIs) are among the most prevalent infections in hospitals and communities worldwide.

Objectives:

Due to the medical importance of UTIs caused by uropathogenic Escherichia coli (UPEC), this study aimed to investigate pathogenicity island (PAI) markers, O-antigen serogroups, and resistance to antibiotic agents associated with UPEC isolates obtained from hospitalized patients in Rasht city hospitals.

Methods:

A total of 110 urine samples were taken from patients with UTI referred to selected hospitals in Rasht, Iran. The double-disk synergy test (DDST) was used to detect the isolate’s ability to produce extended-spectrum β-lactamase (ESBL). Using particular primers, eight PAIs were detected (ie, PAI I536, PAI II536, PAI III536, PAI IV536, PAI ICFT073, PAI IICFT073, PAI IJ96, and PAI IIJ96).

Results:

According to the antibiotic susceptibility pattern, a high level of antibiotic resistance was observed against nalidixic acid (81.8%) and co-trimoxazole (78.2%), while the most effective agent was amikacin (85.5%). Double-disk synergy test revealed that the incidence of ESBL-positive strains was 62.7% (69/110). Of the 110 UPEC isolates, 106 (96.4%) carried at least one of the investigated PAI markers. Uropathogenic E. coli isolates with PAI IV536 (81.8%) had the highest prevalence, and PAI J196 (6.4%) had the lowest PAI marker. The most predominant serogroup O was O25 (36.4%), followed by O16 (17.3%), while the O4 and O7 serogroups (0.9%) were the lowest serogroups among UPEC isolates.

Conclusions:

The characterization of our strain revealed the co-occurrence of PAI and serogroups, confirming the importance of antibiotic resistance among the distinct serogroups and PAI markers. Our results have potential application for epidemiological studies and designing UTI treatment strategies against UTIs caused by UPEC.

1. Background

Urinary tract infections (UTIs) are among the most prevalent infections in hospitals and communities worldwide (1). Urinary tract infection patients can be categorized into both symptomatic and asymptomatic patients. Patients with symptomatic UTIs are divided into 3 categories based on the severity of the disease: Cystitis (infection of the bladder), pyelonephritis (infection of the kidney), and urosepsis (2). In the United States, less than 12 million individuals with UTI are sent to health facilities each year, with 470 000 hospitalized, costing around $6 billion (3, 4). In uropathogenic Escherichia coli (UPEC), E. coli strains, which deviate from their commensal role as gut flora, develop and persist in the urinary tract and exhibit a wide range of virulence traits and tactics that allow them to infect the urinary tract and cause illnesses. These E. coli strains are referred to as UPEC because uropathogenicity is frequently associated with them (5).
The expression of a variety of virulence factors is linked to UPEC’s capacity to generate symptomatic UTIs (6). For E. coli, over 40 genes have been identified linked to the virulence of these bacteria (7). Some of these virulence factors are adhesins encoded by fimH (mannose-specific adhesins of type I fimbriae), toxins encoded by hly (hemolysin), sfa/foc (S-/F1c-fimbriae), papC and papG (P-fimbriae), afa (a fimbrial adhesin), iron acquisition factors produced by iucC (aerobactin iron transport system), cnf1 (cytotoxic necrotizing factor 1), ibeA (invasion of brain endothelium), and the virulence factor gene (VFG), neuC (sialic acid biosynthesis) (8). Some of these VFGs are organized into regions known as pathogenicity islands (PAIs), which stand out for their high expression and, in some circumstances, association with the generation of β-lactamases and antibiotic resistance (7). The mechanism for the coordinated horizontal transfer of virulence genes is provided by these virulence factors, which are frequently expressed in PAIs (9). The PAI idea was initially introduced by Hacker et al. in the late 1980 s (10).
Mobile genetic elements (known as PAIs) differ from the bacterial host genome’s insertion sequences, transposases, and integrases by having GC nucleotide content (11). These elements may range in size from 10 to 200 kb and encode genes linked to 1 or more virulence factors, such as invasions, poisons, adhesins, iron absorption, and secretion systems (12, 13). Uropathogenic E. coli strains are normally classified by serological typing of their O (lipopolysaccharide) antigen (14); in addition, serogroups O1, O2, O4, O6, O7, O8, O15, O16, O18, O21, O22, O25, O75, and O83 are usually expressed in UPEC clones (15, 16). Serogroup assays are used for precise E. coli identification and epidemiological research on E. coli epidemics (17). For the treatment of UTIs caused by UPEC, antibiotic therapy is often required (18), though, particularly in patients with recurrent UTIs, the worldwide spread of multiple drug resistance (MDR) bacterial strains has become a public health problem and is considered a serious health concern (19).

2. Objectives

Due to the medical importance of UTIs caused by UPEC, this study aimed to assess PAI markers, O-antigen serogroups, and resistance to antibiotic properties associated with UPEC isolates obtained from hospitalized patients in Rasht city hospitals.

3. Methods

3.1. Identification and Bacterial Isolation

A total of 110 urine samples were obtained from individuals with UTI referred to selected hospitals in Rasht, Iran. These samples were cultured in blood and MacConkey agar media for 24 hours at 37°C. The IMViC tests were used to identify E. coli. Polymerase chain reaction (PCR) amplification of the 16 S rRNA gene was used to validate the identification, as described elsewhere (20, 21). For each test, E. coli ATCC 25922 was used as the control strain.

