Abstract
Background:
The increasing emergence of resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae) has limited the therapeutic options used to treat infections caused by these bacteria.Objectives:
The aim of this study was the molecular detection of quinolone resistance genes acrA, acrB, qepA, and aac(6’)-Ib-cr in K. pneumoniae strains isolated from hospitalized patients in selected hospitals in Tehran during 2013 - 2014.Methods:
One hundred and seventeen strains of K. pneumoniae were isolated between August 2013 and March 2014 from hospitalized patients in Taleghani hospital, Mofid children’s hospital, and Imam Hossein hospital in Tehran. Antimicrobial susceptibility tests were performed using disk diffusion and broth microdilution methods based on CLSI guidelines. The identification of the genes that encode efflux pumps acrA, acrB, qepA, and aac(6’)-Ib-cr was done using the PCR technique.Results:
Antimicrobial susceptibility tests showed that colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. The PCR assay detected the acrA and acrB genes in 110 (94%) and 102 (87%) isolates, respectively. Additionally, the qepA and aac(6’)-Ib-cr genes were detected in 5 (4%) and 100 (85%) isolates, respectively.Conclusions:
The prevalence of the acrA, acrB, qepA, and aac(6’)-Ib-cr genes in K. pneumoniae, which causes resistance to fluoroquinolones, in this study is cause for concern. Based on our results, accurate identification of resistant Gram-negative bacteria such as K. pneumoniae and detection of its susceptibility to common antibiotics could lead to proper treatment and control of resistant nosocomial infections.Keywords
Efflux Pump Fluoroquinolone Antibiotic Resistance Klebsiella pneumoniae
1. Background
Klebsiella pneumoniae (K. pneumoniae) is one of the important nosocomial infections, causing respiratory, urinary, and wound infections (1-3). Resistance to quinolones in hospitalized isolates was first studied in 1998 in a K. pneumoniae strain isolated in Birmingham, USA (4, 5). Over the past three decades, quinolone resistance has expanded among K. pneumoniae strains isolated from hospitalized patients. Thus, the spread of resistant K. pneumoniae is becoming a global threat to public health (6, 7).
Fluoroquinolone resistance mainly occurs as a result of mutations in chromosomal gene-containing DNA gyrase, topoisomerase IV, and an overexpression of the AcrAB efflux system. Two plasmid-mediated quinolone resistance mechanisms have also been reported in QepA, a plasmid-mediated fluoroquinolone efflux pump, and the Aac(6’)-Ib-cr enzyme, which acetylates aminoglycosides and ciprofloxacin (8-11). Efflux pumps are transport proteins that extrude toxic substrates from the intracellular environment into the extracellular environment. These proteins are found in both Gram-positive and Gram-negative bacteria. The AcrAB and QepA efflux pumps act on the bacterial membrane by extruding antibiotics to the extracellular environment so that the intracellular concentration of antibiotic decreases, causing antibiotic resistance (12, 13).
The AcrAB efflux system consists of the outer membrane channel TolC; the transporter AcrB, which is placed in the inner membrane; and the periplasmic AcrA, which bridges these two integral membrane proteins. The AcrAB efflux pump is able to transport various compounds with little chemical similarity, thus conferring resistance to a broad spectrum of antibiotics. The plasmid-mediated QepA efflux belongs to the main facilitator superfamily-type group and confers diminished susceptibility to hydrophilic fluoroquinolone. The aac(6’)-Ib-cr gene encrypts an aminoglycoside acetyltransferase AAC(6’)-Ib variant marked by Trp102Arg and Asp179Tyr substitutions. These changes afford the new enzyme the capability to acetylate fluoroquinolones that are harboring an unsubstituted piperazinyl group, such as ciprofloxacin and norfloxacin. As a consequence, this gene confers decreased susceptibility to some fluoroquinolones, tobramycin, kanamycin, and amikacin.
2. Objectives
The aim of this study was to detect AcrAB and QepA efflux pumps and the Aac(6’)-Ib-cr enzyme among K. pneumoniae clinical isolates using the PCR method in three teaching hospitals in different parts of Tehran.
