Arch Pediatr Infect Dis

Image Credit:Arch Pediatr Infect Dis

Intestinal Carriage of Carbapenemase-Producing Enterobacteriaceae Members in Immunocompromised Children During COVID-19 Pandemic

Author(s):
Nasim Almasian TehraniNasim Almasian TehraniNasim Almasian Tehrani ORCID1, 2, Masoud AlebouyehMasoud AlebouyehMasoud Alebouyeh ORCID2, Shahnaz ArminShahnaz ArminShahnaz Armin ORCID2, Neda SoleimaniNeda SoleimaniNeda Soleimani ORCID1, Abdollah  Karimi Abdollah Karimi Abdollah  Karimi  ORCID2, Bibishahin ShamsianBibishahin ShamsianBibishahin Shamsian ORCID3, Shiva NazariShiva Nazari3, Leila AzimiLeila AzimiLeila Azimi ORCID2,*
1Department of Microbiology and Microbial Biotechnology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran
2Pediatric Infections Research Center, Research Institute for Children’s Health, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3Pediatric Congenital Hematologic Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Archives of Pediatric Infectious Diseases:Vol. 11, issue 1; e127183
Published online:Jan 02, 2023
Article type:Research Article
Received:May 11, 2022
Accepted:Oct 10, 2022
How to Cite:Almasian Tehrani N, Alebouyeh M, Armin S, Soleimani N, Karimi A, et al. Intestinal Carriage of Carbapenemase-Producing Enterobacteriaceae Members in Immunocompromised Children During COVID-19 Pandemic. Arch Pediatr Infect Dis. 2023;11(1):e127183. doi: https://doi.org/10.5812/pedinfect-127183

Abstract

Background:

Hospital-acquired infection with carbapenem-resistant Enterobacteriaceae (CRE) is a global concern. The administration of antibiotics among the infected and non-infected immunocompromised children with SARS-CoV-2 is associated with an increased risk of intestinal CRE colonization and bacteremia during hospitalization.

Objectives:

The present study aimed to detect the correlation between the intestinal colonization of carbapenemase encoding Enterobacteriaceae with SARS-CoV-2 infection and antibiotic prescription among immunocompromised children admitted to the oncology and Bone Marrow Transplantation (BMT) wards.

Methods:

Stool samples were collected from the immunocompromised children, and the members of Enterobacteriaceae were isolated using standard microbiological laboratory methods. Carbapenem resistance isolates were initially characterized by the disc diffusion method according to CLSI 2021 and further confirmed by the PCR assay. SARS-CoV-2 infection was also recorded according to documented real-time PCR results.

Results:

In this study, 102 Enterobacteriaceae isolates were collected from the stool samples. The isolates were from Escherichia spp. (59/102, 57.8%), Klebsiella spp. (34/102, 33.3%), Enterobacter spp. (5/102, 4.9%), Citrobacter spp. (2/102, 1.9%), and Serratia spp. (2/102, 1.9%). The carbapenem resistance phenotype was detected among 42.37%, 73.52%, 40%, 50%, and 100% of Escherichia spp., Klebsiella spp., Enterobacter spp., Citrobacter spp., and Serratia spp., respectively. Moreover, blaOXA-48 (49.1%) and blaNDM-1 (29.4%), as well as blaVIM (19.6%) and blaKPC (17.6%) were common in the CRE isolates. SARS-CoV-2 infection was detected in 50% of the participants; however, it was confirmed in 65.45% (36/55) of the intestinal CRE carriers. The administration of antibiotics, mainly broad-spectrum antibiotics, had a significant correlation with the CRE colonization in both the infected and non-infected children with SARS-CoV-2 infection.

Conclusions:

Regardless of the COVID-19 status, prolonged hospitalization and antibiotic prescription are major risk factors associated with the CRE intestinal colonization in immunocompromised children.