3.2. Antibiotic Susceptibility Pattern

In accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI), the Mueller Hinton agar (HiMedia, India) disc diffusion method of Kirby-Bauer was used to evaluate the antibiotic susceptibility pattern (22). The following antibiotics were used at the following concentrations: imipenem (10 µg), cefotaxime (10 µg), ceftriaxone (30 µg), ceftazidime (30 µg), gentamicin (10 µg), amikacin (30 µg), ciprofloxacin (5 µg), nalidixic acid (30 µg), trimethoprim/sulfamethoxazole (25 µg), and nitrofurantoin (300 µg). Multiple drug resistance isolates are those that have been found to be resistant to at least 3 different classes of antimicrobial drugs.

3.3. Extended-Spectrum β-Lactamases Screening Test

To screen extended-spectrum β-lactamases (ESBLs) producing isolates, the double-disk synergy test (DDST), was performed based on the CLSI guidelines. E. coli ATCC 25922 (negative control) and Klebsiella pneumoniae ATCC 700603 (positive control) were used as control strains based on the CLSI guidelines.

3.4. Detection of PAI Markers and Serogroups of UPEC Strains

Fresh colonies were used to extract bacterial DNA using the method previously reported (23). Using the exact primers given in Table 1, eight PAIs were detected (ie, PAI I536, PAI II536, PAI III536, PAI IV536, PAI ICFT073, PAI IICFT073, PAI IJ96, and PAI IIJ96). Initial denaturation at 94°C for 5 minutes was followed by 35 cycles of denaturation at 94°C for 1 minute, primer annealing at 55°C for 1 minute, and extension at 72°C for 1 minute with a final extension step at 72°C for 8 minutes (12). Moreover, with the specific primers provided in Table 1, PCR was performed to analyze O1, O2, O4, O6, O7, O8, O15, O16, O18, O21, O22, O25, O75, and O83 genes. Initial denaturation at 94°C for 5 minutes was followed by 30 cycles of primer annealing at 55°C for O1, 58°C for O2 and O25, and 56°C for O4 and O16 for 30 seconds, as well as an extension at 72°C for 30 seconds and a final extension at 72°C for 5 minutes. The KBC power load dye and 1.5% agarose gel were used to evaluate the amplification results (CinnaGen Co, Iran).
Table 1.
Primers Used to Detect Pathogenicity Island Markers and Serogroups A132754TBL1FN1 (11, 24)
TargetPrimer Sequence (5′→3′)Product Size (bp)
PAI I536-FTAATGC CGG AGATTC ATT GTC1800
PAI I536-RAGG ATT TGT CTC AGG GCT TT
PAI II536-FCAT GTC CAA AGC TCG AGC C1000
PAI II536-RCTA CGT CAG GCT GGC TTT G
PAI III536-FCGG GCATGC ATC AAT TAT CTT TG200
PAI III536-RTGT GTA GAT GCA GTC ACT CCG
PAI IV536-FAAG GAT TCG CTG TTA CCG GAC300
PAI IV536-RTCG TCG GGC AGC GTT TCT TCT
PAI ICFT073-FGGA CAT CCT GTTACA GCG CGC A930
PAI ICFT073-RTCG CCA CCA ATC ACA GCG AAC
PAI IICFT073-FATG GAT GTT GTATCG C400
PAI IICFT073-RACG AGC ATG TGG ATC TGC
PAI IJ96-FTCG TGC TCA GGT CCG GAATTT400
PAI IJ96-RTGG CAT CCC ACATTATCG
PAI IIJ96-FGGATCC ATG AAA ACATGG TTA ATG GG2300
PAI IIJ96-RGAT ATT TTT GTT GCC ATT GGT TAC C
O1GTGAGCAAAAGTGAAATAAGGAACG1098
CGCTGATACGAATACCATCCTAC
O6GGATGACGATGTGATTTTGGCTAAC783
TCTGGGTTTGCTGTGTATGAGGC
O7CTATCAAAATACCTCTGCTGGAATC610
TGGCTTCGAGATTAAACCTATTCCT
O8CCAGAGGCATAATCAGAAATAACAG448
GCAGAGTTAGTCAACAAAAGGTCAG
O16GGTTTCAATCTCACAGCAACTCAG302
GTTAGAGGGATAATAGCCAAGCGG
O21CTGCTGATGTCGCTATTATTGCTG209
TGAAAAAAAGGGAAACAGAAGAGCC
O75GAGATATACATGGGGAGGTAGGCT511
ACCCGATAATCATATTCTTCCCAAC
O2AGTGAGTTACTTTTTAGCGATGGAC770
AGTTTAGTATGCCCCTGACTTTGAA
O4TTGTTGCGATAATGTGCATGTTCC664
AATAATTTGCTATACCCACACCCTC
O15TCTTGTTAGAGTCATTGGTGTATCG183
ATAAAACGAGCAAGCACCACACC
O18GTTCGGTGGTTGGATTACAGTTAG551
CTACTATCATCCTCACTGACCACG
O22TTCATTGTCGCCACTACTTTCCG468
GAAACAGCCCATGACATTACTACG
O25AGAGATCCGTCTTTTATTTGTTCGC230
GTTCTGGATACCTAACGCAATACCC
O83GTACACCAGGCAAACCTCGAAAG362
TTCTGTAAGCTAATGAATAGGCACC
Abbreviation: PAI, pathogenicity island.

