High Prevalence of icaABCD Genes Responsible for Biofilm Formation in Clinical Isolates of Staphylococcus aureus From Hospitalized Children

Authors

Abdolmajid Ghasemian1, Shahin Najar-Peerayeh1,*, Bita Bakhshi1, Mohsen Mirzaee2
1Department of Bacteriology, Tarbiat Modares University, Tehran, IR Iran
2Department of Laboratory Sciences, Borujerd Branch, Islamic Azad University, Borujerd, IR Iran
*Corresponding Author: Corresponding author: Shahin Najar-Peerayeh, Department of Bacteriology, Tarbiat Modares University, Tehran, IR Iran. Tel: +98-92182883870, E-mail: Email: [email protected]

Archives of Pediatric Infectious Diseases:Vol. 3, issue 3; e20703
Published online:Jul 13, 2015
Article type:Research Article
Received:May 26, 2014
Accepted:May 13, 2015
How to Cite:Ghasemian A, Najar-Peerayeh S, Bakhshi B, Mirzaee M. High Prevalence of icaABCD Genes Responsible for Biofilm Formation in Clinical Isolates of Staphylococcus aureus From Hospitalized Children. Arch Pediatr Infect Dis. 2015;3(3):e20703. doi: https://doi.org/10.5812/pedinfect.20703v2

Abstract

Background:

The icaABCD genes encode a Polysaccharide Intercellular Adhesion (PIA), which is a tight structure protecting Staphylococcus aureus community against adverse environmental conditions. The ica dependent biofilm formation plays an important role in persistent infections in hospitalized patients.

Objectives:

The aim of this study was to detect icaADBC genes encoding PIA among S. aureus isolates from children in Loghman Hospital of Tehran.

Materials and Methods:

We collected 22 clinical specimens from hospitalized pediatrics and identified the isolates. Then, we detected mecA gene among Methicillin Resistant S. aureus (MRSA), SCCmec types and icaABCD gens by PCR assay and specific primers.

Results:

Five isolates (22.7%) were methicillin resistant (MRSA) and mecA gene was detected among them. All the MRSA isolates harbored SCCmec type III. Prevalence of icaA, icaB, icaC and icaD in the isolates were 16 (73%), 14 (63.6%), 16 (73%) and 16 (73%), respectively. Moreover, all the MRSA strains were icaADBC positive.

Conclusions:

Prevalence of icaADBC genes was relatively high among children and also all the four ica genes were detected among MRSA strains.

1. Background

S. aureus clinical isolates, especially methicillin resistant strains, are the causative agents of various clinical signs such as folliculitis, boils, impetigo and cellulitis, which are important in children (1, 2). S. aureus infections have been sharply increased during the recent years and associated with more mortality than other bacterial agents (3). Attachment and colonization is the first step for Staphylococcusaureus pathogenesis. Biofilm formation leads to bacterial resistance to higher concentrations of antimicrobial agents in addition to host immune responses (4). The self-produced polymeric matrices adhere to inert and living surfaces (5). Penetration of antibiotics reduces through S. aureus and S. epidermidis biofilms (6), although carbon and amino acids can be adsorbed by the biofilm layers (7). Some of special clonal complexes (e.g. clonal complex 8) are capable to adhere to different surfaces and produce a large amount of biofilm (8). The icaADBC genes, encoding PIA play important roles in biofilm formation among S. aureus and S. epidermidis isolates (9). Infections caused by isolates producing slime layer are difficult to treat. Many chronic infections due to S. aureus, especially through medical devices, are associated with biofilm formation (10, 11). Strong biofilm producer isolates are more virulent with severe post-surgical infections (12). The ica dependent biofilm formation develops by production of a polysaccharide inter cellular adhesion (PIA- PNSG/ poly- beta-1, 6-N-acetylglucosamine polymer) by the N-acetyl glucose aminyl transferase enzyme (13). Two ica A and D genes in the operon encode this enzyme. The other genes in this operon include icaB (polysaccharide deacetylase), icaC (transporter of PIA) and icaR (the regulatory gene). In Akiyama’s study, all S. aureus strains tested in skin lesions of impetigo, atopic dermatitis and pemphigus were covered with glycocalyx and formed microcolonies (14). Systemic and intravenous Staphylococcal isolates have been shown to harbor ica genes as twice as the normal flora of healthy volunteers (13). Most reports have detected some of these genes.