1. Background

Immunocompromised children with underlying diseases are at higher risk of hospital-acquired infection (1). These patients experience multiple hospitalization courses and receive antibiotics with likely effects on their gut microbiota composition. The richness of resistant variants of these bacteria in the intestine during hospitalization is mainly associated with extraintestinal infections and increased mortality risk.
The increased use of antibiotics has been reported in clinical settings during the COVID-19 pandemic. Among the resistant bacteria, carbapenem-resistant Enterobacteriaceae (CRE) is of primary concern. In these bacteria, Carbapenemases can hydrolyze all beta-lactam antibiotics, including carbapenems, as the last line of medication in severe nosocomial infections (2). Carbapenemase genes are encoded on transferable genetic elements, and their horizontal transfer makes them potentially responsible for outbreaks. The intestinal colonization of CRE is a risk factor for severe hospital infections and could serve as a reservoir for the transmission of these pathogens in clinical settings (2, 3). CRE is a major global concern leading to an increased mortality rate (4, 5). Carbapenemases are classified by their molecular structure (Ambler classification) in three groups (4, 6). Escherichia coli with NDM-1 is a human health-threatening pathogen, especially in vulnerable patients with underlying diseases, long-term hospitalization, and immune deficiencies (7, 8).

2. Objectives

The rates of fecal carriage of CRE vary across the world and patients with different health conditions. As a risk factor in HAIs, the fecal carriage of CRE is integral in vulnerable pediatric patients and accounts for comorbidity with SARS-CoV-2 and therapeutic regimens (9, 10). To find such a correlation in clinical settings, this study aimed to investigate the correlation between the intestinal carriages of CRE with the diversity of carbapenemase genes, SARS-CoV-infection status, and the types of antibiotics prescribed in immunocompromised children during hospitalization at oncology and hematology wards.

3. Methods

3.1. Patients and Samples

This study was conducted from August 21 to January 20 in Tehran, Iran. To this end, 102 stool samples were collected from immunocompromised pediatric patients admitted to the oncology and BMT wards of the hospital. The patients' information was obtained from questionnaires and hospital documents. All the stool samples were brought to the laboratory at least 2 hours after sampling. Selective cultures such as MacConkey agar (Pronadisa, CONDA, Spain) and biochemical tests such as TSI, IMViC, ureases, and lysine decarboxylase were used for Enterobacteriaceae characterization. Moreover, the COVID-19-related data of the patients were collected from the hospital documents.

3.2. Antibiotic Susceptibility Testing

The standard disk diffusion method was used to determine the sensitivity/resistance of Enterobacteriaceae isolates against imipenem (10 µg), meropenem (10 µg), amikacin (30 µg), gentamycin (10 µg), ceftazidime (30 µg), levofloxacin (5 µg), cefepime (30 µg), cefotaxime (30 µg), aztreonam (30 µg), and tigecycline (15 µg). Moreover, Muller Hinton agar (BD, USA), culturing 24 hours of isolates, diluting in 3 milliliters of physiological serum, and making standard McFarland were also used. The antimicrobial susceptibility was measured using the inhibition zone in the CLSI chart (11).