3.5. Statistical Analysis

The data were analyzed using SPSS version 20 (SPSS Inc, Chicago, IL, USA). A chi-square or Fisher exact test was used to determine any statistical association. P values less than 0.05 were considered statistically significant.

4. Results

A total of 110 confirmed UPEC isolates were obtained from patients referred to a teaching hospital in Rasht, Iran. Among isolated samples, male and female frequencies were 36.7% (40/110) and 63.3% (70/110), respectively. According to the antibiotic susceptibility pattern, a high level of antibiotic resistance was observed against nalidixic acid (81.8%) and co-trimoxazole (78.2%), while the most operative agents were amikacin (85.5%) and nitrofurantoin (83.6%). The heatmap showed hierarchical clustering of all isolates’ antibiotic resistance profiles (Figure 1). The number of distinct classes of antimicrobials to which UPEC isolates were resistant varied among employed antimicrobial agents, according to the isolates’ detailed resistance profiles (Figure 1). Double-disk synergy test revealed that the incidence of ESBL-positive strains was 62.7% (69/110). Moreover, the MDR phenotype was found in 72.7% (80/110) of UPEC isolates.
The hierarchical clustering of isolates’ antibiotic resistance profiles using the heatmap. Red tiles represent resistance, and green tiles represent sensitive patterns.
Figure 1.
The hierarchical clustering of isolates’ antibiotic resistance profiles using the heatmap. Red tiles represent resistance, and green tiles represent sensitive patterns.
Of the 110 UPEC isolates recovered from patients with UTI, 106 (96.4%) carried at least one of the investigated PAI markers. The predominant PAI among UPEC isolates was PAI IV536 (81.8%), followed by PAI ICFT073 (60%), PAI III536 (12.7%), PAI IIJ196 (9.1%), PAI II536 (8.2%), PAI I536 (6.4%), and PAI J196 (6.4%) (Table 1). According to our results, the most predominant serogroup O was O25 (36.4%), followed by O16 (17.3%), while the O4 and O7 serogroups (0.9%) were the lowest serogroups among UPEC isolates. Also, O22 and O83 were not detected in the studied strains (Table 2). The total spread of O-serogroups is summarized in Table 2. Compared to other serogroups, O25 and O16 serogroups showed the highest frequency of indicators for both antibiotic resistance and PAIs. All isolates from serogroup O25 possessed every single one of the examined PAI markers. Among the phylogenetic serogroups O8, O4, and O75, only a few virulence factor genes were more widely dispersed (Table 3). Furthermore, maximum resistance to ciprofloxacin, tetracycline, cefotaxime, and ceftazidime was observed in all UPEC serogroups, while minimum resistance to imipenem, amikacin, and nitrofurantoin was observed.
Table 2.
Prevalence of Pathogenicity Island Markers in Uropathogenic Escherichia coli Strains from Different O-antigen Serogroups
PAI MarkersNo. (%)
O21O18O16O15O8O7O6O4O2O75O1O25
PAI IIJ196002 (10.5)1 (10)01 (100)1 (33.3)02 (50)002 (5)
PAI J1961 (33.3)001 (10)001 (33.3)00004 (10)
PAIIICFT0731 (33.3)2 (66.7)5 (26.3)2 (20)002 (66.7)03 (75)1 (50)5 (55.6)13 (32.5)
PAI ICFT0731 (33.3)2 (66.7)12 63.2)4 (40)2 (100)01 (33.3)1 (100)3 (75)1 (50)7 (77.8)25 (62.5)
PAI IV5363 (100)2 (66.7)14 (7.37)7 (70)01 (100)1 (33.3)1 (100)4 (100)2 (100)8 (88.9)34 (85)
PAI III53601 (33.3)3 (15.8)001 (100)002 (50)02 (22.2)2 (5)
PAI II53601 (33.3)0001 (100)000005 (12.5)
PAI I536001 (5.3)1 (10)01 (100)000002 (5)
Total number of genes331910213142940
Abbreviation: PAI, pathogenicity island.
Table 3.
Distribution of Antibiotic Resistance Among Uropathogenic Escherichia coli Phylogenetic Groupings
AntibioticsNo. (%)
O21O18O16O15O8O7O6O4O2O75O1O25
Amikacin0002 (20)1 (50)02 (66.7)03 (75)1 (50)1 (11.1)6 (15)
Imipenem1 (33.3)1 (33.3)1 (5.3)4 (401 (50)02 (66.7)03 (75)2 (100)2 (22.2)11 (27.5)
Nitrofurantoin01 (33.3)2 (10.5)3 (30)1 (50)02 (66.7)03 (75)2 (100)1 (11.1)4 (10)
Trimethoprim-sulfamethoxazole3 (100)3 (100)16 (84.2)8 (80)2 (100)01 (33.3)001 (50)7 (77.8)29 (72.5)
Cefotaxime3 (100)2 (66.7)15 (78.9)8 (80)2 (100)01 (33.3)01 (25)1 (50)6 (66.7)25 (62.5)
Gentamicin1 (33.3)07 (36.8)3 (30)1 (50)02 (66.7)03 (75)2 (100)1 (11.1)8 (20)
Ceftriaxone2 (66.7)2 (66.7)15 (78.9)8 (80)2 (100)02 (66.7)01 (25)1 (50)4 (44.4)24 (60)
Ciprofloxacin3 (100)2 (66.7)12 (63.2)6 (60)2 (100)02 (66.7)03 (75)1 (50)5 (55.6)23 (57.5)
Nalidixic acid2 (66.7)3 (100)18 (94.7)8 (80)2 (100)1 (100)1 (33.3)001 (50)5 (55.6)32 (80)
Total number of genes331910213142940

