Strain Typing and Molecular Characterization of CTX-M-1 Group ESBL in Clinical Klebsiella pneumoniae Isolated from Children

Authors

Shahin Najar Peerayeh1, Safoura Derakhshan2,*, Fatemeh Fallah3, Bita Bakhshi1
1Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, IR Iran
2Department of Microbiology, Faculty of Medicine, Kurdistan University of Medical Sciences, Sanandaj, IR Iran
3Pediatric Infections Research Center, Mofid Children’s Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
*Corresponding Author: Corresponding author: Safoura Derakhshan, Department of Microbiology, Faculty of Medicine, Kurdistan University of Medical Sciences, Sanandaj, IR Iran. Tel: +98-9379299258, E-mail: Email: [email protected]

Archives of Pediatric Infectious Diseases:Vol. 5, issue 2; e39193
Published online:Sep 05, 2016
Article type:Research Article
Received:May 14, 2016
Accepted:Aug 20, 2016
How to Cite:Najar Peerayeh S, Derakhshan S, Fallah F, Bakhshi B. Strain Typing and Molecular Characterization of CTX-M-1 Group ESBL in Clinical Klebsiella pneumoniae Isolated from Children. Arch Pediatr Infect Dis. 2017;5(2):e39193. doi: https://doi.org/10.5812/pedinfect.39193

Abstract

Background:

Extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae is rapidly spreading worldwide, creating serious problems in clinical settings.

Objectives:

The aim of this study was to describe the molecular and epidemiological characteristics of CTX-M-1 group ESBL-producing K. pneumoniae.

Methods:

Seventeen CTX-M-1 group ESBL-producing K. pneumoniae isolates found among 31 K. pneumoniae isolates in samples collected from three hospitals in Tehran, Iran between May and December 2011 were included in the present study for further characterization and determination of clonal relationships. The genetic environment of blaCTX-M-1 was analyzed by polymerase chain reaction (PCR) mapping and sequencing, and the transferability of blaCTX-M-1 was evaluated through the use of a conjugation assay. PCR-based replicon typing (PBRT) was used to identify plasmid replicons. The isolates were typed using pulsed-field gel electrophoresis (PFGE).

Results:

All 17 isolates carried the blaCTX-M-15 gene. IncL/M was the most common replicon type (82.3%). The conjugation experiment showed that blaCTX-M-15 was carried on transferable plasmids. In all of the studied isolates, the mobile element ISEcp1 was found upstream and orf477 downstream of blaCTX-M-15, whereas IS26 was not found. PFGE identified 11 different profiles and one major clone.

Conclusions:

The findings of this study suggest that among the K. pneumoniae strains isolated from samples of children, dissemination of the blaCTX-M-15 gene is due to clonal spread and to the dissemination of mobile genetic elements bearing blaCTX-M-15, such as ISEcp1. Genotyping of K. pneumoniae is indispensable for monitoring the spread of ESBL-producing strains, for initiating the implementation of suitable infection control measures, and for general epidemiology purposes.

1. Background

Extended-spectrum β-lactamases (ESBLs) are plasmid-mediated enzymes in bacteria that cause resistance to a wide range of β-lactam antibiotics. The CTX-M family has become the most prevalent type of ESBL worldwide, and has been detected mainly in Escherichia coli and Klebsiella species (1). CTX-M β-lactamases have been clustered into six groups based on their amino acid sequence similarities: CTX-M-1, -2, -8, -9, -25, and -45 (2). These enzymes hydrolyze cefotaxime better than ceftazidime, although CTX-M-15 (belonging to group 1) has been reported to have good activity against ceftazidime (3). Rapid emergence and dissemination of the CTX-M-15 enzyme has been widely reported, and it is currently the most widely distributed ESBL genotype in most parts of the world (4-6).
Large nosocomial outbreaks caused by CTX-M-producing Klebsiella pneumoniae have been reported worldwide (7, 8). Intensive use of extended-spectrum cephalosporins and cross- transmission have been associated with the emergence and dissemination of ESBL-producing K. pneumoniae (1). The ESBL genes responsible for resistance are mainly carried on mobile genetic elements, which can readily spread among bacteria (9). Class 1 integrons and transferable elements like conjugative plasmids or insertion sequences (IS) (e.g., ISEcp1) play an important role in the dissemination of antimicrobial resistance genes between species or genera (10). It has been reported that blaCTX-M genes are carried on the plasmids ranging from 7 to 430 kb, mainly on large transmissible plasmids (11). Due to the role of plasmids in the horizontal transfer of antimicrobial resistance genes, much attention has been paid to the identification and classification of bacterial plasmids. Carattoli et al. demonstrated a polymerase chain reaction (PCR)-based replicon typing (PBRT) scheme to detect 18 plasmid replicons commonly found among the Enterobacteriaceae (12). The blaCTX-M types have been shown to be associated with specific plasmid replicons, for example, blaCTX-M-9 to replicon HI2, blaCTX-M-15 to replicons FII, FIA, and FIB, and blaCTX-M-3 to replicon N. In addition, different genetic elements have been shown to be involved in the mobilization of blaCTX-M, such as insertion sequence ISEcp1, which is also responsible for the expression of genes encoding β-lactamase (11). The epidemiology of CTX-M-producing strains is complex, involving the dissemination of strains and the dissemination of mobile genetic elements bearing blaCTX-M genes. Outbreaks of clonal strains have been reported worldwide (2, 8). Genotypic methods are required to demonstrate clonal dissemination between K. pneumoniae isolates. Pulsed-field gel electrophoresis (PFGE) is the current gold standard method for bacterial typing (13).