3.3. Detection of Carbapenemase Genes

Carbapenemase genes (blaOXA-48, blaNDM-1, blaKPC, and blaVIM) were assayed by PCR. Specific primers (SIGMA, Germany, and UK) were also used, and their sequences are presented in Table 1.
Table 1.This Study Used Nucleic Acid Primer Sequencing of CRE Genes to Diagnose CRE Strains
Carbapenemase GenesBase PairsSequence (5 ˊ- 3')TM°CPCR ConditionsReference
OXA-48392F CCAAGCATTTTTACCCGCATCKACC65.5One cycle of initial denaturation at 95°C for 1 min, 30 cycles of denaturation at 95°C for 30 sec, Annealing at 55°C for 30 sec, Extension at 75°C for 1 min; and 1 cycle of final extension at 72 for 7 min.(12)
R GYTTGACCATACGCTGRCTGCG61
NDM-1129F CCCCGCCACACCAGTGACANCTC75.6One cycle of initial denaturation at 95°C for 1 min, 32 cycles of denaturation at 95°C for 30 sec, Annealing at 61°C for 30 sec, Extension at 7°C for 1 min; and 1 cycle of final extension at 72°C for 5 min.(13)
RGTAGTGCTCAGTGTGGGCAT63
VIM390F GATGGTGTTTGGTCGCATA55.5One cycle of initial denaturation at 94°C for 10 min, 35 cycles of denaturation at 94°C for 30 sec, Annealing at 61°C for 40 sec, Extension at 72°C for 1 min; and 1 cycle of final extension at 72°C for 7 min.(14)
R CGAATGCGCAGCACCAG57.2
KPC636F CTGTCTTGTCTCTCATGGCC60.5One cycle of initial denaturation at 94°C for 5 min, 32 cycles of denaturation at 94°C for 35 sec, Annealing at 62°C for 35 sec, Extension at 72°C for 32 sec; and 1 cycle of final extension at 72°C for 5 min.(15)
R CCTCGCTGTGCTTGTCATCC62.5

4. Results

4.1. Patients

Among the participants, there were 54% (55/102) males and 46% (47/102) females, most of whom (43.13%, 44/102) were 1 - 5 years old. Moreover, 88% (90/102) of the patients had undergone treatment with broad-spectrum antibiotics such as carbapenems, cephalosporins, aminoglycosides, ciprofloxacin, and azithromycin. Table 2 presents the patients’ demographic information.
Table 2.Demographic Information of Immunocompromised Children
VariablesNo. (%) (N = 102)
Gender
Male55 (54)
Female47(46)
Age (y)
≤ 5 44 (43.13)
6 - 10 41 (40.19)
≥ 11 17 (16.66)
Ward
BMT23 (22.5)
Oncology79 (77.5)
Underlying disease
AML31 (30.3)
ALL13 (12.7)
Neuroblastoma10 (9.8)
Others48 (47.05)
Antimicrobial prophylaxis
Broad spectrum antibiotics90 (88)
Non-broad spectrum antibiotics12 (12)
COVID-19 status
Positive51 (50)
Negative 51 (50)
Death
Yes 24 (23.5)
No 78 (76.5)

Abbreviations: AML, acute myeloid leukemia; ALL, acute lymphocytic leukemia.

4.2. CRE Frequency in Intestinal Samples Isolated from Immunocompromised Children

During the study period, 102 clinical Enterobacteriaceae isolates were collected, the frequencies of which was as follows: Escherichia spp. (59/102, 57.8%), Klebsiella spp. (34/102, 33.3%), Enterobacter spp. (5/102, 4.9%), Citrobacter spp. (2/102, 1.9%), and Serratia spp. (2/102, 1.9%). According to the antimicrobial susceptibility tests, the strains showed the highest and the lowest resistance rates against ceftazidime (74.5%, 76/102) and tigecycline (13.72%, 14/102), respectively. Table 3 shows antimicrobial-resistant patterns.
Table 3.Antimicrobial-resistant Patterns of Enterobacteriaceae Members Isolated from Immunocompromised Children a
AntibioticsEscherichia spp. N = 59Klebsiella spp. N = 34Enterobacter spp. N = 5Citrobacter spp. N = 2Serratia spp. N = 2
IMP (10 µg)16 (27.11)20 (58.82)2 (40)1 (50)2 (100)
MEM (10 µg)14 (23.72)20 (58.82)2 (40)-2 (100)
AN (30 µg)11 (18.64)13 (38.23)2 (40)-2 (100)
GM (10 µg)29 (49.15)19 (55.88)2 (40)1 (50)1 (50)
CAZ (30 µg)45 (76.27)25 (73.52)3 (60)1 (50)2 (100)
LVX (5 µg)25 (42.37)15 (44.11)-1 (50)2 (100)
CTX (30 µg)45 (76.27)25 (73.52)2 (40)1 (50)2 (100)
CFM (30 µg)31 (52.54)19 (55.88)2 (40)1 (50)2 (100)
AZT (30 µg)41 (69.49)23 (67.64)3 (60)1 (50)2 (100)
TGC (15 µg)3 (5.08)8 (23.52)2 (40)1 (50)-

Abbreviations: IMP, imipenem; MEM, meropenem; AN, amikacin; GM, gentamycin; CAZ, ceftazidime; LVX, levofloxacin; CFM, cefepime; CTX, cefotaxime; AZT, aztreonam; TGC, tigecycline.

a Values are expressed as No. (%).

