Distribution of Virulence Genes, Enterotoxin and Biofilm Formation Among Enteroaggregative Escherichia Coli (EAEC) Strains Isolated From Stools of Children With Diarrhea in South East Iran

Authors

Razieh Nezarieh1, Mohammad Reza ShakibaieMohammad Reza Shakibaie ORCID1, 2,*, Hossein Hosseini Nave1, Amin Norouzi1, Gholamabas Salajegheh3, Mehdi Hayatbakhsh4
1Department of Microbiology and Virology, Kerman University of Medical Sciences, Kerman, IR Iran
2Research Center for Infectious Diseases and Tropical Medicine, Kerman University of Medical Sciences, Kerman, IR Iran
3Division of Internal Medicine, Department of Infectious Diseases, Afzalipour Hospital, Kerman, IR Iran
4Gastroenterology and Hepatology Research Center, Kerman University of Medical Sciences, Kerman, IR Iran
*Corresponding Author: Corresponding author: Mohammad Reza Shakibaie, Department of Microbiology and Virology, Kerman University of Medical Sciences, Kerman, IR Iran. Tel: +98-3419133408226, Fax: +98-3413221671, E-mail: Email: [email protected]

Archives of Pediatric Infectious Diseases:Vol. 3, issue 3; e29745
Published online:Jul 01, 2015
Article type:Research Article
Received:May 05, 2015
Accepted:May 15, 2015
How to Cite:Nezarieh R, Shakibaie MR, Hosseini Nave H, Norouzi A, Salajegheh G, et al. Distribution of Virulence Genes, Enterotoxin and Biofilm Formation Among Enteroaggregative Escherichia Coli (EAEC) Strains Isolated From Stools of Children With Diarrhea in South East Iran. Arch Pediatr Infect Dis. 2015;3(3):e29745. doi: https://doi.org/10.5812/pedinfect.29745v2

Abstract

Background:

Enteroaggregative Escherichia coli (EAEC) is commonly associated with pediatric diarrhea, in developing countries.

Objectives:

In this study, we investigated the distribution of virulence genes, enterotoxin and biofilm formation among EAEC strains isolated from stools of children with diarrhea referred to three hospitals in south east Iran.

Patients and Methods:

A total of 464 diarrheic stools were screen for the presence of E. coli using conventional tests. Well isolated colonies were then evaluated for the presence of EAEC diagnostic genes (aggR and pCVD432) by duplex polymerase chain reaction (D-PCR). Positive samples were further subjected to three sets of multiplex-PCR for detection of fimbrial subunits (AAF), serine protease autotransporter toxins (SPATE) and at least one enterotoxin gene. Hemolytic activity was observed on sheep blood agar. Biofilm formation was measured by using a microtiter plate assay.

Results:

Among the 322 E. coli isolated, 23 were identified as EAEC. All EAEC carried a 630-bp fragment of the plasmid (pAA) encoded pCVD432 and aggR genes. Four major EAEC fimbriae variants aggA, agg4A, agg3A and aafA were detected, with the frequencies of 21.7% (n = 5), 26.8% (n = 6), 21.7% (n = 5) and 4.3% (n = 1), respectively. The class I and II virulence toxins pic, sat, sepA, pet and sigA were detected with frequencies of 56.5% (n = 13), 30.4% (n = 7), 26.8% (n = 6), 21.7% (n = 5) and 4.3% (n = 1), respectively. A heat-stable Shigella enterotoxin-1 gene (astA) was detected in 17.3% (n = 4) of the cases. In addition, 56.4% of the EAEC isolates were α-hemolytic. Quantification of the biofilm revealed six isolates with strong biofilm.

Conclusions:

Overall, except for pCVD432 and aggR, we detected high heterogeneity of virulence factors among EAEC isolates causing diarrhea in children. One set of genes, in the combination, pic- sepA- agg4A, was associated with strong biofilm.