5. Discussion

Urinary tract infections are among the most common infections in both hospitals and communities worldwide. Escherichia coli strains that cause UTIs are thought to be the most prevalent bacteria in people of all sexes and ages (25). Nowadays, there are fewer options to treat infections, including UTIs, due to the dissemination of resistance genes and increased bacterial drug resistance in recent years. Furthermore, MDR E. coli infections are more difficult to cure in Asian nations like Iran (26)). In our investigation, 72.7% of the UPEC isolates were categorized as MDR, and 90% of the UPEC isolates were resistant to 1 or more antimicrobial drugs. The resistance to nalidixic acid and amikacin was found to be the highest and lowest, respectively, among all UPEC isolates in the current study. Previous studies from Pakistan (27), Iraq (28), and Iran (29) on UPEC isolates indicated a similar type of resistance to antibiotics. Considering what we have discovered, nitrofurantoin and amikacin appear to be effective antibiotics to treat UTIs caused by UPEC. Nasrollahian et al. showed that the highest frequency of MDR isolates was 76.3%, which is approximately in line with our results (5). In previous studies conducted in Spain (30), Iran (31), and Nepal (32), the percentages of MDR isolates were reported to be 30%, 55.8%, and 70.2%, respectively, which are much less compared to our results. Accordingly, the increase of MDR-Enterobacterales, in particular strains that produce ESBLs, is responsible for a high proportion of nosocomial outbreaks that are linked to higher morbidity and mortality rates (33, 34). In this regard, the hierarchical clustering of isolates’ antibiotic resistance profiles revealed a partial similarity in most UPEC isolates to the antibiotic-resistant pattern.
According to our results, 62.7% of isolates were ESBL producers. There have been numerous reports of ESBL-producing UPEC among hospitalized patients worldwide. According to a study in northern Iran, which is consistent with the current study, 66.3% of the UPEC isolates were ESBL-producing isolates (4). Moreover, previous studies in Kenya and China showed a lower frequency of ESBL-positive isolates (24.2% and 46%, respectively) (35, 36). A meta-analysis study estimated the proportion of ESBL-Enterobacteriaceae in East African hospitals, showing that the pooled average ESBL proportion for hospitals in East Africa was 42% (37). The types of hospital units, type of specimen, and site of infection are factors that influence variances in the prevalence of ESBL producers. Compared to patients who visit an outpatient department, hospitalized patients, particularly those in intensive care units, are often more prone to develop nosocomial infections that are likely to produce ESBLs (37).
Uropathogenic E. coli PAIs have encoded different virulence factors. These factors have a significant impact on the pathogenesis of UPEC strains and the development of the disease by impairing host defense mechanisms. The first PAIs were found in the UPEC genomes, and the PAIs of 120 different pathogen species have been discovered (5). Different virulence factors, such as particular adhesins, toxins, capsules, specialized O antigens, iron-uptake systems, and elements influencing serum resistance, can be produced by UPECs. The majority of these factors’ encoding genes are found in PAIs. In our investigation, among UPEC isolates, eight PAI markers were detected. Accordingly, 96.4% of UPEC isolates carried at least one of the investigated PAI markers. The highest and lowest PAIs were PAI IV536 (81.8%) and PAI J196 (6.4%) among UPEC isolates. This result is consistent with other investigations in Iran (38), China (24), the Czech Republic (39), and Sweden (40). Among UPEC strains known as high PAI, PAI IV536 has been described as the most common PAI.has been described as the most common PAI. The high frequency of PAI IV536 indicates that UPEC strains have steady levels in this marker. Moreover, 60% of UPEC isolates carried PAI ICFT073 as the second most common PAI. PAI ICFT073, known to include certain P fimbrial, toxin, and iron uptake system encoding genes, is effective to colonization and survival of E. coli strains in the human urinary tract (8).
In earlier research, PAIs of the 536 and CFT073 strains were linked to the highest number of PAI combinations. Early in the 1930s, systematic O-serogrouping of E. coli started, and it quickly became a crucial technique for identifying E. coli strains in clinical situations. Numerous experimental studies have found a strong correlation between specific serogroups and specific pathogenicity indicators in infections, such as UPEC. We found several O-serogroups in our UPEC isolates. Overall, O-serogroups O25, O16, O15, and O1 were the most frequently found, whereas the O4 and O7 serogroups were the least frequently found among the UPEC isolates in this study. Additionally, according to the findings of Momtaz et al., O25 (26.01%), O16 (10.56%), O4 (5.69%), O1 (2.43%), and O2 (2.4%) were the most frequently found serogroups among Iranian hospitalized patients (41).
According to Shokouhi Mostafavi et al., the 2 main O-serogroups among Iranian UPEC isolates were O1 (20%) and O25 (13.7%) (42). As reported by several researchers, in UTI patients, several O-serogroups were found to be present at different frequencies (41). According to the antibiotic susceptibility pattern, the isolates belonging to O25, O21, O16, O18, and O8 had the highest antibiotic resistance, while O4 and O7 had the lowest antibiotic resistance. Moreover, in the present research, the O25 serogroup had the highest distribution and incidence of PAI genes in UPEC, followed by O16, O18, and O7. Generally speaking, various O-serogroup distributions among UPEC isolates can fluctuate based on the type of infection, geography, or even other conditions (hospital or community) (14).