3. Methods
3.1. Bacterial Isolates
One hundred and seventeen strains of K. pneumoniae were isolated between August 2013 and March 2014 from hospitalized patients in Taleghani hospital, Mofid children’s hospital, and Imam Hossein hospital in Tehran. Conventional biochemical tests were performed according to well-recognized methods: ornithine and lysine decarboxylation, a motility test, an indole test, a methyl red test, the Voges-Proskauer test, the Simmons’ citrate test, and the triple sugar iron test (Merck, Germany) (14). Escherichia coli (E. coli) ATCC 25922 was used as positive control strain for bacterial detection.
3.2. Antimicrobial Susceptibility Testing
Antimicrobial susceptibility was determined using the microdilution and Kirby-Bauer disk diffusion (Mast group, Merseyside, UK) methods in accordance with the recommendations of the clinical and laboratory standards institute (CLSI 2013) (14). The antimicrobial agents tested with the microdilution method were imipenem, meropenem, ampicillin, cefotaxime, and ceftazidime. The agents tested with the Kirby-Bauer disk diffusion method were ciprofloxacin (CIP, 30 μg), aztreonam (ATM, 30 μg), imipenem (IPM,10 μg), meropenem (MEM, 10 μg), doripenem (DOR, 10 μg), ertapenem (ETP, 10 μg), gentamicin (GEN, 10 μg) amikacin (AK, 30 μg), ampicillin (AMP, 10 μg), ceftazidime (CAZ, 30 μg), cefotaxime (CTX, 30 μg), cefpodoxime (CPD, 30 μg), tetracycline (TET, 10 μg), tigecycline (TGC, 15 μg), piperacillin (PIP, 100 μg), and colistin (CT, 10 μg). E. coli ATCC25922 was used as a quality control strain in both methods.
3.3. PCR Detection and DNA Sequencing Analysis
The DNA was extracted by the GeNet Bio company (Korea, Cat. no. K-3000) and was used as a template for the PCR reaction (Eppendorf, Mastercycler gradient). Briefly, the 25 μL PCR mixture contained 12.5 μL of master mix (Bioneer company, Korea, Cat. number K-2016), 7.5 μL of deionized water, 1 μL of each primer, and 3 μL of bacterial DNA. Amplification was achieved using the following thermal cycling conditions: five minutes at 94°C for the initial denaturation and for 36 cycles of amplification consisting of 45 seconds at 94°C, 45 seconds at 51 - 57°C, and 45 seconds at 72° C with five minutes at 72°C for the final extension.
The results of the PCR were compared with positive controls. The qepA genes were screened using a polymerase chain reaction PCR technique. The presence of aac(6’)-Ib was detected using the primers Aac(6’)-Ib-F (5’-TTGCGATGCTCTATGAGTGGCTA-3’) and Aac(6’)-Ib-R (5’-CTCGAATGCCTGGCGTGTTT-3’). The specific primers for the acrA gene (AcrA-F, 5’-TCTGATCGACGGTGACATCC-3’ and AcrA-R, 5’-TCGAGCAATGATTTCCTGCG-3’) and the acrB gene (AcrB-F 5’-CAATACGGAAGAGTTTGGCA-3’ and AcrB-F 5’-CAGACGAACCTGGGAACC-3’) were used to evaluate the presence of the AcrAB efflux pump. The obtained amplicons were sequenced. The PCR products were analyzed using electrophoresis in a 1% vw-1 agarose gel. One of the PCR products was purified, and direct sequencing was done (Bioneer company, Korea). The designed target-specific primers, PCR amplification products, and the conditions of the PCR assay and for the acrAB, aac(6’)-Ib-cr, and qepA genes among the clinical isolates are shown in Table 1 and 2.