2. Objectives

In our previous study, we investigated the prevalence of the blaCTX-M-1 group in 31 clinical K. pneumoniae isolates from samples of children between May and December 2011. Our results showed the presence of the blaCTX-M-1 group in 17 of the isolates (14). The present study was designed to characterize these 17 CTX-M-1 group-producing K. pneumoniae isolates and to investigate the epidemiological relationship between them using PFGE.

3. Methods

3.1. Bacterial Isolates

In our previous cross-sectional study (14), 31 K. pneumoniae isolates were identified from samples of children aged 0 - 12 years admitted to three hospitals in Tehran (Loghman-e-Hakim in the southwest, Imam Khomeini in the central region, and Milad in the northwest) between May and December 2011. Antibiotic susceptibility of the isolates was determined using the disk diffusion method. The presence of the blaCTX-M-1 group and class 1, 2, and 3 integrons was investigated through the use of PCR. The results showed a high level of antibiotic resistance among the isolates: 17 isolates were simultaneously resistant to amoxicillin-clavulanic acid, cefotaxime, ceftriaxone, aztreonam, and ceftazidime. All were susceptible to imipenem. Class 1 integron was detected in 8 isolates, whereas classes 2 and 3 were not detected. The blaCTX-M-1 group was detected in 17 isolates. These 17 CTX-M-1 group-producing K. pneumoniae isolates were included in the present study for further characterization and determination of clonal relationships.

3.2. Characterization of the Genetic Support of the blaCTX-M-1 Group

The genetic environment surrounding the blaCTX-M-1 group was investigated by PCR mapping and sequencing of the amplicons (15). Specific primers for the insertion sequences ISEcp1 and IS26 (located upstream of blaCTX-M-1) and for the open reading frame orf477 (located downstream) were combined with blaCTX-M-1-specific primers (Table 1). Amplicons were then sequenced and their sequence similarity to other genes was searched using the basic local alignment search tool (BLAST) program.
Table 1.
Sequence of Primers Used to Detect the blaCTX-M-1 Group and its Genetic Environment
TargetPrimer NamePrimer Sequence (5′ - 3′)Amplification ConditionsReference
blaCTX-M-1 groupM1FGGTTAAAAAATCACTGCGTC1 cycle of 5 minutes at 94°C; 35 cycles of 1 minute at 94°C, 1 min at 54°C, 1 minute at 72°C; 1 cycle of 7 minutes at 72°C(14)
M1RTTGGTGACGATTTTAGCCGC
ISEcp1ISEcp1U1AAAAATGATTGAAAGGTGGT1 cycle of 5 minutes at 94°C; 35 cycles of 1 minute at 94°C, 1 minute at 52°C, 1 minute at 72°C; 1 cycle of 7 minutes at 72°C(15)
IS26tnpA IS26AGCGGTAAATCGTGGAGTGA1 cycle of 5 minutes at 94°C; 35 cycles of 1 minute at 94°C, 1 minute at 58°C, 90s at 72°C; 1 cycle of 7 minutes at 72°C(16)
Orf477ORF477RCCAGGAACCACGGAGCTTAT1 cycle of 5 minutes at 94°C; 35 cycles of 1 minute at 94°C, 1 minute at 54°C, 1 minute at 72°C; 1 cycle of 7 minute at 72°CThe present study