5.1. Conclusions

Based on the antibiogram, resistance to nalidixic acid and amikacin was found to be highest and lowest, respectively. Also, 62.7% of isolates were ESBL producers. In our investigation, the highest and lowest PAIs were PAI IV536 and PAI J196 among UPEC isolates. Moreover, O-serogroup O25 was the most frequently found, whereas the O4 and O7 serogroups were the least frequently found. The characterization of our strain revealed the co-occurrence of PAI and serogroups, confirming the importance of antibiotic resistance among the distinct serogroups and PAI markers. Our results have potential application for epidemiological studies and designing UTI treatment strategies against UTIs caused by UPEC.

Acknowledgments

Footnotes

  • Authors' Contribution: H. S. E. S. conceived and designed the evaluation and drafted the manuscript. M. A. participated in designing the evaluation, performed parts of the statistical analysis, and helped to draft the manuscript. H. P. re-evaluated the clinical data, revised the manuscript, and performed the statistical analysis. A. M. and T. SH. collected the clinical data, interpreted them, and revised the manuscript. All authors read and approved the final manuscript.

  • Conflict of Interests: The authors declare no conflicts of interest about employment and funding or research support.

  • Data Reproducibility: The dataset presented in the study is available on request from the corresponding author during submission or after publication.

  • Ethical Approval: This study was approved by the Research Ethics Committee of Islamic Azad University, Rasht Branch, Rasht, Iran (IR.IAU.LIAU.REC.1399.068).

  • Funding/Support: This study was financially funded by Islamic Azad University, Rasht Branch, Rasht, Iran (grant number: 127208).