Primer Sequence and Product Size
| Primer | Sequence, 5’ - 3’ | Product Size, bp |
|---|---|---|
| QepA | 403 | |
| F | 5’- CTGCAGGTACTGCGTCATG -3’ | |
| R | 5’- CGTGTTGCTGGAGTTCTTC -3’ | |
| AcrA | 157 | |
| F | 5’- TCTGATCGACGGTGACATCC -3’ | |
| R | 5’- TCGAGCAATGATTTCCTGCG -3’ | |
| AcrB | 64 | |
| F | 5’- CAATACGGAAGAGTTTGGCA -3’ | |
| R | 5’- CAGACGAACCTGGGAACC -3’ | |
| Aac(6’)-Ib | 611 | |
| F | 5’- TTGCGATGCTCTATGAGTGGCTA -3’ | |
| R | 5’- CTCGAATGCCTGGCGTGTTT -3’ |
Temperature and Time of the PCR Assay
| PCR Steps | Temperature, ºC | Time | ||||||
|---|---|---|---|---|---|---|---|---|
| Aac(6’)-Ib | QepA | AcrA | AcrB | Aac(6’)-Ib | QepA | AcrA | AcrB | |
| Initial denaturation | 94 | 94 | 94 | 94 | 5 min | 5 min | 5 min | 5 min |
| Denaturation | 94 | 94 | 94 | 94 | 45 s | 45 s | 45 s | 45 s |
| Annealing | 55 | 51 | 57 | 52 | 45 s | 45 s | 45 s | 45 s |
| Extension | 72 | 72 | 72 | 72 | 45 s | 45 s | 45 s | 45 s |
| Final extension | 72 | 72 | 72 | 72 | 5 min | 5 min | 5 min | 5 min |
| PCR steps | 36 | 36 | 36 | 36 | 36 | - | - | - |
3.4. Statistical Analysis
This study was a descriptive study. MINITAB16 software was used for the analysis of the study’s results. The P value and confidence intervals were P < 0.05 and 95%, respectively.
4. Results
In total, 117 strains were recovered. Seventy strains were isolated from Taleghani HOSPITAL (51.2%), 45 were isolated from Mofid children’s hospital (38.6%), and 12 were isolated from Imam Hossein hospital (10.2%). Sixty-four strains were isolated from females (55%) and 53 were isolated from males (45%). The ages of the patients ranged from 1 to 90 years old. The patients included 67 (57.26%) males and 50 (42.74%) females. The studied strains were isolated from the following wards: pediatrics, 49 (42%); outpatient, 16 (13.5%); intensive care units (ICUs), 13 (11.1%); surgery, 9 (7.5%); neonatal ICUs, 12 (10.1%); bone marrow transplant unit, 4 (3.6%); hematology, 4 (3.6%); endocrine, 3 (2.5%); gastrology, 3 (2.5%); and other wards, 4 (3.6%). The distribution of the antibiotic resistance genes in the K. pneumoniae isolates is shown in Table 3. The MIC results for the studied strains are shown in Table 4. The PCR assay, using specific primers, demonstrated that among the 117 isolates, 110 (94%) and 102 (87%) isolates were positive for the acrA and acrB gene, respectively, showing that different acr types were circulating with a high prevalence. Additionally, for the qepA and aac(6’)-Ib-cr genes, 5 (4%) and 100 (85%) isolates were detected, respectively. Both the acrAB and aac(6’)-Ib-cr genes were significantly more prevalent among the K. Pneumonia isolates.
Antibiotic Susceptibility Testing Results
| Antibiotic | Resistant, No (%) | Sensitive, No (%) | Intermediate, No (%) |
|---|---|---|---|
| Aztreonam | 75 (64) | 37 (31) | 5 (5) |
| Meropenem | 28 (24) | 77 (66) | 12 (10) |
| Gentamicin | 51 (43) | 65 (55) | 1 (2) |
| Amikacin | 40 (34) | 76 (65) | 1 (2) |
| Imipenem | 28 (24) | 77 (66) | 12 (10) |
| Cefotaxime | 77 (66) | 39 (33) | 1 (2) |
| Tetracycline | 70 (60) | 43 (36) | 4 (4) |
| Ampicillin | 73 (62) | 20 (17) | 24 (21) |
| Piperacillin | 73 (62) | 40 (34) | 4 (4) |
| Cefpodoxime | 84 (72) | 30 (26) | 3 (2) |
| Tigecycline | 17 (15) | 35 (30) | 65 (55) |
| Doripenem | 28 (24) | 78 (66) | 12 (10) |
| Ertapenem | 28 (24) | 77 (66) | 12 (10) |
| Ceftazidime | 73 (62) | 39 (33) | 5 (5) |
| Colistin | 5 (4) | 112 (96) | 0 (0.0) |
Minimum Inhibitory Concentration (MIC) Testing Results
| Antibiotics | MIC, µg/mL | ||
|---|---|---|---|
| Range | MIC 50 | MIC 90 | |
| Meropenem | 0.25 - 256 | 1 | 32 |
| Imipenem | 0.25 - 256 | 1 | 16 |
| Ceftazidime | 1 - > 256 | 64 | > 256 |
| Cefotaxime | 0.5 - > 256 | 16 | > 256 |
| Ampicillin | 2 - > 256 | 256 | > 256 |
5. Discussion
A multiresistant strain of K. pneumoniae was described in Birmingham two decades ago. It included a broad host range plasmid that contributed to a decline in vitro activity of quinolones. In the presence of this plasmid, resistance to quinolones due to efflux pump systems, DNA gyrase alterations, and porin loss increased eightfold. The gene of quinolone efflux pump resistance, named qepA, is located on a plasmid containing a transposable element on both sides (15).