3.3. Plasmid Characterization

Plasmids were classified according to incompatibility groups by PCR using a previously described PBRT method (12). PBRT (five multiplex- and three simplex-PCRs) was carried out on total DNA using 18 primer pairs that recognize FIA, FIB, FII, FIC, Frep, HI1, HI2, I1, P, A/C, X, L/M, N, T, K, Y, B/O, and W replicons, which are the major plasmid incompatibility groups circulating among the Enterobacteriaceae (12). Positive controls were provided by Dr. Carattoli (Istituto Superiore di Sanita, Italy). The PCR conditions used were as follows: 5 minutes at 94°C; followed by 35 cycles of 1 minute at 94°C, 30 seconds at 60°C, and 1 minute at 72°C; and a final extension of 7 minutes at 72°C.

3.4. Conjugation and PCR Amplification of the blaCTX-M-1 Group From Transconjugants

To determine whether the blaCTX-M-1 group gene was carried on a conjugative plasmid, conjugation experiments were carried out using a broth-mating assay (17) with K. pneumoniae strains as donors and rifampicin-resistant E. coli A15R- (provided by Dr. Bedenic, Croatia) as the recipient strain. Cultures of recipient and donor strains grown in Luria-Bertani broth (Scharlau, Spain) were combined in a ratio of 1: 10 (donor to recipient) and incubated at 37°C for 16 hours. Samples (0.1 mL) of this mixture were spread onto the surfaces of Mueller-Hinton agar plates containing 300 µg/mL rifampicin (for the inhibition of donor strain growth) plus 3 µg/mL cefotaxime (to prevent the growth of E. coli recipients lacking blaCTX-M-1). Samples from donor and recipient strain were used as controls. The transconjugants growing on the selection plates were examined for acquisition of the blaCTX-M-1 group gene using PCR (Table 1).

3.5. Molecular Strain Typing

PFGE of XbaI-digested genomic DNA was performed according to the pulse net protocol from the centers for disease control and prevention (Atlanta, USA) (18) with minor modifications. Agarose plugs were digested with 10 U of restriction endonuclease XbaI (Jena Bioscience, Germany) at 37°C for 6 hours. Electrophoresis was performed on a 1% low melting agarose gel (Sigma, USA) using a CHEF-DR II apparatus (Bio-Rad, USA) under the following conditions: initial pulse time for 2.2 seconds and final time for 54.2 seconds at 6 V for 20 hours.
Banding patterns were compared using Gelcompar II software, version 4.0 (Applied Maths, Belgium). Salmonella Braenderup H9812 was used as the reference strain. A dendrogram was generated using the band-based Dice similarity coefficient and the unweighted pair group method with arithmetic mean (UPGMA). Clusters were created with a 1.5% band tolerance. The discriminatory power of the PFGE was assessed using Simpson's diversity index (19) via a free online tool, Comparing Partitions, available at http://Darwin.phyloviz.net/ComparingPartitions.

4. Results

4.1. Characterization of the blaCTX-M-1 Group Gene

Sequence analysis identified all blaCTX-M-1 group genes as blaCTX-M-15. The GenBank accession number for the blaCTX-M-15 gene is KC131462. PCR amplification using the specific primers reported in Table 1 indicated the presence of the insertion sequence ISEcp1 upstream of the blaCTX-M-15 gene in all the strains and the promoter region (-10 and -35) associated with this element. A 48-bp region was found between the right inverted repeat of ISEcp1 and the start codon of the blaCTX-M-15 gene. The orf477 gene was detected downstream of the blaCTX-M-15 gene in all strains, whereas IS26 was not found.