References

  • 1.
    Halaji M, Fayyazi A, Rajabnia M, Zare D, Pournajaf A, Ranjbar R. Phylogenetic group distribution of uropathogenic escherichia coli and related antimicrobial resistance pattern: A meta-analysis and systematic review. Front Cell Infect Microbiol. 2022;12:790184. [PubMed ID: 35281449]. [PubMed Central ID: PMC8914322]. https://doi.org/10.3389/fcimb.2022.790184.
  • 2.
    Smelov V, Naber K, Johansen TEB. Improved classification of urinary tract infection: Future considerations. Eur Urol Suppl. 2016;15(4):71-80.
  • 3.
    Navidinia M, Teymouri AR, Goudarzi M. Assessment of correlation between urinary secretary IgA (sIgA) levels and different types of urinary tract infection (UTI) in various age groups. Arch adv biosci. 2018;9(1):45-9.
  • 4.
    Fayyazi A, Halaji M, Sadeghi A, Havaei SA. High frequency of integrons and efflux pump in uropathogenic Escherichia coli isolated from Iranian kidney and non-kidney transplant patients. Gene Rep. 2020;21:100873.
  • 5.
    Nasrollahian S, Halaji M, Hosseini A, Teimourian M, Armaki MT, Rajabnia M, et al. Genetic diversity, carbapenem resistance genes, and biofilm formation in upec isolated from patients with catheter-associated urinary tract infection in North of Iran. Int J Clin Pract. 2022;2022:9520362. [PubMed ID: 36187911]. [PubMed Central ID: PMC9507725]. https://doi.org/10.1155/2022/9520362.
  • 6.
    Bien J, Sokolova O, Bozko P. Role of uropathogenic escherichia coli virulence factors in development of urinary tract infection and kidney damage. Int J Nephrol. 2012;2012:681473. [PubMed ID: 22506110]. [PubMed Central ID: PMC3312279]. https://doi.org/10.1155/2012/681473.
  • 7.
    Pina-Iturbe A, Hoppe-Elsholz G, Fernandez PA, Santiviago CA, Gonzalez PA, Bueno SM. Bioinformatic and experimental characterization of SEN1998: A conserved gene carried by the Enterobacteriaceae-associated ROD21-like family of genomic islands. Sci Rep. 2022;12(1):2435. [PubMed ID: 35165310]. [PubMed Central ID: PMC8844411]. https://doi.org/10.1038/s41598-022-06183-x.
  • 8.
    Najafi A, Hasanpour M, Askary A, Aziemzadeh M, Hashemi N. Distribution of pathogenicity island markers and virulence factors in new phylogenetic groups of uropathogenic Escherichia coli isolates. Folia Microbiol (Praha). 2018;63(3):335-43. [PubMed ID: 29199378]. https://doi.org/10.1007/s12223-017-0570-3.
  • 9.
    Hacker J, Kaper JB. Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000;54:641-79. [PubMed ID: 11018140]. https://doi.org/10.1146/annurev.micro.54.1.641.
  • 10.
    Hacker J, Bender L, Ott M, Wingender J, Lund B, Marre R, et al. Deletions of chromosomal regions coding for fimbriae and hemolysins occur in vitro and in vivo in various extraintestinal Escherichia coli isolates. Microb Pathog. 1990;8(3):213-25. [PubMed ID: 1974320]. https://doi.org/10.1016/0882-4010(90)90048-u.
  • 11.
    Sabate M, Moreno E, Perez T, Andreu A, Prats G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect. 2006;12(9):880-6. [PubMed ID: 16882293]. https://doi.org/10.1111/j.1469-0691.2006.01461.x.
  • 12.
    Samei A, Haghi F, Zeighami H. Distribution of pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Folia Microbiol (Praha). 2016;61(3):261-8. [PubMed ID: 26563230]. https://doi.org/10.1007/s12223-015-0433-8.
  • 13.
    Tangi SC, Tajbakhsh E, Soleimani NA, Shahraki MM. Prevalence of pathogenicity island markers genes in uropathogenic Escherichia coli isolated from patients with urinary tract infectious. Asian Pac J Trop Dis. 2015;5(8):662-6.
  • 14.
    Sadeghi A, Halaji M, Fayyazi A, Havaei SA. Characterization of plasmid-mediated quinolone resistance and serogroup distributions of uropathogenic escherichia coli among iranian kidney transplant patients. Biomed Res Int. 2020;2020:2850183. [PubMed ID: 33195692]. [PubMed Central ID: PMC7641683]. https://doi.org/10.1155/2020/2850183.
  • 15.
    Abe CM, Salvador FA, Falsetti IN, Vieira MA, Blanco J, Blanco JE, et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli. FEMS Immunol Med Microbiol. 2008;52(3):397-406. [PubMed ID: 18336383]. https://doi.org/10.1111/j.1574-695X.2008.00388.x.
  • 16.
    Orskov I, Orskov F, Birch-Andersen A, Kanamori M, Svanborg-Eden C. O, K, H and fimbrial antigens in Escherichia coli serotypes associated with pyelonephritis and cystitis. Scand J Infect Dis Suppl. 1982;33:18-25. [PubMed ID: 6127800].
  • 17.
    Paniagua-Contreras GL, Monroy-Perez E, Rodriguez-Moctezuma JR, Dominguez-Trejo P, Vaca-Paniagua F, Vaca S. Virulence factors, antibiotic resistance phenotypes and O-serogroups of Escherichia coli strains isolated from community-acquired urinary tract infection patients in Mexico. J Microbiol Immunol Infect. 2017;50(4):478-85. [PubMed ID: 26433755]. https://doi.org/10.1016/j.jmii.2015.08.005.
  • 18.
    Foxman B. Urinary tract infection syndromes: Occurrence, recurrence, bacteriology, risk factors, and disease burden. Infect Dis Clin North Am. 2014;28(1):1-13. [PubMed ID: 24484571]. https://doi.org/10.1016/j.idc.2013.09.003.
  • 19.
    Halaji M, Feizi A, Mirzaei A, Sedigh Ebrahim-Saraie H, Fayyazi A, Ashraf A, et al. The global prevalence of class 1 integron and associated antibiotic resistance in Escherichia coli from patients with urinary tract infections, a systematic review and meta-analysis. Microb Drug Resist. 2020;26(10):1208-18. [PubMed ID: 32282274]. https://doi.org/10.1089/mdr.2019.0467.
  • 20.
    Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc Natl Acad Sci U S A. 1985;82(20):6955-9. [PubMed ID: 2413450]. [PubMed Central ID: PMC391288]. https://doi.org/10.1073/pnas.82.20.6955.
  • 21.
    Warsen AE, Krug MJ, LaFrentz S, Stanek DR, Loge FJ, Call DR. Simultaneous discrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA microarrays. Appl Environ Microbiol. 2004;70(7):4216-21. [PubMed ID: 15240304]. [PubMed Central ID: PMC444826]. https://doi.org/10.1128/AEM.70.7.4216-4221.2004.
  • 22.
    Weinstein MP. Performance standards for antimicrobial susceptibility testing. Clinical laboratory standards instit. 2021.
  • 23.
    FATH EB, BONAKDAR HF, EYNI MI, ALI GM, NAKHJAVANI FA, KAZEMI BAHRAM. Detection of vancomycin resistant enterococci (VRE) isolated from urinary tract infections (UTI) in Tehran, Iran. DARU. 2006;14(3).