In our survey, the qepA gene was reported in 5 (4%) isolates. These results are similar to a study conducted by Kim et al. in Korea (16). Although the prevalence of the qepA gene in the current study was low, this plasmid encoding gene can be moved between individuals, hospitals, and environments, increasing the resistance rate.
The aac(6’)-Ib-cr gene confers decreased susceptibility to some fluoroquinolones and to aminoglycosides. In our study, 100 (85%) K. pneumoniae strains isolated from hospitalized patients carried the aac(6’)-Ib-cr gene. This finding indicates an alarming trend in the increasing frequency of K. pneumoniae that is resistant to fluoroquinolones and aminoglycosides, which are two important anti-Gram negative agents that are commonly used in our practice.
Ma et al. performed a study in China reported that found that the most antibiotic resistance belonged to ciprofloxacin and levofloxacin and that among a total of 101 isolates, 35 (34.7%) genes were aac(6’)-Ib-cr, qepA, and qnr (17).
Recent investigations have expressed various other mechanisms for antimicrobial resistance among K. pneumoniae strains. One of these important mechanisms is the efflux systems comprising the AcrAB efflux pumps. Many studies indicated a relationship between the AcrAB efflux system and resistance to quinolones in K. pneumoniae (18-21). Now, the AcrAB efflux system is one of the major mechanisms in multidrug resistant.
K. pneumoniae strains, and it consists of the transporter AcrB, which is placed in the inner membrane, and the periplasmic AcrA, which bridges these two integral membrane proteins. Our study demonstrated that 110 (94%) and 102 (87%) strains had acrA and acrB genes, respectively, showing that acrA and acrB were circulating at a high prevalence. Pakzad et al. performed a study in Iran in 2013 that demonstrated that 40 (76.92%) strains of Klebsiella pneumoniae (K. pneumoniae) that were isolated from burn patients were resistant to ciprofloxacin, and the PCR results in their study showed that all ciprofloxacin-resistant strains also had the acrA gene (22).
Another study conducted by Hasdemir et al. in 2004 demonstrated that the AcrAB efflux pump system participated in resistance to fluoroquinolones in multidrug resistant K. pneumoniae strains isolated from Turkey (18). Geographical location plays a major role in the distribution of these genes because countries that are geographically closer to our country have a relatively similar distribution of acrA, acrB, qepA and aac(6’)-Ib-cr genes. Recent surveys exhibited that the emergence of fluoroquinolone-resistant clinical K. pneumoniae strains have been extended among hospitalized patients in Iran (23-25).
Additional investigations using PCR or a probe-based assay can help simplify the actual dissemination and prevalence of quinolone resistance. The high prevalence of quinolone resistance-encoding genes implies the need for accurate identification of resistant K. pneumoniae strains and for the choice of proper treatment for the prevention of resistant nosocomial infections. Continuous evaluations of the decrease or increase of antibiotic resistance among K. pneumoniae strains isolated from hospitalized patients could provide physicians with new therapeutic choices so that treatment with ineffectual drugs can be stopped and replaced by effectual antibiotics.
References
-
1.
Tsai YK, Fung CP, Lin JC, Chen JH, Chang FY, Chen TL, et al. Klebsiella pneumoniae outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence. Antimicrob Agents Chemother. 2011;55(4):1485-93. [PubMed ID: 21282452]. https://doi.org/10.1128/AAC.01275-10.