1. Background

Bacterial diarrhea is the second most common cause of morbidity and mortality in developing and underdeveloped countries and among the causative agents, Escherichia coli (E. coli) plays a dominant role in community acquired enteritis (1, 2). The E. coli is a type of bacteria that lives in the human intestine, as normal flora; however, five distinct pathotypes have been characterized, including enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), enterohemorrhagic E. coli, enteropathogenic E. coli (EPEC), and enterotoxigenic E. coli (ETEC) that cause diseases (3). The EAEC is an important etiologic agent of diarrhea among children and is increasingly recognized as a global emerging pathogen, with potential threat to public health (4-6). It was first described in 1985, recognized by its distinctive adherence to HEp-2 cells in an aggregative, stacked brick-like pattern, and also its tendency to attach to abiotic surfaces, when grown in tissue culture plates (7, 8). This bacterium produces a watery diarrhea and can cause symptoms, such as abdominal pain and fever, in children, as well as adults. Most prominently, besides causing acute diarrhea, it can also persist in the human intestine subclinically, inducing chronic inflammation in the absence of dysentery (9). In addition, the pathogenic potential of EAEC has been demonstrated by the emergence of recent food borne outbreaks, most notably in Germany in 2011 (10). The frequency of diarrhea in developed and developing countries differs and poor sanitation and crowded living conditions increase the propensity for EAEC to spread in developing countries. The EAEC is also linked to diarrhea in adults, including HIV‐positive patients and travelers visiting less developed regions of the world. Recently, it was found that EAEC isolates are associated with extraintestinal infections, such urinary tract infections (UTIs) and hemolytic uremic syndrome (HUS) (11, 12).
At the molecular level, a diagnostic probe was initially constructed for polymerase chain reaction (PCR) amplification of a 630-bp fragment of a plasmid encoded autotransporter adherence pCVD432 (aatA) gene, in harboring strains (13). Principally, among adherence genes, fimbriae I and II (AAF/I and AAF/II), which are required for attachment to surfaces and form biofilm, as well as the AAF/III that help EAEC strains bind loosely to epithelial cells, were identified. The AAF was assigned into several distinct alleles, including four major pilin variants (aggA, aafA, agg3A and agg4A) (14).
Similarly, plasmid encoded serine protease autotransporters of Enterobacteriaceae (SPATE) toxins detected in several EAEC strains that cause increased mucus release, exfoliation of cells and development of crypt abscesses (15). This family comprises two classes; class-I consists of the cytotoxic genes, which include pet and sat (16) and class-II include the genes involved in colonization (pic) and Shigella extracellular protease (sepA), which appears to be involved in tissue invasion (17). In addition, several strains of EAEC produce enterotoxins, such as the enteroaggregative heat stable toxin-1 (EAST1) and the Shigella enterotoxin-1 (ShET1) (18).
Little information is available on the prevalence of EAEC infections in Iran. A PCR method, based on identifying the presence of the virulence genes pCVD432, aggR, aggA, aafA, aap, and astA was used among EAEC isolated from fecal samples, in Tehran (19). In another study from Iran, out of 715 stool samples collected from patients showing diarrhea in Shiraz, 101 diarrhoeagenic E. coli were identified, five of which confirmed as EAEC (20). Similarly, Bouzari et al. (21) isolated 98 E. coli strains that displayed the aggregative adherence pattern on HeLa cells and hybridized with the pCVD432 probe.

2. Objectives

The aims of present study were to investigate distribution of the putative plasmid encoded AAF (AAF/I, II, III), SPATE cytotoxins (sat, sepA, pic), Shigella like enterotoxin-1 astA genes and biofilm formation among EAEC strains, isolated from stool of children with diarrhea, in south east Iran.

3. Patients and Methods

3.1. Specimen Collection and Microbiological Processing

A total of 464 stool samples of diarrheal patients referred to three main hospitals were collected by an expert laboratory technician during the summer seasons of 2013 and 2014. The children were classified according the age groups: 1-5 years old, 5-10 years old and more than 10 years old. Initially screened for ‘presumptive’ colonies of E. coli by overnight enrichment of the samples in the E. coli enrichment broth (HiMedia, Mumbai, India), followed by streaking on selective MacConkey and eosin-methylene blue (EMB) agars (HiMedia, Mumbai, India) and incubation of plates at 37°C for 24 hours and final bacterial identification, colonies were recovered and kept at freezing temperature (-70°C) for further analyses.