  • 24.
    Li D, Liu B, Chen M, Guo D, Guo X, Liu F, et al. A multiplex PCR method to detect 14 Escherichia coli serogroups associated with urinary tract infections. J Microbiol Methods. 2010;82(1):71-7. [PubMed ID: 20434495]. https://doi.org/10.1016/j.mimet.2010.04.008.
  • 25.
    Lee DS, Lee SJ, Choe HS. Community-acquired urinary tract infection by Escherichia coli in the Era of antibiotic resistance. Biomed Res Int. 2018;2018:7656752. [PubMed ID: 30356438]. [PubMed Central ID: PMC6178185]. https://doi.org/10.1155/2018/7656752.
  • 26.
    Alizade H. Escherichia coli in Iran: An overview of antibiotic resistance: A review article. Iran J Public Health. 2018;47(1):1-12. [PubMed ID: 29318111]. [PubMed Central ID: PMC5756583].
  • 27.
    Badini ZA, Rauf A, Sanjrani MA, Niazi MR, Baseer K, Khan MA. Isolation, identification, molecular characterization and antibiotic susceptibility testing of uro-pathogenic E. coli (UPEC) isolated from non-hospitalized urinary tract infections (UTI). Pak J Med Sci. 2019;2(4):69-73.
  • 28.
    Rahman MM, Hossain MMK, Rubaya R, Halder J, Karim ME, Bhuiya AA, et al. Association of antibiotic resistance traits in uropathogenic Escherichia coli (UPEC) Isolates. Can J Infect Dis Med Microbiol. 2022;2022:4251486. [PubMed ID: 35340918]. [PubMed Central ID: PMC8942690]. https://doi.org/10.1155/2022/4251486.
  • 29.
    Halaji M, Shahidi S, Atapour A, Ataei B, Feizi A, Havaei SA. Characterization of extended-spectrum beta-lactamase-producing uropathogenic escherichia coli among iranian kidney transplant patients. Infect Drug Resist. 2020;13:1429-37. [PubMed ID: 32523361]. [PubMed Central ID: PMC7237106]. https://doi.org/10.2147/IDR.S248572.
  • 30.
    Garcia-Menino I, Lumbreras P, Leston L, Alvarez-Alvarez M, Garcia V, Hammerl JA, et al. Occurrence and genomic characterization of clone st1193 clonotype 14-64 in uncomplicated urinary tract infections Caused by Escherichia coli in Spain. Microbiol Spectr. 2022;10(3). e0004122. [PubMed ID: 35604206]. [PubMed Central ID: PMC9241898]. https://doi.org/10.1128/spectrum.00041-22.
  • 31.
    Shahbazi S, Asadi Karam MR, Habibi M, Talebi A, Bouzari S. Distribution of extended-spectrum beta-lactam, quinolone and carbapenem resistance genes, and genetic diversity among uropathogenic Escherichia coli isolates in Tehran, Iran. J Glob Antimicrob Resist. 2018;14:118-25. [PubMed ID: 29581075]. https://doi.org/10.1016/j.jgar.2018.03.006.
  • 32.
    Gurung S, Kafle S, Dhungel B, Adhikari N, Thapa Shrestha U, Adhikari B, et al. Detection of OXA-48 Gene in carbapenem-resistant escherichia coli and klebsiella pneumoniae from urine samples. Infect Drug Resist. 2020;13:2311-21. [PubMed ID: 32765007]. [PubMed Central ID: PMC7369300]. https://doi.org/10.2147/IDR.S259967.
  • 33.
    Pajohi Alamoti M, Bazargani-Gilani B, Mahmoudi R, Reale A, Pakbin B, Di Renzo T, et al. Essential oils from indigenous iranian plants: A natural weapon vs. Multidrug-resistant Escherichia coli. Microorganisms. 2022;10(1). [PubMed ID: 35056560]. [PubMed Central ID: PMC8781614]. https://doi.org/10.3390/microorganisms10010109.
  • 34.
    Jamali S, Tavakoly T, Mojtahedi A, Shenagari M. The phylogenetic relatedness of bla (NDM-1) harboring extended-spectrum beta-lactamase producing uropathogenic Escherichia coli and Klebsiella pneumoniae in the North of Iran. Infect Drug Resist. 2020;13:651-7. [PubMed ID: 32158241]. [PubMed Central ID: PMC7049266]. https://doi.org/10.2147/IDR.S230335.
  • 35.
    Muriuki CW, Ogonda LA, Kyanya C, Matano D, Masakhwe C, Odoyo E, et al. Phenotypic and genotypic characteristics of uropathogenic Escherichia coli Isolates from Kenya. Microb Drug Resist. 2022;28(1):31-8. [PubMed ID: 34297634]. [PubMed Central ID: PMC8792489]. https://doi.org/10.1089/mdr.2020.0432.
  • 36.
    Zhang J, Zheng B, Zhao L, Wei Z, Ji J, Li L, et al. Nationwide high prevalence of CTX-M and an increase of CTX-M-55 in Escherichia coli isolated from patients with community-onset infections in Chinese county hospitals. BMC Infect Dis. 2014;14:659. [PubMed ID: 25466590]. [PubMed Central ID: PMC4265337]. https://doi.org/10.1186/s12879-014-0659-0.
  • 37.
    Sonda T, Kumburu H, van Zwetselaar M, Alifrangis M, Lund O, Kibiki G, et al. Meta-analysis of proportion estimates of extended-spectrum-beta-lactamase-producing enterobacteriaceae in East Africa hospitals. Antimicrob Resist Infect Control. 2016;5:18. [PubMed ID: 27186369]. [PubMed Central ID: PMC4868002]. https://doi.org/10.1186/s13756-016-0117-4.
  • 38.
    Asadi E, Mohammadzadeh M, Niakan M. Distribution of pathogenicity islands among uropathogenic Escherichia coli isolates from patients with urinary tract infections. Int J Enteric Pathog. 2020;8(2):39-43.
  • 39.
    Kryger J, Burleigh A, Christensen M, Hopkins W. Genetic evaluation of E. coli Strains Isolated from asymptomatic children with neurogenic bladders. Int J Chronic Dis. 2015;2015:206570. [PubMed ID: 26609542]. [PubMed Central ID: PMC4644559]. https://doi.org/10.1155/2015/206570.
  • 40.
    Ostblom A, Adlerberth I, Wold AE, Nowrouzian FL. Pathogenicity island markers, virulence determinants malX and usp, and the capacity of Escherichia coli to persist in infants' commensal microbiotas. Appl Environ Microbiol. 2011;77(7):2303-8. [PubMed ID: 21317254]. [PubMed Central ID: PMC3067437]. https://doi.org/10.1128/AEM.02405-10.
  • 41.
    Momtaz H, Karimian A, Madani M, Safarpoor Dehkordi F, Ranjbar R, Sarshar M, et al. Uropathogenic Escherichia coli in Iran: serogroup distributions, virulence factors and antimicrobial resistance properties. Ann Clin Microbiol Antimicrob. 2013;12:8. [PubMed ID: 23627669]. [PubMed Central ID: PMC3651382]. https://doi.org/10.1186/1476-0711-12-8.
  • 42.
    Shokouhi Mostafavi SK, Najar-Peerayeh S, Mohabbati Mobarez A, Kardoust Parizi M. Serogroup distribution, diversity of exotoxin gene profiles, and phylogenetic grouping of CTX-M-1- producing uropathogenic Escherichia coli. Comp Immunol Microbiol Infect Dis. 2019;65:148-53. [PubMed ID: 31300106]. https://doi.org/10.1016/j.cimid.2019.05.003.