-
2.
Hakemi-Vala M, Makhmor M, Kobarfar F, Kamalinejad M, Heidary M, Khoshnood S. Investigation of Antimicrobial Effect of Tribulus terrestris L. against Some Gram Positive and Negative Bacteria and Candida spp. Novelty Biomed. 2014;2(3):85-90.
-
3.
Livermore DM. Current epidemiology and growing resistance of gram-negative pathogens. Korean J Intern Med. 2012;27(2):128-42. [PubMed ID: 22707882]. https://doi.org/10.3904/kjim.2012.27.2.128.
-
4.
Garcia-Sureda L, Juan C, Domenech-Sanchez A, Alberti S. Role of Klebsiella pneumoniae LamB Porin in antimicrobial resistance. Antimicrob Agents Chemother. 2011;55(4):1803-5. [PubMed ID: 21282437]. https://doi.org/10.1128/AAC.01441-10.
-
5.
Luo Y, Yang J, Zhang Y, Ye L, Wang L, Guo L. Prevalence of beta-lactamases and 16S rRNA methylase genes amongst clinical Klebsiella pneumoniae isolates carrying plasmid-mediated quinolone resistance determinants. Int J Antimicrob Agents. 2011;37(4):352-5. [PubMed ID: 21376540]. https://doi.org/10.1016/j.ijantimicag.2010.12.018.
-
6.
Roy S, Viswanathan R, Singh AK, Das P, Basu S. Sepsis in neonates due to imipenem-resistant Klebsiella pneumoniae producing NDM-1 in India. J Antimicrob Chemother. 2011;66(6):1411-3. [PubMed ID: 21393155]. https://doi.org/10.1093/jac/dkr068.
-
7.
Padilla E, Llobet E, Domenech-Sanchez A, Martinez-Martinez L, Bengoechea JA, Alberti S. Klebsiella pneumoniae AcrAB efflux pump contributes to antimicrobial resistance and virulence. Antimicrob Agents Chemother. 2010;54(1):177-83. [PubMed ID: 19858254]. https://doi.org/10.1128/AAC.00715-09.
-
8.
Yang J, Ye L, Wang W, Luo Y, Zhang Y, Han L. Diverse prevalence of 16S rRNA methylase genes armA and rmtB amongst clinical multidrug-resistant Escherichia coli and Klebsiella pneumoniae isolates. Int J Antimicrob Agents. 2011;38(4):348-51. [PubMed ID: 21724374]. https://doi.org/10.1016/j.ijantimicag.2011.04.021.
-
9.
Xianfeng Z, Jianxin GAO, Yaojian H, Songzhe FU, Haiying C. Antibiotic resistance pattern of Klebsiella pneumoniae and Enterobacter sakazakii isolates from powdered infant formula. Afr J Microbiol. 2011;5(19):3073-7. https://doi.org/10.5897/ajmr10.867.
-
10.
Heidary M, Hashemi A, Goudarzi H, Khoshnood S, Roshani M, Azimi H, et al. The antibacterial activity of Iranian plants extracts against metallo beta-lactamase producing Pseudomonas aeruginosa strains. JPS. 2016;7(1).
-
11.
Goudarzi H, Hashemi A, Fatemeh F, Noori M, Erfanimanesh S, Yosefi N, et al. Detection of blaDIM, blaAIM, blaGIM, blaNDM and blaVIM Genes among Acinetobacter baumannii strains isolated from hospitalized patients in Tehran hospitals, Iran. IJM. 2016;9(4):32-9.
-
12.
Maramba-Lazarte CC. Etiology of neonatal sepsis in five urban hospitals in the Philippines. PIDSP Journal. 2011;12(2).
-
13.
Lubell Y, Ashley EA, Turner C, Turner P, White NJ. Susceptibility of community-acquired pathogens to antibiotics in Africa and Asia in neonates--an alarmingly short review. Trop Med Int Health. 2011;16(2):145-51. [PubMed ID: 21078009]. https://doi.org/10.1111/j.1365-3156.2010.02686.x.
-
14.
Performance standard for antimicrobial susceptibility testing; seventeenth informational supplement, M100_s17. Wayne: Clinical and Laboratory Standards Institue; 2013.