3.2. Detection of Aggr and Cdv432 Genes by Duplex- Polymerase Chain Reaction

The E. coli isolates were tested for the presence of aggR and pCVD432 genes, using duplex-PCR, as described previously (13). Briefly, total genomic DNA was isolated from a single colony grown on EMB agar plates by boiling method and used for PCR reactions. The forward and reverse primer sequences (Thermo Scientific, Vilnius, Lithuania) for EAEC-specific genes were designed using references, as shown in Table 1 and confirmed by online Primer Quest software tool (http://www.ncbi.nlm.nih.gov/GeneBank). To verify whether the PCR sensitivity is sufficient for diagnostic use, ten-fold dilutions of the template DNA of diarrheagenic E. coli was quantified, using optical density at 280/260 nm. The PCR reaction was performed with 2 µL DNA template, primers (20 pM) 1 µL, master mix 12.5 µL (Amplicon, Brighton, UK), DD/W 9.5 µL in a temperature gradient thermal cycler (Biometra-T gradient, Biometra GmbH, Gottingen, Germany). Amplification protocol comprised of initial denaturation temperature at 95°C for 5 minutes, followed by 30 cycle of denaturation at 95°C for 40 seconds, annealing at 56°C for 40 seconds, extension at 72°C for 30 seconds, followed by a final extension at 70°C for 5 minutes. The electrophoresis of the amplified DNA fragments, along with 100 bp DNA marker ladder was carried out using 1.2% agarose gel (Merck, Darmstadt, Germany) in 1.6 × tris-borate-EDTA (TBE) buffer (pH 8.2) and bands were visualized by UV gel documentation system. A reference DNA from prototype strain EAEC 042 containing both the aggR and pCVD432 genes was run as positive control strain, while E. coli K12 DH5α DNA was used.

3.3. Detection of Enteroaggregative Escherichia Coli Virulence Genes by Multiplex-Polymerase Chain Reaction

All EAEC positive samples were analyzed by additional multiplex PCR (M-PCR), with the primers and conditions described in Table 1 and Table 2, to amplify fragments of 10 genes encoding putative virulence factors (agg4A, aggA, aafA, agg3A, astA, satA, sigA, pet, pic and sepA). The M-PCR was divided into three sets of multiplex reactions, each with a specific denaturation and annealing temperature. A control for each virulence gene was also run along the tests.

3.4. Hemolytic Activity on Sheep Blood Agar

An amount of 200 µL of the EAEC culture was streaked on blood agar base medium (Merck, Darmstadt, Germany) supplemented with fresh sheep blood (5%). The plates were then incubated for 24 hours at 37°C and hemolytic activity surrounding the colonies was determined.

3.5. Biofilm Formation

Formation of the biofilm for each EAEC isolate was quantified by microtiter method (22), with a number of modifications. Briefly, one loopful from each well of isolated colony was inoculated into a sterile TSB medium (2 mL), containing glucose (1% W/V), to optimize biofilm formation [glucose was sterilized separately by filtering, using 0.25 µM membrane filter (Sartorius AG, Goettingen, Germany)]. The optical density (OD) of 650 nm was then adjusted to 0.13 to reach 0.5 McFarland standard (1.5 × 108 CFU/mL), followed by further dilution of prepared bacterial suspension to reach ~ 106 CFU/mL. A quantity of 100 µL of the standardized cell suspension was transferred to the wells of a round-bottom 96-well microtiter plate. Bacteria were allowed to adhere and grow without agitation for 24 hours at 37°C. After incubation, non-adherent cell suspensions were aseptically aspirated with sterile microtips, washed and replaced with 20 µL of sterile phosphate buffered solution (pH 7.2) to remove any remaining suspended cells. In order to fix the biofilm, 150 µL of methanol were added to each well and kept at room temperature (25°C) for 20 minutes. Methanol was removed and replaced with 200 µL methylene blue (1% W/V) and incubated for 30 minutes at room temperature. Microplate wells were rinsed twice with PBS pH 7 and 200 µL glacial acetic acid (33% V/V) were added. The optical density was measured at 490 nm, by using Synergy 2 multi-mode microplate reader (BioTek, Winooski, VT, USA). For each experiment, correction for background staining was made by subtracting the value for methylene blue bound to uninoculated controls. Positive standard for biofilm formation was Pseudomonas aeruginosa PAO1, and negative control was TSB broth only. The mean value was calculated from three independent experiments. The isolates were then classified into strongly adherent (strong biofilm), moderately adherent (moderate biofilm), weakly adherent (weak biofilm) and not adherent (no biofilm), based on the formula described by Stepanovic et al. (23).