The highest rate resistance to antibiotics was recorded in Escherichia spp. to ceftazidime and cefotaxime (76.27%), Klebsiella spp. to ceftazidime and cefotaxime (73.5%), Enterobacter spp. to ceftazidime and aztreonam (60%), Citrobacter spp. to all antibiotics except for meropenem and amikacin (50%), and Serratia spp. to all antibiotics except for gentamycin and tigecycline (100%).

4.3. Frequency of Carbapenemase Genes in Intestinal CRE Isolated from Immunocompromised Children

Carbapenem resistance was observed in 54% (55/102) of the strains, the frequencies of which was as follows: Escherichia spp. (42.37%, 25/59); Klebsiella spp. (73.52%, 25/34); Enterobacter spp. (40%, 2/5); Citrobacter spp. (50%, 1/2), and Serratia spp. (100%, 2/2). Out of the 55 CRE strains, the frequencies of carbapenemase were as follows blaOXA-48 (90.9%, 50/55), blaNDM-1 (54.54%, 30/55), blaVIM (36.36%, 20/55), and blaKPC (32.72%, 18/55). Figure 1 illustrates the frequency of the resistance genes among the CRE strains.
Frequency of carbapenemase-producing genes in CRE isolated from stool samples of immunocompromised children.
Figure 1.

Frequency of carbapenemase-producing genes in CRE isolated from stool samples of immunocompromised children.

4.4. Intestinal CRE Carriage in Children with COVID-19 and Broad-Spectrum Antibiotic Usage

In this study, 50% (51/102) of the immunocompromised patients had laboratory-confirmed COVID-19. Of patients with intestinal CRE colonization54% (55/102), 65.45% (36/55) were COVID-19 positive after admission in the oncology and BMT wards. Out of patients with COVID-19 (50%, 51/102), 94.11% (48/51) underwent broad-spectrum antibiotics treatment. Table 4 presents the status of CRE carriers, COVID-19, and broad-spectrum antibiotic usage.
Table 4.Frequency of Intestinal CRE Carriers with COVID-19 and Broad-Spectrum Antibiotic Usage a
CRE and Antibiotic StatusCOVID-19 Positive; N = 51COVID-19 Negative; N = 51P-Value
CRE carriers and consumed broad-spectrum antibiotics29 (56.86)15 (29.41)0.027
CRE carriers and not-consumed broad-spectrum antibiotics2 (3.9)4 (7.84)
Not CRE carriers and consumed broad-spectrum antibiotics19 (37.25)27 (52.94)
Not CRE carriers and not-consumed broad-spectrum antibiotics1 (1.9)5 (9.8)

a Values are expressed as No. (%).