-
15.
Kumar V, Sun P, Vamathevan J, Li Y, Ingraham K, Palmer L, et al. Comparative genomics of Klebsiella pneumoniae strains with different antibiotic resistance profiles. Antimicrob Agents Chemother. 2011;55(9):4267-76. [PubMed ID: 21746949]. https://doi.org/10.1128/AAC.00052-11.
-
16.
Kim ES, Jeong JY, Choi SH, Lee SO, Kim SH, Kim MN, et al. Plasmid-mediated fluoroquinolone efflux pump gene, qepA, in Escherichia coli clinical isolates in Korea. Diagn Microbiol Infect Dis. 2009;65(3):335-8. [PubMed ID: 19717263]. https://doi.org/10.1016/j.diagmicrobio.2009.07.006.
-
17.
Ma J, Zeng Z, Chen Z, Xu X, Wang X, Deng Y, et al. High prevalence of plasmid-mediated quinolone resistance determinants qnr, aac(6')-Ib-cr, and qepA among ceftiofur-resistant Enterobacteriaceae isolates from companion and food-producing animals. Antimicrob Agents Chemother. 2009;53(2):519-24. [PubMed ID: 18936192]. https://doi.org/10.1128/AAC.00886-08.
-
18.
Hasdemir UO, Chevalier J, Nordmann P, Pages JM. Detection and prevalence of active drug efflux mechanism in various multidrug-resistant Klebsiella pneumoniae strains from Turkey. J Clin Microbiol. 2004;42(6):2701-6. [PubMed ID: 15184455]. https://doi.org/10.1128/JCM.42.6.2701-2706.2004.
-
19.
Bialek-Davenet S, Lavigne JP, Guyot K, Mayer N, Tournebize R, Brisse S, et al. Differential contribution of AcrAB and OqxAB efflux pumps to multidrug resistance and virulence in Klebsiella pneumoniae. J Antimicrob Chemother. 2015;70(1):81-8. [PubMed ID: 25193085]. https://doi.org/10.1093/jac/dku340.
-
20.
Nagasaka Y, Kimura K, Yamada K, Wachino J, Jin W, Notake S, et al. Genetic profiles of fluoroquinolone-nonsusceptible Klebsiella pneumoniae among cephalosporin-resistant K. pneumoniae. Microb Drug Resist. 2015;21(2):224-33. [PubMed ID: 25419619]. https://doi.org/10.1089/mdr.2014.0150.
-
21.
Buffet-Bataillon S, Tattevin P, Maillard JY, Bonnaure-Mallet M, Jolivet-Gougeon A. Efflux pump induction by quaternary ammonium compounds and fluoroquinolone resistance in bacteria. Future Microbiol. 2016;11(1):81-92. [PubMed ID: 26674470]. https://doi.org/10.2217/fmb.15.131.
-
22.
Pakzad I, Zayyen Karin M, Taherikalani M, Boustanshenas M, Lari AR. Contribution of AcrAB efflux pump to ciprofloxacin resistance in Klebsiella pneumoniae isolated from burn patients. GMS Hyg Infect Control. 2013;8(2):15. [PubMed ID: 24327941]. https://doi.org/10.3205/dgkh000215.
-
23.
Alaghehbandan R, Azimi L, Rastegar Lari A. Nosocomial infections among burn patients in Teheran, Iran: a decade later. Ann Burns Fire Disasters. 2012;25(1):3-7. [PubMed ID: 23012608].
-
24.
Rastegar Lari A, Azimi L, Rahbar M, Fallah F, Alaghehbandan R. Phenotypic detection of Klebsiella pneumoniae carbapenemase among burns patients: first report from Iran. Burns. 2013;39(1):174-6. [PubMed ID: 22694870]. https://doi.org/10.1016/j.burns.2012.02.025.
-
25.
Jafari M, Fallah F, Borhan RS, Navidinia M, Rafiei Tabatabaei S, Karimi A. The First Report of CMY, aac(6′)-Ib and 16S rRNA Methylase Genes Among Pseudomonas aeruginosa Isolates From Iran. Arch Pediatr Infect Dis. 2013;1(3):109-12. https://doi.org/10.5812/pedinfect.11392.