4. Results

We classified children with diarrhea into three anthropometric groups. Group one had highest proportion in the population [56.52% (n = 13)] and had an age range of 1-5 years old. The second group [21.73% (n = 5)] consisted of children with ages between 5-10 years old, while the third group [21.73% (n = 5)] included patients ≥ 10 years old.
A total of 23 strains of EAEC were detected by duplex-PCR, which harbored both the aggR and pCVD432 genes (Figure 1). Distribution of virulence genes and toxins in EAEC isolates is presented in Table 2. Four major EAEC fimbrial variants, aggA, agg4A, agg3A and aafA, were detected with the frequency of 21.7% (n = 5), 26.8% (n = 6), 21.7% (n = 5) and 4.3% (n = 1), respectively (Figure 2 A, 2B). In addition, we identified the class I and II SPATE genes including pic, sat, sepA, and pet, in 56.5% (n = 13), 30.4% (n = 7), 26.8% (n = 6) and 21.7% (n = 5) of the EAEC population, respectively (Figure 2 C). SigA gene was found in only one isolate (4.3%), while the heat-stable enterotoxin-1 (EAST1) astA gene was detected in four (17.3%) cases (Figure 2 A and Table 2). Pic-sat-sepA-agg4A was the most prevalent gene combination detected in our study (Figure 2 D). A total of 56.4% of the isolates were α-hemolytic, while the remaining isolates were non-hemolytic. Quantitative evaluation of the biofilm of the represented strains introduced six isolates with strong (severely adherent), 11 isolates with moderate (moderately adherent), and six isolates with weak (weakly adherent) biofilm (Figure 3).
The DNA ladder was consist of size marker range 100 - 1500 bp. PC = positive control (A reference DNA from prototype strain EAEC 042), NC = negative control consisting of <i>E. coli</i> K12 DH5α. Numbers indicate the EAEC isolates showing strong biofilm.
Figure 1.
The DNA ladder was consist of size marker range 100 - 1500 bp. PC = positive control (A reference DNA from prototype strain EAEC 042), NC = negative control consisting of E. coli K12 DH5α. Numbers indicate the EAEC isolates showing strong biofilm.
A, The M-PCR for agg3A, agg4A, aggA and astA; B, M-PCR for satA, aafA, cdv432 and aggR genes; C, sepA, pic, sigA and pet genes; NC = negative control. The electrophoresis was carried out for 1 hour at 100 V and the gels were stained with UV illuminating dye (SYBR green).
Figure 2.
A, The M-PCR for agg3A, agg4A, aggA and astA; B, M-PCR for satA, aafA, cdv432 and aggR genes; C, sepA, pic, sigA and pet genes; NC = negative control. The electrophoresis was carried out for 1 hour at 100 V and the gels were stained with UV illuminating dye (SYBR green).
B, Microtiter plate colorimetric method of biofilm assay; TSB = negative control, PC = positive control (<i>P. aeruginosa</i> PAO1).
Figure 3.
B, Microtiter plate colorimetric method of biofilm assay; TSB = negative control, PC = positive control (P. aeruginosa PAO1).
Table 1.
List of Primers, Their Sequences and the Size of the Amplified Products, Used for Detection of Virulence Genes and Enterotoxin of Enteroaggregative Escherichia Coli Strains Isolated in This Study a
Virulence GeneProperties of TargetPrimer Sequence (5´ - 3´)Amplicon Size, bpReferences
SatSecreted autotransporter toxin geneF-TCA GAA GCT CAG CGA ATC ATT G; R-CCA TTA TCA CCA GTA AAA CGC ACC930Boisen et al. (2009) (18)
SigAClass I cytotoxic SPATE proteinF-CCG ACT TCT CAC TTT CTC CCG; R-CCA TCC AGC TGC ATA GTG TTT G430Boisen et al. (2009) (18)
PetPlasmid encoded cytotoxinF-GGC ACA GAA TAA AGG GGT GTT T; R-CCT CTT GTT TCC ACG ACA TAC302Restieri et al. (2007) (17)
PicSerine protease autotransporter toxinF-ACT GGA TCT TAA GGC TCA GGA T; R-GAC TTA ATG TCA CTG TTC AGC G572Restieri et al. (2007) (17)
SepAShigella extracellular protein AF-GCA GTG GAA ATA TGA TGC GGC; R-TTG TTC AGA TCG GAG AAG AAC G794Restieri et al. (2007) (17)
AafAAAF/II fimbrial subunitF-CAG AAT GTT TGC GAT TGC TAC; R-TTT GTC ACA AGC TCA GCA TT468Boisen et al. (2012) (18)
agg3AAAF/III subunitF-GTA TCA TTG CGA GTC TGG TAT TCA G; R-GGG CTG TTA TAG AGT AAC TTC CAG462Boisen et al. (2012) (18)
agg4AAAF/IV subunitF-TCC ATT ATG TCA GGC TGC AA; R-GGC GTT AAC GTC TGA TTT CC411Boisen et al. (2012) (18)
AggAAggregative fimbria AAF/I subunitF-TCT ATC TRG GGG GGC TAA CGC T; R-ACC TGT TCC CCA TAA CCA GAC C220Boisen et al. (2012) (18)
AstAHeat-stable enterotoxin (EAST1)F-ATG CCA TCA ACA CAG TAT AT; R-GCG AGT GAC GGC TTT GTA GT110Vila et al. (2000) (15)
AggRTranscription of AAFsF- ACGCAGAGTTGCCTGATAAAG; R-ATACAGAATCGTCAGCATCAGC308Restieri et al. (2007) (17)
pcdv432 (aatA)Transcription of AAFsF- CTGGCGAAAGACTGTATCAT; R- AAATGTATAGAAATCCGCTGTT630Boisen et al. (2012) (18)
a Abbreviations: AAF, fimbrial subunits; EAEC, enteroaggregative Escherichia coli; SPATE, serine protease autotransporter toxins.
Table 2.
Prevalence of Virulence-Related Genes in Stool Samples From Children Infected With EAEC Isolates a
EAEC, IsolatesSAPTEFimbrial GenesEnterotoxin
Class IClass-II(AAF)
petsatsigAPicsepAaggAagg3Aagg4AaggfAastA
43+++
110+
116++
147+++
166+++
188++++
300+
311+++++
316
335++
379+
383+
403++
407++
417+
428+++
434+++
436+++
437++++
438+++
450+
455+
463+++
a Abbreviations: AAF, fimbrial subunits; EAEC, enteroaggregative Escherichia coli; SPATE, serine protease autotransporter toxins.