Copyright

Copyright © 2023, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

1
Dec
2013

Phylogenetic Groups and Pathogenicity Island Markers in Escherichia coli Isolated From Children

Masoumeh Navidinia,
Shahin Najar Peerayeh,
Fatemeh Fallah,
Bita Bakhshi

Navidinia M, Najar Peerayeh S, Fallah F, Bakhshi B. Phylogenetic Groups and Pathogenicity Island Markers in Escherichia coli Isolated From Children. Jundishapur J Microbiol. 2013;6(10):e8362. doi: https://doi.org/10.5812/jjm.8362

15
Jul
2013

Distribution of the Pathogenicity Islands Markers (PAIs) in Uropathogenic E.coli Isolated from Children in Mofid Children Hospital

Masoumeh Navidinia,
Shahin Najar Peerayeh,
Fatemeh Fallah,
Bita Bakhshi,
Saadat Adabian,
Shadi Alimehr
,et al.

Navidinia M, Najar Peerayeh S, Fallah F, Bakhshi B, Adabian S, et al. Distribution of the Pathogenicity Islands Markers (PAIs) in Uropathogenic E.coli Isolated from Children in Mofid Children Hospital. Arch Pediatr Infect Dis. 2013;1(2):. doi: https://doi.org/10.5812/pedinfect.9083

5
Jul
2020
The Frequency of PAI, aer and traT Genes in Escherichia coli Commensal and Urinary Pathogenic E. coli Isolates in Shahrekord and the Relationship Between the Two Groups by Multiplex PCR

The Frequency of PAI, aer and traT Genes in Escherichia coli Commensal and Urinary Pathogenic E. coli Isolates in Shahrekord and the Relationship Between the Two Groups by Multiplex PCR

Mohamad Hossein Rezaei,
Farshad Kakian,
Abolfazl Gholipour,
Behnam Zamanzad

Rezaei MH, Kakian F, Gholipour A, Zamanzad B. The Frequency of PAI, aer and traT Genes in Escherichia coli Commensal and Urinary Pathogenic E. coli Isolates in Shahrekord and the Relationship Between the Two Groups by Multiplex PCR. Jundishapur J Microbiol. 2020;13(6):e98683. doi: https://doi.org/10.5812/jjm.98683

15
Feb
2025
Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran

Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran

Mehdi Bozorgi Mazandarani,
Mohammad Kargar,
Farshid Kafilzadeh

Bozorgi Mazandarani M, Kargar M, Kafilzadeh F. Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran. Jundishapur J Microbiol. 2025;18(2):e156768. doi: https://doi.org/10.5812/jjm-156768

7
Feb
2015

Virulence Genes and Antimicrobial Resistance Pattern in Uropathogenic Escherichia coli Isolated From Hospitalized Patients in Kashan, Iran

Foroogh Neamati,
Farzaneh Firoozeh,
Mahmood Saffari,
Mohammad Zibaei

Neamati F, Firoozeh F, Saffari M, Zibaei M. Virulence Genes and Antimicrobial Resistance Pattern in Uropathogenic Escherichia coli Isolated From Hospitalized Patients in Kashan, Iran. Jundishapur J Microbiol. 2015;8(2):e17514. doi: https://doi.org/10.5812/jjm.17514

More by these authors

Ali Moradpoor ShamamiPubMedScholar
Masumeh AnvariPubMedScholar
Hassan PourmoshtaghPubMedScholar
Seyedeh Tooba ShafighiPubMedScholar
Hadi Seddigh Ebrahim-SaraiePubMedScholar
Share
Cited by
Metrics