5. Discussion

The rate of hospital admissions in both infectious disease and pediatric intensive care unit (PICU) wards has been increasing because of the COVID-19pandemic. This had enhanced the likelihood of COVID-19 diffusion among other hospital wards (16). The description of broad-spectrum antibiotics such as carbapenems in these patients is associated with some side-effects, including the multiplication of carbapenemase genes, and the admission in different wards can also lead to the CRE outbreaks (17). The fecal carriage and intestinal colonization of CRE can raise the risks of secondary infections and increase mortality rates (18). CRE has revealed different drug resistance mechanisms, making the early detection and control of the CRE infections challenging (19).
Accordingly, we focused on the correlation between the intestinal carriage of CRE and the possible effects of carbapenemase genes on immunocompromised children during the COVID-19 pandemic.
The findings revealed that 65.45% of the immunocompromised pediatrics with the intestinal carriage of CRE were COVID-19 positive after hospitalization. Most of the patients were males (54%), and AML was the most frequent underlying disease among the patients. COVID-19 played an integral role in hospital prolongation and increasing death rates in intestinal CRE carriers.
Another study was conducted in the UK in 2022 to examine COVID-19 in immunocompromised children, and the findings indicated no mortality and the low risk of severe infections (1). The differences between this study and the present study might have underestimated the pivotal role of antibiotics administration and its association with CRE carriage and COVID-19.
Escherichia spp. was the most frequent strains isolated from immunocompromised children (57.8%) and also the most frequent carbapenem-resistant strain isolated from the intestinal CRE carriage of COVID-19 positive patients (68%). The second most frequent strain was Klebsiella spp. (33.3%) in 60% of COVID-19 positive CRE carriages. In a study carried out in 2021 in the USA, the frequency of CRE strains isolated from confirmed COVID-19 patients was 41.9%, and the most frequent species was Klebsiella pneumonia (90.3%) (17). The differences between the percentages of the CRE isolates could be attributed to differences in the samples as the target samples in the former study were feces; however, the latter one worked on blood and respiratory samples. Moreover, the frequency of Escherichia spp. was higher than the other kinds of samples.
Among intestinal CRE isolated from the intestinal track of the immunocompromised children, OXA-48 had the highest prevalence in this study. The first case of blaOXA-48 detection in Iran was reported by Azimi et al., who reported blaOXA-48 in 96% of imipenem-resistant K. pneumonia isolated from the immunodeficient patients (20, 21). According to a systematic review by Nasiri et al., blaOXA48 gene was the most common cause of carbapenem resistance in K. pneumoniae and E. coli in Iran (22). Pérez-Blanco et al. founded the higher frequency of OXA-48 in K. pneumoniae compared to other species, including K. pneumonia (93.6%), Escherichia coli (2.3%), Enterobacter spp. (1.7%), both K. pneumoniae and E. coli (0.5%), and Raoultella spp. or Citrobacter spp. (1.8%) (23). The high prevalence of OXA-48 among CRE in many studies can prove that carbapenem strains harboring OXA-48 has been boosting in Iran and becoming the endemic carbapenemase, thereby highlighting the significance of the strength detection and prevention control of CRE (22).
The detection of NDM-1 in K. pneumonia was first reported in 2013 in Iran (24). According to a study in 2019, NDM-1 was detected among 100% of the CRE isolates in Brazil, suggesting the high prevalence of NDM-1 in this country (25). In our study, NDM-1 was detected in 54.54% of the CRE strains. According to the data about harboring NDM-1 plasmid, a carrier of several other resistant genes, we can conclude that the spread of this challenging carbapenemase is in a medium range in Iran. On the other hand, the findings of this study suggest that NDM-1 has been increasing across the country in recent years. The high prevalence of NDM-1 in bacteria in hospitals can be a major challenge in treating and controlling infectious diseases (24).
The emergence of VIM-producing K. pneumoniae in Iran is also a concern. VIM-producing bacteria constitute the prevalent multidrug-resistant population of K. pneumoniae in Iran (26). In a study in 2019, 73% of Enterobacteriaceae isolates, especially Enterobacter spp., collected from clinical and environmental samples, were VIM carriers (27). In the present study, we reported 36.36% of VIM carriage among CRE.
The correlation between CRE intestinal carriage with COVID-19 and administrational antibiotics was significant in this study. To the best of our knowledge, no similar study has addressed this issue.
Note that most of the patients who were CRE colonized had previous hospital admission and had consumed broad-spectrum antibiotics, especially ciprofloxacin and carbapenems. In the present study, the most frequently used prophylaxis antibiotics in these two wards were meropenem, vancomycin, and amikacin. It can be assumed that immune deficiency in patients admitted to the BMT and oncology wards is a remarkable risk factor for upcoming infections such as COVID-19 and that the circle of these infections finally would end in prolonged hospitalization period, which itself is one of the most dangerous hospital-acquired infection-inducing risk factors. Moreover, this process could lead to the spread of the CRE strains by the carriers during admission in different hospital wards. In this study, there was no control group of inpatient children; hence, further studies are required to detect the relationship between CRE colonization with previous hospital admissions, prophylaxis antibiotics diet, and COVID-19.