2. Objectives

The aim of this study was to detect the icaADBC genes encoding PIA among clinical isolates of S. aureus from children in Loghman Hospital of Tehran.

3. Materials and Methods

We collected 22 S. aureus isolates and then identified them with coagulase, manitol fermentation, colony morphology and DNase tests. Methicillin resistant isolates were identified in the phenotypic test by disk diffusion with oxacillin disk. Bacterial isolates were suspended in 200 µL of TE buffer and then lysostaphin was added (comprising 200 µL of TE buffer and 20 µL of lysostaphin [2 µg/mL, Sigma]). Genomic DNA of S. aureus isolates was isolated according to Straubinger method (15). The mecA gene was detected with specific primers indicated in Table 1 (16). PCR reaction mixture comprised of 9.5 µL distilled water (DW), 2 µL DNTPs (10 mM), 1.5 µL MgCl2 (50 mM), 1 µL of each primer, 3 µL 10X PCR buffer (200 mM), 2µL Taq polymerase (500 U) and 5 µL template DNA. The thermal profile included initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C (30 s), 55°C (30 s) and 72°C (30 s) and final extension of 72°C (4 min). Reaction mixture for SCCmec types was 94°C (1 min), 51°C (1 min), 72°C (1.5 min) and final extension of 72°C for 10 min. Moreover, thermal profile for icaA gene concluded with 94°C (5 min), followed by 30 cycle of 94°C (1 min), 52°C (30 s) and 72°C (1.5 min) with final extension of 72°C (10 min). The annealing temperature for icaB, icaC and icaD set as 55°C for 1 min (17), shown in Table 2. PCR products were electrophoresed in 1% gel agarose in 1X TBE buffer with staining of 1 µL of each loading buffer and gel red and then observed under UV emission. Pearson Chi-Square was used to data analysis. A P < 0.05 considered significant.
Table 1.
Primers for the mecA and SCCmec Types Used in This Study
PrimerSequence 5’ → 3’Size (bp)Reference
mecA147(16)
F: GTG AAG ATA TAC CAA GTG ATT
R: ATG CGC TATAGATTGAAA GGA
SCCmecI613(16)
F: GCTTTAAAGAGTGTCGTTACAGG
R: GTTCTCTCATAGTATGACGTCC
SCCmecII398(16)
F: CGTTGAAGATGATGAAGCG
R:CGAAATCAATGGTTAATGGACC
SCCmecIII280(16)
F: CCATATTGTGTACGATGCG
R: CCTTAGTTGTCGTAACAGATCG
SCCmecIVa776(16)
F: GCCTTATTCGAAGAAACCG
R: CTACTCTTCTGAAAAGCGTCG
SCCmecV325(16)
F: GAACATTGTTACTTAAATGAGCG
R: TGAAAGTTGTACCCTTGACACC
Table 2.
Primers Sequences Used for Amplification of icaADBC Genes
PrimerSequence 5’ → 3’Size (bp)Reference
icaA188(17)
F: ACACTTGCTGGCGCAGTCAA
R: TCTGGAACCAACATCCAACA
icaB900(17)
F: AGAATCGTGAAGTATAGAAAATT
R: TCTAATCTTTTTCATGGAATCCGT
icaC1100(17)
F:ATGGGACGGATTCCATGAAAAAGA
R: TAATAAGCATTAATGTTCAATT
icaD198(17)
F: ATGGTCAAGCCCAGACAGAG
R: AGTATTTTCAATGTTTAAAGCAA