5. Discussion

The EAEC strains are heterogeneous, both with respect to symptoms developed by infected hosts and with respect to virulence genes (24). In the present study, which was carried out for the first time in south east Iran, we demonstrated the importance of specific virulence genes in the biofilm formation of EAEC isolates. The rate of EAEC infection, in our case, was similar with reports from other parts of Iran (23, 24). Indeed, the varying presence of the different virulence factors indicates heterogeneity of the EAEC isolates. Although other studies have shown that the prevalence of pic varies between 4.6% and 57% depending on the strain (25), however, in our case, it was 56.52%. Similarly, in our study, the aafA gene was detected in only one isolate, followed by aggA, agg3A and agg4A, and may suggest that regional differences have a role in the prevalence of EAEC fimbrial adhesions. It has been reported that EAEC isolates were more likely to produce biofilm than non-diarrheagenic E. coli isolates and the production of biofilm was associated with the virulence (26). The pathogenic mechanisms of EAEC infection are only partially understood and are most consistent with mucosal colonization, followed by secretion of enterotoxins and cytotoxins. It was suggested that AggR protein may initiate a positive feedback loop that results in its own amplification, a mechanism that may partly explain the marked increase in aggR expression levels. This likely contributes to biofilm formation.
In conclusion, the results of our study, which carried out in south east Iran for the first time, clearly showed that the rate of infection by diarrhoeagenic EAEC was highest in children less than 5 years. The isolates harbored wide variety of virulence genes that help organism to attach to the intestinal epithelial cells and damage them. In addition to aggR and pCVD432, the pic, sepA and agg4A genes were more frequently involved in strong biofilm. However, the roles of these genes in the biofilm formation yet remain to be determined.