5.1. Conclusion

Regardless of the COVID-19 pandemic, prolonged hospitalization and antibiotic prescription are main risk factors associated with the CRE intestinal colonization in immunocompromised children. The high prevalence of blaOXA-48 in these isolates, especially in Escherichia spp., can raise therapeutic challenges and concerns about systemic infections in these patients. The intestinal carriage of KPC could increase the risk of secondary infection treatment failure in immunocompromised and COVID-19 positive patients. The co-occurrence of NDM-1, OXA-48, and VIM-producing Enterobacteriaceae is a concern and need further consideration to control their spread rate and highlight the significance of maximizing the infection control measures.

Acknowledgments

Footnotes

References

  • 1.
    Chappell H, Patel R, Driessens C, Tarr AW, Irving WL, Tighe PJ, et al. Immunocompromised children and young people are at no increased risk of severe COVID-19. J Infect. 2022;84(1):31-9. [PubMed ID: 34785268]. [PubMed Central ID: PMC8590622]. https://doi.org/10.1016/j.jinf.2021.11.005.
  • 2.
    Solgi H, Badmasti F, Aminzadeh Z, Giske CG, Pourahmad M, Vaziri F, et al. Molecular characterization of intestinal carriage of carbapenem-resistant Enterobacteriaceae among inpatients at two Iranian university hospitals: first report of co-production of bla NDM-7 and bla OXA-48. Eur J Clin Microbiol Infect Dis. 2017;36(11):2127-35. [PubMed ID: 28639165]. https://doi.org/10.1007/s10096-017-3035-3.
  • 3.
    García-Arenzana N, Redondo-Bravo L, Espinel-Ruiz MA, Borrego-Prieto P, Ruiz-Carrascoso G, Quintas-Viqueira A, et al. Carbapenem-Resistant Enterobacteriaceae Outbreak in a Medical Ward in Spain: Epidemiology, Control Strategy, and Importance of Environmental Disinfection. Microb Drug Resist. 2020;26(1):54-9. [PubMed ID: 31524566]. https://doi.org/10.1089/mdr.2018.0390.
  • 4.
    Alizadeh N, Ahangarzadeh Rezaee M, Samadi Kafil H, Hasani A, Soroush Barhaghi MH, Milani M, et al. Evaluation of Resistance Mechanisms in Carbapenem-Resistant Enterobacteriaceae. Infect Drug Resist. 2020;13:1377-85. [PubMed ID: 32494169]. [PubMed Central ID: PMC7229782]. https://doi.org/10.2147/idr.s244357.
  • 5.
    Salomão MC, Freire MP, Boszczowski I, Raymundo SF, Guedes AR, Levin AS. Increased Risk for Carbapenem-Resistant Enterobacteriaceae Colonization in Intensive Care Units after Hospitalization in Emergency Department. Emerg Infect Dis. 2020;26(6):1156-63. [PubMed ID: 32267827]. [PubMed Central ID: PMC7258474]. https://doi.org/10.3201/eid2606.190965.
  • 6.
    Armin S, Fallah F, Azimi L, Samadi Kafil H, Ghazvini K, Hasanzadeh S, et al. Warning: spread of NDM-1 in two border towns of Iran. Cell Mol Biol (Noisy-le-grand). 2018;64(10):125-9. [PubMed ID: 30084804].
  • 7.
    Kakian F, Fathi J, Alvandi F, Moumivand M, Rabei Gholami A, Gholipour A, et al. The occurrence of antibiotic resistance, ESBLs, MBL and NDM-1 in Uropathogenic Escherichia coli in Central part of Iran. J Curr Biomed Rep. 2020;1(2):73-6. https://doi.org/10.52547/JCBioR.1.2.73.