4.2. Plasmid Analysis

A total of eight different replicons, dominated by L/M, were detected in all isolates using PBRT (Table 2). Of the 17 strains tested, one strain was devoid of any replicons. Of the 18 replicons, 10 were not found, including the I1, HI2, X, FIA, FIB, W, A/C, P, Y, and T replicons. The IncL/M replicon was the most commonly detected replicon type (14/17 isolates, 82.3%), followed by HI1, FIC (4/17, each), IncK, FIIs (3/17, each), IncB/O (2/17), and Frep, N (1/17, each). In total, 8 of the 17 isolates (47%) contained multiple replicons. L/M + FIC were the most frequently recognized replicons in combination (4/17, 23.5%). The results of the conjugation experiment showed that blaCTX-M-15 was carried on conjugative plasmids in all of the K. pneumoniae strains. The PCR analysis performed on the transconjugants revealed the acquisition of the blaCTX-M-15 gene.
Table 2.
Antimicrobial Resistance Patterns and Plasmid Replicons of the 17 CTX-M-15-Producing K. pneumoniae Isolates
PulsotypesNumber of Isolate (s)Replicon TypesAntimicrobial ResistanceaClass 1 Integronb
P461L/MCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK-
1+
1HI1, L/M-
3L/M-
P541L/M, FIC, Frep, FIIsCTX, CRO, CAZ, AUG, ATM, TN, TS, GM, CPM, AK+
P501L/MCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK+
P51HI1, L/M, FICCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK-
P491L/MCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK-
P471HI1CTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK-
P431HI1, NCTX, CRO, CAZ, AUG, ATM, T, TS, CPM, FOX+
P371L/M, B/OCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK-
P21L/M, FIC, B/O, K, FIIsCTX, CRO, CAZ, AUG, ATM, TN, T, GM, CPM, AK+
P141NTCTX, CRO, CAZ, AUG, ATM, TN, CPM, AK+
1L/M,KCTX, CRO, CAZ, AUG, ATM, TN, AK+
P11L/M,FIC,K,FIIsCTX, CRO, CAZ, AUG, ATM, TN, GM, CPM, AK+
Abbreviations: ATM, aztreonam; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; CPM, cefepime; FOX, cefoxitin; AUG, amoxicillin-clavulanic acid; T, tetracycline; TS, trimethoprim-sulphamethoxazole; TN, tobramycin; GM, gentamicin; AK, amikacin.
aThe resistance profiles excluded antimicrobial agents that exhibited intermediate resistance.
b+, positive; -, negative.

4.3. Molecular Typing of Isolates by PFGE

The PFGE analysis of the 17 blaCTX-M-15 positive isolates, identified 11 distinct PFGE profiles (pulsotypes). P46 was the most commonly found pulsotype [6/17, 35.2% of isolates]. Figure 1 shows the clustering of PFGE data. One major cluster (cluster I) was identified among the PFGE types. This cluster was composed of 11 isolates collected from hospitals A (Loghman) and B (Milad), and 6 pulsotypes were detected in the cluster (P43, P46, P47, P49, P50, and P54). Seven isolates from this cluster were found in samples collected from the neonatal intensive care unit (NICU), 3 isolates in samples from the Pediatric ward, and 1 isolate in samples from the Neonatal unit. Similar PFGE patterns (similarity above 80%) were observed among isolates in samples from the NICU and neonatal ward. One major clone (isolates with indistinguishable PFGE profiles) that was composed of 6 isolates (clone A) was identified in samples from the NICU and neonatal ward of hospital B (Milad). The discriminatory power of PFGE (Simpson's diversity index) was 0.882 with a 95% confidence interval (0.750 - 1.000).
Abbreviations: NICU, neonatal intensive care unit; Hos, Hospital. A, Loghman-e-Hakim; B, Milad; C, Imam Khomeini.
Figure 1.
Abbreviations: NICU, neonatal intensive care unit; Hos, Hospital. A, Loghman-e-Hakim; B, Milad; C, Imam Khomeini.
The antibiotic resistance, presence of class 1 integron, and replicon content of each pulsotype are presented in Table 2. As shown, most isolates with the same PFGE type had similar antimicrobial resistance profiles. For example, six isolates with pulsotype P46 showed the same resistance profile.

5. Discussion

This study was conducted to characterize the 17 CTX-M-1 group ESBL-producing K. pneumoniae strains isolated in our previous study (14). Thirty-one K. pneumoniae isolates were identified in samples collected from children aged 0 - 12 years admitted to three hospitals in Tehran between May and December 2011. The blaCTX-M-1 group was detected in 17 isolates (14). These 17 CTX-M-1 group-producing isolates were included in the present study for further characterization and determination of clonal relationships.
All of the CTX-M-1 group-producing K. pneumoniae harbored ESBL of CTX-M-15. The blaCTX-M-15 gene, first described in 2001 (20), is the most common ESBL reported in the world (4, 21, 22), including Iran. Reports have shown that this resistance gene is highly circulating in Tehran and the rest of Iran (6, 23-25). Among the ESBL-producing strains, the prevalence of blaCTX-M-15 reported in different studies in Iran varies from 62.6%, as reported by Feizabadi et al., (23) to 92.8%, as described by Alizadeh et al. (25). In several countries, such as Lebanon, India, France, Spain, the UK, Latin America, and the African countries, CTX-M-15 is now one of the most common CTX-M β-lactamases (5).
In order to comprehend how CTX-M-15 is disseminated, we performed a population analysis and gene characterization. XbaI-PFGE typing was performed in order to conduct the population analyses. Typing of isolates via PFGE grouped most of the isolates into one major cluster (Figure 1). Interestingly, this cluster was detected in two hospitals located more than 10 km away from each other. It would be worth investigating the possibility of a common source of infection, such as drinking water or food products, between the two hospitals and the possibility of inter- hospital transfer of patients. A major clone (clone A) was identified in the NICU and neonatal unit of hospital B (Milad). One possible explanation is patient-to-patient transmission between wards and the introduction of the clone into other wards through patient transfer. All the strains in this clone were simultaneously resistant to cefotaxime, ceftazidime, ceftriaxone, amoxicillin-clavulanic acid, aztreonam, tobramycin, gentamicin, cefepime, and amikacin. Antibiotic therapy with a carbapenem could be useful to control the infection. A multicountry study reported that carbapenems are the treatment of choice for infections caused by ESBL-producing K. pneumoniae (26). Co-resistance to several antimicrobial agents has often been described for CTX-M-producing isolates (27, 28). These arrays of resistance genes confer a multidrug resistance phenotype that can be transferred horizontally (28). Integrons are mobile genetic elements that can be located either on a chromo-some or a plasmid and can integrate antibiotic resistance genes. Eight of our 17 K. pneumoniae strains harbored class 1 integron, as previously described (14). The blaCTX-M-15 gene has been shown to be linked to mobile genetic elements such as insertion sequence ISEcp1 (2). We found ISEcp1 upstream of the blaCTX-M-15 gene in all strains. This insertion sequence is also able to provide promoter sequences enhancing the expression of the blaCTX-M gene (2). Another insertion sequence, IS26, was not found. The absence of amplification of the IS26-blaCTX-M-15 region in our studied strains might be due to the presence of a truncated IS26 sequence, as reported by Saladin et al. (15). In all the strains, the orf477 sequence was found downstream of the blaCTX-M-15 gene. A similar organization has been frequently found for blaCTX-M-15 in many studies (16, 29). Abbassi et al. reported the presence of ISEcp1 upstream and orf477 downstream of blaCTX-M-15 in K. pneumoniae isolates (2). Tayh et al. also found ISEcp1 and orf477 in the flanking sequences of blaCTX-M-15 in 16 broad-spectrum cephalosporin-resistant K. pneumoniae isolates collected between April and June 2013 from Palestinian hospitals in the Gaza Strip (30).
The conjugation studies revealed the transfer of plasmids carrying blaCTX-M-15 in all isolates. A high prevalence of the L/M plasmid replicon was seen in our strain collection (82.3%), although this replicon has been considered rare in CTX-M-15-expressing strains (31). Most studies have reported a dominance of IncF plasmid replicons in blaCTX-M-15-producing strains (11, 31-33). Due to several limitations, we were unable to determine the precise location of the blaCTX-M-15 gene and it was not clear which replicon type harbored this gene. The plasmids containing replicon L/M found in most of our strains may harbor the blaCTX-M-15 gene, although this point needs to be investigated further.
In conclusion, our results show that CTX-M-15 is the dominant CTX-M ESBL in our strain collection from children’s samples. We hypothesize that the clonal spread and genetic transit of mobile elements, such as ISEcp1, between unrelated strains are responsible for the dissemination of CTX-M-15 and support long term persistence in colonized hosts. Therefore, proper use of antibiotics with emphasis on the sensible prescription of antibiotics and suitable infection control measures are necessary to control the further spread of CTX-M-15-producing strains of K. pneumoniae.

Acknowledgments

Footnotes

  • Authors’ Contribution:Shahin Najar Peerayeh designed the search; Safoura Derakhshan performed the microbiological and molecular studies; Fatemeh Fallah and Bita Bakhshi advised the search. All authors approved the final manuscript.

  • Financial Disclosure:There is no financial interest related to the material in this manuscript.

  • Funding/Support:This study was funded through a grant from Tarbiat Modares University, faculty of medical sciences, Tehran, Iran, and the pediatric infections research center, Tehran, Iran.

References

  • 1.
    Manzur A, Tubau F, Pujol M, Calatayud L, Dominguez MA, Pena C, et al. Nosocomial outbreak due to extended-spectrum-beta-lactamase- producing Enterobacter cloacae in a cardiothoracic intensive care unit. J Clin Microbiol. 2007;45(8):2365-9. [PubMed ID: 17581932]. https://doi.org/10.1128/JCM.02546-06.
  • 2.
    Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D, et al. Genetic characterisation of CTX-M-15-producing Klebsiella pneumoniae and Escherichia coli strains isolated from stem cell transplant patients in Tunisia. Int J Antimicrob Agents. 2008;32(4):308-14. [PubMed ID: 18620848]. https://doi.org/10.1016/j.ijantimicag.2008.04.009.
  • 3.
    Poirel L, Gniadkowski M, Nordmann P. Biochemical analysis of the ceftazidime-hydrolysing extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3. J Antimicrob Chemother. 2002;50(6):1031-4. [PubMed ID: 12461028].
  • 4.
    Lee MY, Ko KS, Kang CI, Chung DR, Peck KR, Song JH. High prevalence of CTX-M-15-producing Klebsiella pneumoniae isolates in Asian countries: diverse clones and clonal dissemination. Int J Antimicrob Agents. 2011;38(2):160-3. [PubMed ID: 21605960]. https://doi.org/10.1016/j.ijantimicag.2011.03.020.
  • 5.
    Iroha IR, Esimone CO, Neumann S, Marlinghaus L, Korte M, Szabados F, et al. First description of Escherichia coli producing CTX-M-15- extended spectrum beta lactamase (ESBL) in out-patients from south eastern Nigeria. Ann Clin Microbiol Antimicrob. 2012;11:19. [PubMed ID: 22824236]. https://doi.org/10.1186/1476-0711-11-19.
  • 6.
    Peerayeh SN, Rostami E, Siadat SD, Derakhshan S. High rate of aminoglycoside resistance in CTX-M-15 producing Klebsiella pneumoniae isolates in Tehran, Iran. Lab Med. 2014;45(3):231-7. [PubMed ID: 25051075]. https://doi.org/10.1309/LMDQQW246NYAHHAD.
  • 7.
    Hernandez JR, Martinez-Martinez L, Canton R, Coque TM, Pascual A, Spanish Group for Nosocomial I. Nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum beta-lactamases in Spain. Antimicrob Agents Chemother. 2005;49(5):2122-5. [PubMed ID: 15855544]. https://doi.org/10.1128/AAC.49.5.2122-2125.2005.
  • 8.
    Pena C, Pujol M, Ardanuy C, Ricart A, Pallares R, Linares J, et al. An outbreak of hospital-acquired Klebsiella pneumoniae bacteraemia, including strains producing extended-spectrum beta-lactamase. J Hosp Infect. 2001;47(1):53-9. [PubMed ID: 11161899]. https://doi.org/10.1053/jhin.2000.0862.
  • 9.
    Mshana SE, Hain T, Domann E, Lyamuya EF, Chakraborty T, Imirzalioglu C. Predominance of Klebsiella pneumoniae ST14 carrying CTX-M-15 causing neonatal sepsis in Tanzania. BMC Infect Dis. 2013;13:466. [PubMed ID: 24099282]. https://doi.org/10.1186/1471-2334-13-466.
  • 10.
    Vo AT, van Duijkeren E, Gaastra W, Fluit AC. Antimicrobial resistance, class 1 integrons, and genomic island 1 in Salmonella isolates from Vietnam. PLoS One. 2010;5(2):9440. [PubMed ID: 20195474]. https://doi.org/10.1371/journal.pone.0009440.
  • 11.
    Naseer U, Haldorsen B, Tofteland S, Hegstad K, Scheutz F, Simonsen GS, et al. Molecular characterization of CTX-M-15-producing clinical isolates of Escherichia coli reveals the spread of multidrug-resistant ST131 (O25:H4) and ST964 (O102:H6) strains in Norway. APMIS. 2009;117(7):526-36. [PubMed ID: 19594493]. https://doi.org/10.1111/j.1600-0463.2009.02465.x.
  • 12.
    Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63(3):219-28. [PubMed ID: 15935499]. https://doi.org/10.1016/j.mimet.2005.03.018.
  • 13.
    Sekse C, Sunde M, Lindstedt BA, Hopp P, Bruheim T, Cudjoe KS, et al. Potentially human-pathogenic Escherichia coli O26 in Norwegian sheep flocks. Appl Environ Microbiol. 2011;77(14):4949-58. [PubMed ID: 21642413]. https://doi.org/10.1128/AEM.00189-11.
  • 14.
    Derakhshan S, Peerayeh SN, Fallah F, Bakhshi B, Rahbar M, Ashrafi A. Detection of class 1, 2, and 3 integrons among Klebsiella pneumoniae isolated from children in Tehran hospitals. Arch Pediatr Infect Dis. 2013;1(4):164-8.
  • 15.
    Saladin M, Cao VT, Lambert T, Donay JL, Herrmann JL, Ould-Hocine Z, et al. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett. 2002;209(2):161-8. [PubMed ID: 12007800].
  • 16.
    Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2006;57(1):14-23. [PubMed ID: 16291869]. https://doi.org/10.1093/jac/dki398.
  • 17.
    Park YJ, Park SY, Oh EJ, Park JJ, Lee KY, Woo GJ, et al. Occurrence of extended-spectrum beta-lactamases among chromosomal AmpC-producing Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens in Korea and investigation of screening criteria. Diagn Microbiol Infect Dis. 2005;51(4):265-9. [PubMed ID: 15808318]. https://doi.org/10.1016/j.diagmicrobio.2004.11.009.
  • 18.
    Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, et al. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis. 2006;3(1):59-67. [PubMed ID: 16602980]. https://doi.org/10.1089/fpd.2006.3.59.
  • 19.
    Elberse KE, Nunes S, Sa-Leao R, van der Heide HG, Schouls LM. Multiple-locus variable number tandem repeat analysis for Streptococcus pneumoniae: comparison with PFGE and MLST. PLoS One. 2011;6(5):19668. [PubMed ID: 21637335]. https://doi.org/10.1371/journal.pone.0019668.
  • 20.
    Karim A, Poirel L, Nagarajan S, Nordmann P. Plasmid-mediated extended-spectrum beta-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett. 2001;201(2):237-41. [PubMed ID: 11470367].
  • 21.
    Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, Canica MM, et al. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61(2):273-81. [PubMed ID: 18077311]. https://doi.org/10.1093/jac/dkm464.
  • 22.
    Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, et al. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg Infect Dis. 2008;14(2):195-200. [PubMed ID: 18258110]. https://doi.org/10.3201/eid1402.070350.
  • 23.
    Feizabadi MM, Mahamadi-Yeganeh S, Mirsalehian A, Mirafshar SM, Mahboobi M, Nili F, et al. Genetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010;4(10):609-15. [PubMed ID: 21045352].
  • 24.
    Peymani A, Farivar TN, Sanikhani R, Javadi A, Najafipour R. Emergence of TEM, SHV, and CTX-M-extended spectrum beta-lactamases and class 1 integron among Enterobacter cloacae isolates collected from hospitals of Tehran and Qazvin, Iran. Microb Drug Resist. 2014;20(5):424-30. [PubMed ID: 24684320]. https://doi.org/10.1089/mdr.2013.0191.
  • 25.
    Alizade H, Fallah F, Ghanbarpour R, Aflatoonian MR, Goudarzi H, Sharifi H. Phylogenetic groups, extended-spectrum beta-lactamases and metallo-beta-lactamase in Escherichia coli isolated from fecal samples of patients with diarrhea in Iran. Gastroenterol Hepatol Bed Bench. 2015;8(3):207-14. [PubMed ID: 26328043].
  • 26.
    Bagattini M, Crivaro V, Di Popolo A, Gentile F, Scarcella A, Triassi M, et al. Molecular epidemiology of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit. J Antimicrob Chemother. 2006;57(5):979-82. [PubMed ID: 16531430]. https://doi.org/10.1093/jac/dkl077.
  • 27.
    Machado E, Coque TM, Canton R, Baquero F, Sousa JC, Peixe L, et al. Dissemination in Portugal of CTX-M-15-, OXA-1-, and TEM-1-producing Enterobacteriaceae strains containing the aac(6')-Ib-cr gene, which encodes an aminoglycoside- and fluoroquinolone-modifying enzyme. Antimicrob Agents Chemother. 2006;50(9):3220-1. [PubMed ID: 16940136]. https://doi.org/10.1128/AAC.00473-06.
  • 28.
    Habeeb MA, Haque A, Iversen A, Giske CG. Occurrence of virulence genes, 16S rRNA methylases, and plasmid-mediated quinolone resistance genes in CTX-M-producing Escherichia coli from Pakistan. Eur J Clin Microbiol Infect Dis. 2014;33(3):399-409. [PubMed ID: 24036893]. https://doi.org/10.1007/s10096-013-1970-1.
  • 29.
    Jouini A, Vinue L, Slama KB, Saenz Y, Klibi N, Hammami S, et al. Characterization of CTX-M and SHV extended-spectrum beta-lactamases and associated resistance genes in Escherichia coli strains of food samples in Tunisia. J Antimicrob Chemother. 2007;60(5):1137-41. [PubMed ID: 17855726]. https://doi.org/10.1093/jac/dkm316.
  • 30.
    Tayh G, Ben Sallem R, Ben Yahia H, Gharsa H, Klibi N, Boudabous A, et al. First Report of Extended-Spectrum beta-Lactamases Among Clinical Isolates of Klebsiella pneumoniae in Gaza Strip, Palestine. Microb Drug Resist. 2016. [PubMed ID: 27294803]. https://doi.org/10.1089/mdr.2016.0089.
  • 31.
    Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53(6):2227-38. [PubMed ID: 19307361]. https://doi.org/10.1128/AAC.01707-08.
  • 32.
    Kamatchi C, Sumathi G, Vaidyanathan R. A pilot study on replicon typing of plasmids associated with ESBL genes in Klebsiella pneumoniae from Chennai. Advances BioTech. 2011;11:5-10.
  • 33.
    Agyekum A, Fajardo-Lubian A, Ansong D, Partridge SR, Agbenyega T, Iredell JR. blaCTX-M-15 carried by IncF-type plasmids is the dominant ESBL gene in Escherichia coli and Klebsiella pneumoniae at a hospital in Ghana. Diagn Microbiol Infect Dis. 2016;84(4):328-33. [PubMed ID: 26830052]. https://doi.org/10.1016/j.diagmicrobio.2015.12.010.

Copyright

Copyright © 2016, Pediartric Infections Research Center. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

6
Aug
2016

Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Strains Isolated from Children with Urinary Tract Infections

Reza Ranjbar,
Hamed Memariani,
Rahim Sorouri

Ranjbar R, Memariani H, Sorouri R. Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Strains Isolated from Children with Urinary Tract Infections. Arch Pediatr Infect Dis. 2017;5(2):e39000. doi: https://doi.org/10.5812/pedinfect.39000

26
Oct
2015

Characterization of CTX-M-Type Extend-Spectrum β-Lactamase Producing Klebsiella spp. in Kashan, Iran

Hasan Afzali,
Farzaneh Firoozeh,
Atena Amiri,
Rezvan Moniri,
Mohammad Zibaei

Afzali H, Firoozeh F, Amiri A, Moniri R, Zibaei M. Characterization of CTX-M-Type Extend-Spectrum β-Lactamase Producing Klebsiella spp. in Kashan, Iran. Jundishapur J Microbiol. 2015;8(10):e59917. doi: https://doi.org/10.5812/jjm.27967

7
Jul
2018
Diversity Determination of CTX-M1 Producing Klebsiella pneumoniae Using Multilocus Variable-Number Tandem Repeat Analysis, Semnan, Iran

Diversity Determination of CTX-M1 Producing Klebsiella pneumoniae Using Multilocus Variable-Number Tandem Repeat Analysis, Semnan, Iran

Shiva Mirkalantari,
Ali Jazayeri Moghadas

Mirkalantari S, Jazayeri Moghadas A. Diversity Determination of CTX-M1 Producing Klebsiella pneumoniae Using Multilocus Variable-Number Tandem Repeat Analysis, Semnan, Iran. Jundishapur J Microbiol. 2018;11(7):e63131. doi: https://doi.org/10.5812/jjm.63131

10
Sep
2013

High Prevalence of blaCTX-M-1 Group Extended-Spectrum β-lactamase Genes in Escherichia coli Isolates From Tehran

Shahin Najar Peerayeh,
Majid Eslami,
Mojtaba Memariani,
Seyed Davar Siadat

Najar Peerayeh S, Eslami M, Memariani M, Siadat SD. High Prevalence of blaCTX-M-1 Group Extended-Spectrum β-lactamase Genes in Escherichia coli Isolates From Tehran. Jundishapur J Microbiol. 2013;6(7):e6863. doi: https://doi.org/10.5812/jjm.6863

20
Apr
2018
Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae

Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae

Hesam Alizade,
Maziar Jajarmi,
Mohammad Reza Aflatoonian,
Davood Kalantar-Neyestanaki,
Saeed Shoja,
Reza Ghanbarpour

Alizade H, Jajarmi M, Aflatoonian MR, Kalantar-Neyestanaki D, Shoja S, et al. Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae. Jundishapur J Microbiol. 2018;11(4):e61285. doi: https://doi.org/10.5812/jjm.61285

More by these authors

Shahin Najar PeerayehPubMedScholar
Safoura DerakhshanPubMedScholar
Fatemeh FallahPubMedScholar
Bita BakhshiPubMedScholar
Share
Cited by
Metrics