Acknowledgments

Footnotes

  • Funding/Support:This study was supported by the research council of Kerman University of Medical Sciences, Kerman, Iran (grant 4/93), provided to Dr. Shakibaie MR.

References

  • 1.
    O'Reilly CE, Jaron P, Ochieng B, Nyaguara A, Tate JE, Parsons MB, et al. Risk factors for death among children less than 5 years old hospitalized with diarrhea in rural western Kenya, 2005-2007: a cohort study. PLoS Med. 2012;9(7). eee1001256. [PubMed ID: 22802736]. https://doi.org/10.1371/journal.pmed.1001256.
  • 2.
    Lanata CF, Fischer-Walker CL, Olascoaga AC, Torres CX, Aryee MJ, Black RE, et al. Global causes of diarrheal disease mortality in children <5 years of age: a systematic review. PLoS One. 2013;8(9). eee72788. [PubMed ID: 24023773]. https://doi.org/10.1371/journal.pone.0072788.
  • 3.
    Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. [PubMed ID: 15040260]. https://doi.org/10.1038/nrmicro818.
  • 4.
    Weintraub A. Enteroaggregative Escherichia coli: epidemiology, virulence and detection. J Med Microbiol. 2007;56(Pt 1):4-8. [PubMed ID: 17172509]. https://doi.org/10.1099/jmm.0.46930-0.
  • 5.
    Estrada-Garcia T, Navarro-Garcia F. Enteroaggregative Escherichia coli pathotype: a genetically heterogeneous emerging foodborne enteropathogen. FEMS Immunol Med Microbiol. 2012;66(3):281-98. [PubMed ID: 22775224]. https://doi.org/10.1111/j.1574-695X.2012.01008.x.
  • 6.
    Estrada-García T, Cerna JF, Paheco-Gil L, Velázquez RF, Ochoa TJ, Torres J, et al. Drug-resistant DiarrheogenicEscherichia coli, Mexico. Emerg Infect Dis. 2005;11(8):1306-8. https://doi.org/10.3201/eid1108.050192.
  • 7.
    Nataro JP, Kaper JB, Robins-Browne R, Prado V, Vial P, Levine MM. Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis J. 1987;6(9):829-31. [PubMed ID: 3313248].
  • 8.
    Scavia G, Staffolani M, Fisichella S, Striano G, Colletta S, Ferri G, et al. Enteroaggregative Escherichia coli associated with a foodborne outbreak of gastroenteritis. J Med Microbiol. 2008;57(Pt 9):1141-6. [PubMed ID: 18719185]. https://doi.org/10.1099/jmm.0.2008/001362-0.
  • 9.
    Harrington SM, Dudley EG, Nataro JP. Pathogenesis of enteroaggregative Escherichia coli infection. FEMS Microbiol Lett. 2006;254(1):12-8. [PubMed ID: 16451173]. https://doi.org/10.1111/j.1574-6968.2005.00005.x.
  • 10.
    Beutin L, Hammerl JA, Reetz J, Strauch E. Shiga toxin-producing Escherichia coli strains from cattle as a source of the Stx2a bacteriophages present in enteroaggregative Escherichia coli O104:H4 strains. Int J Med Microbiol. 2013;303(8):595-602. [PubMed ID: 24012149]. https://doi.org/10.1016/j.ijmm.2013.08.001.
  • 11.
    Morabito S, Karch H, Mariani-Kurkdjian P, Schmidt H, Minelli F, Bingen E, et al. Enteroaggregative, Shiga toxin-producing Escherichia coli O111:H2 associated with an outbreak of hemolytic-uremic syndrome. J Clin Microbiol. 1998;36(3):840-2. [PubMed ID: 9508328].
  • 12.
    Hebbelstrup Jensen B, Olsen KE, Struve C, Krogfelt KA, Petersen AM. Epidemiology and clinical manifestations of enteroaggregative Escherichia coli. Clin Microbiol Rev. 2014;27(3):614-30. [PubMed ID: 24982324]. https://doi.org/10.1128/CMR.00112-13.
  • 13.
    Cerna JF, Nataro JP, Estrada-Garcia T. Multiplex PCR for detection of three plasmid-borne genes of enteroaggregative Escherichia coli strains. J Clin Microbiol. 2003;41(5):2138-40. [PubMed ID: 12734261].
  • 14.
    Kahali S, Sarkar B, Rajendran K, Khanam J, Yamasaki S, Nandy RK, et al. Virulence Characteristics and Molecular Epidemiology of Enteroaggregative Escherichia coli Isolates from Hospitalized Diarrheal Patients in Kolkata, India. J Clin Microbiol. 2004;42(9):4111-20. https://doi.org/10.1128/jcm.42.9.4111-4120.2004.
  • 15.
    Vila J, Vargas M, Henderson IR, Gascon J, Nataro JP. Enteroaggregative escherichia coli virulence factors in traveler's diarrhea strains. J Infect Dis. 2000;182(6):1780-3. [PubMed ID: 11069254]. https://doi.org/10.1086/317617.
  • 16.
    Navarro-Garcia F, Elias WP. Autotransporters and virulence of enteroaggregative E. coli. Gut Microbes. 2011;2(1):13-24. [PubMed ID: 21637014]. https://doi.org/10.4161/gmic.2.1.14933.
  • 17.
    Restieri C, Garriss G, Locas MC, Dozois CM. Autotransporter-encoding sequences are phylogenetically distributed among Escherichia coli clinical isolates and reference strains. Appl Environ Microbiol. 2007;73(5):1553-62. [PubMed ID: 17220264]. https://doi.org/10.1128/AEM.01542-06.
  • 18.
    Boisen N, Ruiz-Perez F, Scheutz F, Krogfelt KA, Nataro JP. Short report: high prevalence of serine protease autotransporter cytotoxins among strains of enteroaggregative Escherichia coli. Am J Trop Med Hyg. 2009;80(2):294-301. [PubMed ID: 19190229].
  • 19.
    Aslani MM, Alikhani MY, Zavari A, Yousefi R, Zamani AR. Characterization of enteroaggregative Escherichia coli (EAEC) clinical isolates and their antibiotic resistance pattern. Int J Infect Dis. 2011;15(2):e136-9. [PubMed ID: 21130676]. https://doi.org/10.1016/j.ijid.2010.10.002.
  • 20.
    Abbasi P, Kargar M, Doosti A, Mardaneh J, Ghorbani-Dalini S, Anvarinejad M, et al. Enteroaggregative Escherichia Coli (EAEC) in South of Iran. Int J Pediatr. 2014;2(2):32.
  • 21.
    Bouzari S, Jafari A, Azizi A, Oloomi M, Nataro JP. Short report: characterization of enteroaggregative Escherichia coli isolates from Iranian children. Am J Trop Med Hyg. 2001;65(1):13-4. [PubMed ID: 11504399].
  • 22.
    Shakibaie M, Forootanfar H, Golkari Y, Mohammadi-Khorsand T, Shakibaie MR. Anti-biofilm activity of biogenic selenium nanoparticles and selenium dioxide against clinical isolates of Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis. J Trace Elem Med Biol. 2015;29:235-41. [PubMed ID: 25175509]. https://doi.org/10.1016/j.jtemb.2014.07.020.
  • 23.
    Stepanovic S, Vukovic D, Hola V, Di Bonaventura G, Djukic S, Cirkovic I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS. 2007;115(8):891-9. [PubMed ID: 17696944]. https://doi.org/10.1111/j.1600-0463.2007.apm_630.x.
  • 24.
    Dallman TJ, Chattaway MA, Cowley LA, Doumith M, Tewolde R, Wooldridge DJ, et al. An investigation of the diversity of strains of enteroaggregative Escherichia coli isolated from cases associated with a large multi-pathogen foodborne outbreak in the UK. PLoS One. 2014;9(5). eee98103. [PubMed ID: 24844597]. https://doi.org/10.1371/journal.pone.0098103.
  • 25.
    Eslava C, Navarro-Garcia F, Czeczulin JR, Henderson IR, Cravioto A, Nataro JP. Pet, an autotransporter enterotoxin from enteroaggregative Escherichia coli. Infect Immun. 1998;66(7):3155-63. [PubMed ID: 9632580].
  • 26.
    Modarresi F, Azizi O, Shakibaie MR, Motamedifar M, Mosadegh E, Mansouri S. Iron limitation enhances acyl homoserine lactone (AHL) production and biofilm formation in clinical isolates of Acinetobacter baumannii. Virulence. 2015;6(2):152-61. [PubMed ID: 25622119]. https://doi.org/10.1080/21505594.2014.1003001.

Copyright

Copyright © 2015, Pediartric Infections Research Center. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

8
Sep
2015

Phenotypic and Genotypic Characterization of Enteroaggregative Escherichia coli Strains Isolated From Diarrheic Children in Iran

Abolfazl Davoodabadi,
Maryam Abbaszadeh,
Mana Oloomi,
Saeid Bouzari

Davoodabadi A, Abbaszadeh M, Oloomi M, Bouzari S. Phenotypic and Genotypic Characterization of Enteroaggregative Escherichia coli Strains Isolated From Diarrheic Children in Iran. Jundishapur J Microbiol. 2015;8(9):e22295. doi: https://doi.org/10.5812/jjm.22295

12
Mar
2018
Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran

Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran

Mohammad Mehdi Soltan-Dallal,
Mohsen Karami-Talab,
Maneli Aminshahidi,
Amir Arastehfar,
Fereshteh Fani

Soltan-Dallal MM, Karami-Talab M, Aminshahidi M, Arastehfar A, Fani F. Antimicrobial Susceptibility Patterns of Enteroaggregative E. coli, as the Most Common Diarrheagenic E. coli, Associated to Gastroenteritis Outbreaks in Iran. Arch Pediatr Infect Dis. 2018;6(2):e11917. doi: https://doi.org/10.5812/pedinfect.11917

28
Sep
2020
Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran

Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran

Mehrandokht Sirous,
Mohammad Hashemzadeh,
Maryam Keshtvarz,
Mansour Amin,
Nasim Shams,
Maryam Dastoorpoor
,et al.

Sirous M, Hashemzadeh M, Keshtvarz M, Amin M, Shams N, et al. Molecular Characterization and Antimicrobial Resistance of Enteropathogenic Escherichia coli in Children from Ahvaz, Iran. Jundishapur J Microbiol. 2020;13(7):e100877. doi: https://doi.org/10.5812/jjm.100877

2
Dec
2017

Characterization of Toxins and Colonization Factors of Enterotoxigenic Escherichia coli Isolates from Children with Acute Diarrhea in Abuja, Nigeria

Casmir Ifeanyichukwu Cajetan Ifeanyi,
Nkiruka Florence Ikeneche,
Bassey Enya Bassey,
Nazek Al-Gallas,
Akpa Alexander Casmir,
Isu Rosemary Nnennaya

Ifeanyichukwu Cajetan Ifeanyi C, Ikeneche NF, Bassey BE, Al-Gallas N, Alexander Casmir A, et al. Characterization of Toxins and Colonization Factors of Enterotoxigenic Escherichia coli Isolates from Children with Acute Diarrhea in Abuja, Nigeria. Jundishapur J Microbiol. 2018;11(1):e64269. doi: https://doi.org/10.5812/jjm.64269

17
Dec
2024
The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran

The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran

Saba Farhadinia,
Shahin Najarpiraye,
Bita Bakhshi

Farhadinia S, Najarpiraye S, Bakhshi B. The Prevalence of Typical and Atypical Enteropathogenic Escherichia coli Strains Isolated from Non-diarrheal Stool Samples of Children of Tehran. Jundishapur J Microbiol. 2024;17(12):e151793. doi: https://doi.org/10.5812/jjm-151793

More by these authors

Razieh NezariehPubMedScholar
Mohammad Reza ShakibaiePubMedScholar
Hossein Hosseini NavePubMedScholar
Amin NorouziPubMedScholar
Gholamabas SalajeghehPubMedScholar
Mehdi HayatbakhshPubMedScholar
Share
Cited by
Metrics