  • 8.
    Montagnani C, Prato M, Scolfaro C, Colombo S, Esposito S, Tagliabue C, et al. Carbapenem-resistant Enterobacteriaceae Infections in Children: An Italian Retrospective Multicenter Study. Pediatr Infect Dis J. 2016;35(8):862-8. [PubMed ID: 27100130]. https://doi.org/10.1097/inf.0000000000001188.
  • 9.
    Satlin MJ, Jenkins SG, Walsh TJ. The global challenge of carbapenem-resistant Enterobacteriaceae in transplant recipients and patients with hematologic malignancies. Clin Infect Dis. 2014;58(9):1274-83. [PubMed ID: 24463280]. [PubMed Central ID: PMC4038783]. https://doi.org/10.1093/cid/ciu052.
  • 10.
    Wee LEI, Conceicao EP, Tan JY, Magesparan KD, Amin IBM, Ismail BBS, et al. Unintended consequences of infection prevention and control measures during COVID-19 pandemic. Am J Infect Control. 2021;49(4):469-77. [PubMed ID: 33157180]. [PubMed Central ID: PMC7610096]. https://doi.org/10.1016/j.ajic.2020.10.019.
  • 11.
    Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. 32th ed. Malvern, UK: Clinical and Laboratory Standards Institute; 2022.
  • 12.
    Wolter DJ, Khalaf N, Robledo IE, Vázquez GJ, Santé MI, Aquino EE, et al. Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates from Puerto Rican Medical Center Hospitals: dissemination of KPC and IMP-18 beta-lactamases. Antimicrob Agents Chemother. 2009;53(4):1660-4. [PubMed ID: 19188398]. [PubMed Central ID: PMC2663076]. https://doi.org/10.1128/aac.01172-08.
  • 13.
    Liu S, Wang Y, Xu J, Li Y, Guo J, Ke Y, et al. Genome sequence of an OXA23-producing, carbapenem-resistant Acinetobacter baumannii strain of sequence type ST75. J Bacteriol. 2012;194(21):6000-1. [PubMed ID: 23045506]. [PubMed Central ID: PMC3486073]. https://doi.org/10.1128/jb.01440-12.
  • 14.
    Szejbach A, Mikucka A, Bogiel T, Gospodarek E. Usefulness of phenotypic and genotypic methods for metallo-beta-lactamases detection in carbapenem-resistant Acinetobacter baumannii strains. Med Sci Monit Basic Res. 2013;19:32-6. [PubMed ID: 23333953]. [PubMed Central ID: PMC3638691]. https://doi.org/10.12659/msmbr.883744.
  • 15.
    Azimi L, Rastegar-Lari A, Talebi M, Ebrahimzadeh-Namvar A, Soleymanzadeh-Moghadam S. Evaluation of phenotypic methods for detection of Klebsiella pneumoniae carbapenemase-producing K. pneumoniae in Tehran. J Med Bacteriol. 2013;2(3-4):26-31.
  • 16.
    Farfour E, Lecuru M, Dortet L, Le Guen M, Cerf C, Karnycheff F, et al. Carbapenemase-producing Enterobacterales outbreak: Another dark side of COVID-19. Am J Infect Control. 2020;48(12):1533-6. [PubMed ID: 33011336]. [PubMed Central ID: PMC7529666]. https://doi.org/10.1016/j.ajic.2020.09.015.
  • 17.
    Gomez-Simmonds A, Annavajhala MK, McConville TH, Dietz DE, Shoucri SM, Laracy JC, et al. Carbapenemase-producing Enterobacterales causing secondary infections during the COVID-19 crisis at a New York City hospital. J Antimicrob Chemother. 2021;76(2):380-4. [PubMed ID: 33202023]. [PubMed Central ID: PMC7717307]. https://doi.org/10.1093/jac/dkaa466.
  • 18.