4. Results

Five (22.7%) isolates were resistant to oxacillin (1 µg), moreover all the isolates were susceptible to vancomycin (2 µg) and linezolid (30 µg) disks. The mecA gene was detected in all five isolates (22.7%) with 147 bp size. All the MRSA isolates harbored SCCmec type III.
Furthermore, the prevalence of icaA, B, C and D in the isolates were 16 (73%), 14 (63.7%), 16 (73%) and 16 (73%), respectively as depicted in Figure 1. Interestingly, all MRSA isolates harbored all of icaADBC genes, suggesting that MRSA isolates may be more capable of PIA synthesis and biofilm formation (Table 3). However, there was no significant difference between MRSA and MSSA strains for the presence of icaADBC operon.
M: marker. columns 1, 3 and 4: <i>mecA gene</i>. column 2: <i>icaA</i> with 188 bp. columns 5 and 6: <i>icaD</i> gene with 189 bp. columns 4 and 5: <i>icaB</i> and <i>icaC</i> with 900 and 1100 bps, respectively.
Figure 1.
M: marker. columns 1, 3 and 4: mecA gene. column 2: icaA with 188 bp. columns 5 and 6: icaD gene with 189 bp. columns 4 and 5: icaB and icaC with 900 and 1100 bps, respectively.
Table 3.
Characteristics of MRSA Isolated From Hospitalized Children
MRSAClinical OriginmecASCCmecica GenesGender
1Trachea+IIIADBCMale
2Blood+IIIADBCMale
3Lesion+IIIADBCFemale
4Trachea+IIIADBCMale
5Lesion+IIIADBCMale

5. Discussion

All the studied isolates were susceptible to vancomycin and linezolid; although these drugs are the last choices for treatment of S. aureus infections, resistance to vancomycin has been sporadically reported from some areas of the world, similar to Iran (18, 19). Moreover, resistance to linezolid was detected in 19 of 20 isolates studied by Armin et al. (20). In this study, all MRSA strains harbored SCCmec type III. In the study of Japoni et al. (21) from south of Iran, SCCmec type III was the predominant type. MRSA strains harbor several virulence factors that develop more clinical signs (17, 22). Also the study by Imani Fouladi et al. (22), 75% of Staphylococcus aureus isolates with the SEB gene were Methicillin resistant and 15% were MSSA. In the study of Rahimi et al. (23), all the isolates were susceptible to vancomycin and most were susceptible to SXT. MRSA isolates harbored all icaADBC genes, suggesting that these isolates are strong biofilm producers and considered to cause chronic and persistent infections (24). Polymeric Intercellular Adhesion (PIA) plays an important role in attachment of bacteria to each other and to accumulate with multilayered biofilm. Catheter and blood stream Staphylococcal infections play an important role in biofilms (25, 26). We confirmed no significant difference between MSSA and MRSA isolates of S. aureus regarding the presence of icaADBC genes, similar to survey Atshan et al. (27), in which icaADBC genes were compared between MRSA and MSSA. Furthermore, we previously observed that most isolates belonged to accessory gene regulator (agr) group I (28), but the relationship of agr groups and icaADBC expression needs more studies. Several studies indicated the role of icaA and icaD genes in biofilm production and several reported that all of isolates were icaA positive (29). In the study by Hou et al. (30), among 55.56% of isolates that produced biofilm phenotypically, 11.11% had icaA gene, but other genes were not investigated. In this study, methicillin resistant isolates harbored higher rate of icaADBC genes, similar to studies conducted by Khan et al. (31) and O’neill et al. (32). However, Smith et al. (33) detected no significant correlation between susceptibility to methicillin and biofilm formation. Variations in the presence of icaADBC genes from studies might be due to epidemiological varieties and periods that these isolates have been collected.
Most of previous studies focused on the icaAD genes that encode PIA; likewise, these studies have not determined whether MRSA strains could produce PIA significantly more than MSSA isolates. For instance, Nasr et al. (34) detected icaAD genes in 32% of blood and catheter isolates. In the other study, 36 of 46 Staphylococcal isolates harbored icaA and icaD genes; while Grinholc and coworkers did not detect icaD, but all strains were icaA positive (35). Terki et al. (36) detected icaAD genes in 17 (38.5%) of 44 staphylococcal isolates from urinary tract. In the other study, biofilm formation in most isolates was PIA dependent (37). Smith et al. (33) depicted that isolates of S. aureus from infected skin lesions were significantly more capable of producing biofilms than those isolated from blood and other infected sites. In the study of Semczuk et al. (38), all the isolates forming biofilm phenotypically, harbored icaAD genes. Satorres and Alcaraz (13) suggested that the ica genes might be more prevalent in Staphylococcus strains isolated from hospitalized patients or staff, than healthy individuals or the community. The limitations of this study were loss of healthy individuals, environmental strains and low number of isolates. In conclusion, the prevalence of icaADBC genes was high in hospitalized children in center of Tehran. There was no significant difference between MRSA and MSSA isolates of S. aureus regarding the presence of icaADBC genes, although all methicillin resistant strains harbored all the icaADBC genes.

Acknowledgments

Footnotes

  • Authors’ Contributions:Abdolmajid Ghasemian followed the microbiological and molecular laboratory studies. Shahin Najar Peerayeh designed the thesis of research, Bita Bakhshi and Mohsen Mirzaee advised the research.

  • Funding/Support:This work was supported by grants for a thesis from Faculty of Medical Sciences of Tarbiat Modares University, Tehran, IR Iran.

References

  • 1.
    Nkwelang G, Akoachere JFT, Kamga LH, Nfoncham ED, Ndip RN. Staphylococcus aureus isolates from clinical and environmental samples in a semi-rural area of Cameroon: phenotypic characterization of isolates. Afri J Microbiol Res. 2009;3(11):731-6.
  • 2.
    Post V, Wahl P, Uckay I, Ochsner P, Zimmerli W, Corvec S, et al. Phenotypic and genotypic characterisation of Staphylococcus aureus causing musculoskeletal infections. Int J Med Microbiol. 2014;304(5-6):565-76. [PubMed ID: 24768432]. https://doi.org/10.1016/j.ijmm.2014.03.003.
  • 3.
    Naber CK. Staphylococcus aureus bacteremia: epidemiology, pathophysiology, and management strategies. Clin Infect Dis. 2009;48 Suppl 4:S231-7. [PubMed ID: 19374578]. https://doi.org/10.1086/598189.
  • 4.
    Verma P, Maheshwari SK, Mathur A. A review on bacterial biofilm formation and disassembly. Int J Pharm Sci Res. 2013;4(8):2900-6.
  • 5.
    Diemond-Hernandez B, Solorzano-Santos F, Leanos-Miranda B, Peregrino-Bejarano L, Miranda-Novales G. Production of icaADBC-encoded polysaccharide intercellular adhesin and therapeutic failure in pediatric patients with Staphylococcal device-related infections. BMC Infect Dis. 2010;10:68. [PubMed ID: 20230642]. https://doi.org/10.1186/1471-2334-10-68.
  • 6.
    Nathan KA, Mark JMJ, William C. Staphylococcus aureus biofilms. Vir. 2011;2(5):1-15.
  • 7.
    Zhu Y, Weiss EC, Otto M, Fey PD, Smeltzer MS, Somerville GA. Staphylococcus aureus biofilm metabolism and the influence of arginine on polysaccharide intercellular adhesin synthesis, biofilm formation, and pathogenesis. Infect Immun. 2007;75(9):4219-26. [PubMed ID: 17576756]. https://doi.org/10.1128/IAI.00509-07.
  • 8.
    Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphylococcus aureus biofilm formation at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiol. 2009;9:229. [PubMed ID: 19863820]. https://doi.org/10.1186/1471-2180-9-229.
  • 9.
    Eftekhar F, Dadaei T. Biofilm formation and detection of icaAB genes in clinical isolates of methicillin resistant staphylococcus aureus. Iran J Basic Med Sci. 2011;14(2):132-6.
  • 10.
    Martin-Lopez JV, Perez-Roth E, Claverie-Martin F, Diez Gil O, Batista N, Morales M, et al. Detection of Staphylococcus aureus Clinical Isolates Harboring the ica Gene Cluster Needed for Biofilm Establishment. J Clin Microbiol. 2002;40(4):1569-70. [PubMed ID: 11923401].
  • 11.
    Glinska K, Tkacikova L. Detection of icaA gene encoding the biofilm formation in S.aureus isolates. Folia Veterinaria. 2009;53(1):10-1.
  • 12.
    Bekir K, Haddad O, Grissa M, Chaieb K, Bakhrouf A, Elgarssdi SI. Molecular detection of adhesins genes and biofilm formation in methicillin resistant Staphylococcus aureus. African J Microbiol Res. 2012;6(23):4908-17.
  • 13.
    Satorres SE, Alcaraz LE. Prevalence of icaA and icaD genes in Staphylococcus aureus and Staphylococcus epidermidis strains isolated from patients and hospital staff. Central Eur J Public Health. 2007;15(2):87-90.
  • 14.
    Akiyama H, Hamada T, Huh WK, Yamasaki O, Oono T, Fujimoto W, et al. Confocal laser scanning microscopic observation of glycocalyx production by Staphylococcus aureus in skin lesions of bullous impetigo, atopic dermatitis and pemphigus foliaceus. Br J Dermatol. 2003;148(3):526-32.
  • 15.
    Gey A, Werckenthin C, Poppert S, Straubinger RK. Identification of pathogens in mastitis milk samples with fluorescent in situ hybridization. J Vet Diagn Invest. 2013;25(3):386-94. [PubMed ID: 23632662]. https://doi.org/10.1177/1040638713486113.
  • 16.
    Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, et al. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol. 2004;42(11):4947-55. [PubMed ID: 15528678]. https://doi.org/10.1128/JCM.42.11.4947-4955.2004.
  • 17.
    Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur J Microbiol. 2014;7(6). ee10741. [PubMed ID: 25371805]. https://doi.org/10.5812/jjm.10741.
  • 18.
    Howden BP, Davies JK, Johnson PD, Stinear TP, Grayson ML. Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications. Clin Microbiol Rev. 2010;23(1):99-139. [PubMed ID: 20065327]. https://doi.org/10.1128/CMR.00042-09.
  • 19.
    Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern Iran. J Clin Microbiol. 2012;50(11):3581-5. [PubMed ID: 22933598]. https://doi.org/10.1128/JCM.01727-12.
  • 20.
    Armin S, Rouhipour A, Fallah F, Rahbar M, Ebrahimi M. Vancomycin and linezolid resistant staphylococcus in hospitalized children. Arch Pediatr Infect Dis. 2012;1(1):4-8.
  • 21.
    Japoni A, Jamalidoust M, Farshad S, Ziyaeyan M, Alborzi A, Japoni S, et al. Characterization of SCCmec types and antibacterial susceptibility patterns of methicillin-resistant Staphylococcus aureus in Southern Iran. Jpn J Infect Dis. 2011;64(1):28-33. [PubMed ID: 21266752].
  • 22.
    Imani Fouladi AA, Choupani A, Fallah Mehrabadi J. Study of prevalence of Enterotoxin type B gene in Meticillin Resistant Staphylococcus aureus (MRSA) isolated from wound. Kowsar Med J. 2011;16(1):21-5.
  • 23.
    Rahimi F, Bouzari M, Maleki Z, Rahimi F. Antibiotic susceptibility pattern among Staphylococcus spp. with emphasis on detection of mecA gene in methicillin resistant Staphylococcus aureus isolates. Arch Clin Infect Dis. 2009;4(3):143-50.
  • 24.
    Begun J, Gaiani JM, Rohde H, Mack D, Calderwood SB, Ausubel FM, et al. Staphylococcal biofilm exopolysaccharide protects against Caenorhabditis elegans immune defenses. PLoS Pathog. 2007;3(4). ee57. [PubMed ID: 17447841]. https://doi.org/10.1371/journal.ppat.0030057.
  • 25.
    O'Gara JP. ica and beyond: biofilm mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMS Microbiol Lett. 2007;270(2):179-88. [PubMed ID: 17419768].
  • 26.
    Ziebuhr W, Heilmann C, Gotz F, Meyer P, Wilms K, Straube E, et al. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect Immun. 1997;65(3):890-6. [PubMed ID: 9038293].
  • 27.
    Atshan SS, Nor Shamsudin M, Sekawi Z, Lung LT, Hamat RA, Karunanidhi A, et al. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus. J Biomed Biotechnol. 2012;2012:976972. [PubMed ID: 22701309]. https://doi.org/10.1155/2012/976972.
  • 28.
    Ghasemian A, Peerayeh SN, Bakhshi B, Mirzaee M. Accessory Gene Regulator Specificity Groups Among Staphylococcus aureus Isolated From Hospitalized Children. Arch Pediatr. 2014;2(2). ee16096.
  • 29.
    Yazdani R, Oshaghi M, Havayi A, Pishva E, Salehi R, Sadeghizadeh M, et al. Detection of icaAD gene and biofilm formation in Staphylococcus aureus isolates from wound infections. Iran J Public Health. 2006;35(2):25-8.
  • 30.
    Hou W, Sun X, Wang Z, Zhang Y. Biofilm-forming capacity of Staphylococcus epidermidis, Staphylococcus aureus, and Pseudomonas aeruginosa from ocular infections. Invest Ophthalmol Vis Sci. 2012;53(9):5624-31. [PubMed ID: 22736609]. https://doi.org/10.1167/iovs.11-9114.
  • 31.
    Khan F, Shukla I, Rizvi M, Mansoor T, Sharma SC. Detection of Biofilm Formation in Staphylococcus aureus. Does it have a Role in Treatment of MRSA Infections? Trends Med Res. 2011;6(2).
  • 32.
    O'Neill E, Pozzi C, Houston P, Smyth D, Humphreys H, Robinson DA, et al. Association between methicillin susceptibility and biofilm regulation in Staphylococcus aureus isolates from device-related infections. J Clin Microbiol. 2007;45(5):1379-88. [PubMed ID: 17329452]. https://doi.org/10.1128/JCM.02280-06.
  • 33.
    Smith K, Perez A, Ramage G, Lappin D, Gemmell CG, Lang S. Biofilm formation by Scottish clinical isolates of Staphylococcus aureus. J Med Microbiol. 2008;57(Pt 8):1018-23. [PubMed ID: 18628505]. https://doi.org/10.1099/jmm.0.2008/000968-0.
  • 34.
    Nasr RA, AbuShady HM, Hussein HS. Biofilm formation and presence of icaAD gene in clinical isolates of staphylococci. Egypt J Med Human Genetics. 2012;13(3):269-74.
  • 35.
    Szweda P, Schielmann M, Milewski S, Frankowska A, Jakubczak A. Biofilm production and presence of ica and bap genes in Staphylococcus aureus strains isolated from cows with mastitis in the eastern Poland. Pol J Microbiol. 2012;61(1):65-9. [PubMed ID: 22708349].
  • 36.
    Terki IK, Hassaine H, Oufrid S, Bellifa S, Mhamedi I, Lachachi M, et al. Detection of icaA and icaD genes and biofilmformation in Staphylococcus spp. isolated from urinary catheters at the University Hospital of Tlemcen (Algeria). African J Microbiol Res. 2013;7(47):5350-7.
  • 37.
    Otto M. Staphylococcal biofilms. Curr Top Microbiol Immunol. 2008;322:207-28. [PubMed ID: 18453278].
  • 38.
    Semczuk K, Dzierzanowska-Fangrat K, Dmenska H, Dzierzanowska D. [The analyze of capability of biofilm synthesis by Staphylococcus aureus strains isolated from children with cystic fibrosis]. Med Dosw Mikrobiol. 2008;60(4):311-8. [PubMed ID: 19382603].

Copyright

Copyright © 2015, Pediartric Infections Research Center. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

26
Apr
2014

Accessory Gene Regulator Specificity Groups Among Staphylococcus aureus Isolated From Hospitalized Children

Abdolmajid Ghasemian,
Shahin Najar Peerayeh,
Bita Bakhshi,
Mohsen Mirzaee

Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. Accessory Gene Regulator Specificity Groups Among Staphylococcus aureus Isolated From Hospitalized Children. Arch Pediatr Infect Dis. 2014;2(4):e16096. doi: https://doi.org/10.5812/pedinfect.16096

20
Jul
2021
Phenotypic and Genotypic Characterization of Antibiotic Resistance in Staphylococcus aureus Isolated from Different Sources

Phenotypic and Genotypic Characterization of Antibiotic Resistance in Staphylococcus aureus Isolated from Different Sources

Zainab Amer Hatem,
Saade Abdalkareem Jasim,
Zainab Hussein Mahdi

Hatem ZA, Jasim SA, Mahdi ZH. Phenotypic and Genotypic Characterization of Antibiotic Resistance in Staphylococcus aureus Isolated from Different Sources. Jundishapur J Microbiol. 2021;14(4):e115221. doi: https://doi.org/10.5812/jjm.115221

27
Nov
2016

Detection of Biofilm Production Capability and icaA/D Genes Among Staphylococci Isolates from Shiraz, Iran

Mehrdad Zalipour,
Hadi Sedigh Ebrahim-Saraie,
Jamal Sarvari,
Reza Khashei

Zalipour M, Sedigh Ebrahim-Saraie H, Sarvari J, Khashei R. Detection of Biofilm Production Capability and icaA/D Genes Among Staphylococci Isolates from Shiraz, Iran. Jundishapur J Microbiol. 2016;9(12):e41431. doi: https://doi.org/10.5812/jjm.41431

29
Nov
2015

Methicillin-Resistant Staphylococcus aureus Isolated From Various Types of Hospital Infections in Pediatrics: Panton-Valentine Leukocidin, Staphylococcal Chromosomal Cassette mec SCCmec Phenotypes and Antibiotic Resistance Properties

Banafshe Dormanesh,
Soheila Siroosbakhat,
Ebrahim Khodaverdi Darian,
Ladan Afsharkhas

Dormanesh B, Siroosbakhat S, Khodaverdi Darian E, Afsharkhas L. Methicillin-Resistant Staphylococcus aureus Isolated From Various Types of Hospital Infections in Pediatrics: Panton-Valentine Leukocidin, Staphylococcal Chromosomal Cassette mec SCCmec Phenotypes and Antibiotic Resistance Properties. Jundishapur J Microbiol. 2015;8(11):e11341. doi: https://doi.org/10.5812/jjm.11341

27
Sep
2017
Investigation of Biofilm Formation Among Methicillin-Resistant Staphylococcus aureus Isolated from Children

Investigation of Biofilm Formation Among Methicillin-Resistant Staphylococcus aureus Isolated from Children

Roghayeh Samadi,
Zohreh Ghalavand,
Bahram Nikmanesh,
Narges Nodeh Farahani,
Maryam Yasini,
Mozhgan Esmaeili Benvidi
,et al.

Samadi R, Ghalavand Z, Nikmanesh B, Nodeh Farahani N, Yasini M, et al. Investigation of Biofilm Formation Among Methicillin-Resistant Staphylococcus aureus Isolated from Children. Arch Pediatr Infect Dis. 2018;6(3):e61635. doi: https://doi.org/10.5812/pedinfect.61635

More by these authors

Abdolmajid GhasemianPubMedScholar
Shahin Najar-PeerayehPubMedScholar
Bita BakhshiPubMedScholar
Mohsen MirzaeePubMedScholar
Share
Cited by
Metrics