    Gajdács M, Ábrók M, Lázár A, Jánvári L, Tóth Á, Terhes G, et al. Detection of VIM, NDM and OXA-48 producing carbapenem resistant Enterobacterales among clinical isolates in Southern Hungary. Acta Microbiol Immunol Hung. 2020;67(4):209-15. [PubMed ID: 33258795]. https://doi.org/10.1556/030.2020.01181.
  • 19.
    Suay-García B, Pérez-Gracia MT. Present and Future of Carbapenem-resistant Enterobacteriaceae (CRE) Infections. Antibiotics (Basel). 2019;8(3). [PubMed ID: 31430964]. [PubMed Central ID: PMC6784177]. https://doi.org/10.3390/antibiotics8030122.
  • 20.
    Latifi B, Tajbakhsh S, Askari A, Yousefi F. Phenotypic and genotypic characterization of carbapenemase-producing Klebsiella pneumoniae clinical isolates in Bushehr province, Iran. Gene Rep. 2020;21:100932. https://doi.org/10.1016/j.genrep.2020.100932.
  • 21.
    Azimi L, Nordmann P, Lari AR, Bonnin RA. First report of OXA-48-producing Klebsiella pneumoniae strains in Iran. GMS Hyg Infect Control. 2014;9(1):Doc07. [PubMed ID: 24653971]. [PubMed Central ID: PMC3960935]. https://doi.org/10.3205/dgkh000227.
  • 22.
    Nasiri MJ, Mirsaeidi M, Mousavi SMJ, Arshadi M, Fardsanei F, Deihim B, et al. Prevalence and Mechanisms of Carbapenem Resistance in Klebsiella pneumoniae and Escherichia coli: A Systematic Review and Meta-Analysis of Cross-Sectional Studies from Iran. Microb Drug Resist. 2020;26(12):1491-502. [PubMed ID: 32348701]. https://doi.org/10.1089/mdr.2019.0440.
  • 23.
    Pérez-Blanco V, Redondo-Bravo L, Ruíz-Carrascoso G, Paño-Pardo JR, Gómez-Gil R, Robustillo-Rodela A, et al. Epidemiology and control measures of an OXA-48-producing Enterobacteriaceae hospital-wide oligoclonal outbreak. Epidemiol Infect. 2018;146(5):656-62. [PubMed ID: 29458443]. [PubMed Central ID: PMC9134566]. https://doi.org/10.1017/s0950268818000249.
  • 24.
    Shahcheraghi F, Nobari S, Rahmati Ghezelgeh F, Nasiri S, Owlia P, Nikbin VS, et al. First report of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Iran. Microb Drug Resist. 2013;19(1):30-6. [PubMed ID: 22984942]. https://doi.org/10.1089/mdr.2012.0078.
  • 25.
    da Silva IR, Aires CAM, Conceição-Neto OC, de Oliveira Santos IC, Ferreira Pereira N, Moreno Senna JP, et al. Distribution of Clinical NDM-1-Producing Gram-Negative Bacteria in Brazil. Microb Drug Resist. 2019;25(3):394-9. [PubMed ID: 30676240]. https://doi.org/10.1089/mdr.2018.0240.
  • 26.
    Rajabnia R, Asgharpour F, Ferdosi Shahandashti E, Moulana Z. Nosocomial emerging of (VIM1) carbapenemase-producing isolates of Klebsiella pneumoniae in North of Iran. Iran J Microbiol. 2015;7(2):88-93. [PubMed ID: 26622969]. [PubMed Central ID: PMC4662784].
  • 27.
    Kohler P, Tijet N, Kim HC, Johnstone J, Edge T, Patel SN, et al. Dissemination of Verona Integron-encoded Metallo-β-lactamase among clinical and environmental Enterobacteriaceae isolates in Ontario, Canada. Sci Rep. 2020;10(1):18580. [PubMed ID: 33122675]. [PubMed Central ID: PMC7596063]. https://doi.org/10.1038/s41598-020-75247-7.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles