Logo

Evaluation of the Virulence Features and Antibiotic Resistance Patterns of Pathogenic Pseudomonas aeruginosa Strains Isolated from Hospitalized Patients in Gonabad, Iran

Author(s):
Alireza MohammadzadehAlireza Mohammadzadeh1, Jalal MardanehJalal Mardaneh1, Reza AhmadiReza Ahmadi2,*, Javad AdabiJavad Adabi3
1Department of Microbiology, School of Medicine, Gonabad University of Medical Sciences, Gonabad, IR Iran
2Department of Internal Medicine, School of Medicine, Gonabad University of Medical Sciences, Gonabad, IR Iran
3Microbiology Laboratory, 22Bahman Hospital, Gonabad University of Medical Sciences, Gonabad, IR Iran

Archives of Pediatric Infectious Diseases:Vol. 5, issue 3; e41267
Published online:Jan 16, 2017
Article type:Research Article
Received:Aug 07, 2016
Accepted:Oct 29, 2016
How to Cite:Mohammadzadeh A, Mardaneh J, Ahmadi R, Adabi J. Evaluation of the Virulence Features and Antibiotic Resistance Patterns of Pathogenic Pseudomonas aeruginosa Strains Isolated from Hospitalized Patients in Gonabad, Iran.Arch Pediatr Infect Dis.2017;5(3):e41267.https://doi.org/10.5812/pedinfect.41267.

Abstract

Background:

Pseudomonas aeruginosa is a ubiquitous microorganism, which is present in diverse environmental niches and is seldom a member of normal human microbiota community. P. aeruginosa is an increasingly problematic drug-resistant bacterium in today’s world. In fact, we are now faced with growing clones of pandrug-resistant P. aeruginosa in hospital settings.

Objectives:

The aim of the present study was to examine the antibiotic resistance patterns and presence of nan1 and int1 virulence genes (encoding neuraminidase and class 1 integrons, respectively) in clinical P. aeruginosa isolates and to analyze the measured values with regard to hospital wards, specimens, and antibiotic resistance of the strains.

Methods:

In this cross sectional study, strains recovered consecutively from different samples of hospitalized patients between 2014 and 2016 in Gonabad, Iran, were tested. Culture of specimens was performed on common bacteriological culture media. The isolates were recognized as P. aeroginosa, based on morphological and biochemical tests. The isolates, identified as presumptive P. aeruginosa, were further confirmed by species-specific polymerase chain reaction (PCR) to detect exoA gene. All the isolates were tested for their antimicrobial susceptibility patterns, using the standard guidelines issued by the clinical and laboratory standards institute (CLSI). Genes encoding the virulence factors (nan1 and int1) were investigated by PCR using specific primers.

Results:

Overall, 95 P. aeruginosa isolates were studied during the study period. The isolates were recovered from 30 (31.6%) males and 65 (68.4%) females. In total, 34 (35.5%) infected patients were in the age group of 30 - 44 years. There were 24 (25.3%) patients hospitalized in the intensive care unit (ICU). A total of 31 (32.6%) strains were isolated from the blood. Colistin was the most effective antibiotic against the isolates, and ticarcillin was the least effective antimicrobial agent. Based on the findings, 21.1% of the P. aeroginosa strains were resistant to the quinolone class of antimicrobial agents. Also, ceftazidime resistance was detected in the isolates (10.5%). Based on the results, 5.26% of the tested isolates were co-resistant to ceftazidime, amikacin, and piperacillin/tazobactam. Among 95 P. aeroginosa isolates on which PCR assay was performed, 44.2% had the nan1 gene.

Conclusions:

Selection of the most effective anti-Pseudomonal drug (including in vitro test and report) is a decision best made by each clinical microbiology laboratory in consultation with the infectious diseases practitioners and pharmacologists, as well as therapeutic and hospital infection control committees. The guidelines for each bacterium include antibiotics of confirmed effectiveness, which show acceptable results in antibiotic susceptibility tests.

1. Background

Pseudomonas aeruginosa is a ubiquitous microorganism which is present in diverse environmental niches and is seldom a member of normal human microbiota community (1). The capability of P. aeruginosa to tolerate different environmental conditions and to survive on minimal nutritional needs has allowed this opportunistic bacterium to survive in both general population and hospital units (2).

During patient hospitalization, colonization rates of this organism may exceed 50%, mainly among individuals who have experienced fracture or trauma in the skin or mucosal barriers due to surgical interventions, indwelling catheters, ventilation systems, tracheostomy, or burns (1, 3). Serious infections with P. aeruginosa are predominantly hospital-acquired. P. aeruginosa is principally problematic for critically ill patients in intensive care units (ICUs) and burn victims (4). This pathogen is a common causative agent of pneumonia (nosocomial pneumonia, ventilator-associated pneumonia, and healthcare-associated pneumonia), bacteremia, and urinary tract, skin, and soft tissue infections (5).

The virulence of P. aeruginosa is associated with the secretion of several cell-associated and extracellular factors. P. aeruginosa possesses a large number of virulence factors, such as exotoxin A, exoenzyme U, exoenzyme S, elastase, neuraminidase, phospholipase C, sialidase, and alkaline protease and exhibits antibiotic resistance. The virulence gene known as nan1 encodes a neuraminidase enzyme, which is responsible for attachment to the host’s respiratory tract.

Neuraminidase is an extracellular factor, known to play a vital role in the implantation of P. aeruginosa (6, 7). Class I integrons (encoded by int1 gene) possess two conserved segments (CS), separated by a variable region including integrated cassettes, which often consist of different antibiotic-resistant genes (7). P. aeruginosa is an increasingly problematic drug-resistant bacterium in today’s world. In fact, we are now faced with growing clones of pandrug-resistant P. aeruginosa in hospital settings, which threaten to move humans into what some consider the “post-antibiotic era” of bacterial diseases, caused by drug-resistant bacteria (8).

P. aeruginosa is a serious therapeutic problem for the treatment of both hospital- (nosocomial) and community-acquired infections; unfortunately, selection of the most effective drug is complicated, considering the capability of this bacterium to show resistance to several classes of antibiotics (9). This opportunistic pathogen owes its intrinsic and acquired resistance (to antimicrobial agents) mostly to the expression of chromosomally encoded efflux pumps, belonging to the so-called resistance-nodulation-cell division (RND) family of multidrug transporters.

P. aeruginosa can gain resistance to other antibacterial compounds either through the acquisition of antibiotic-resistant genes on mobile genetic elements (eg, transposon and plasmid) or by mutational mechanisms which change the expression and/or function of chromosomally encoded mechanisms (10). Not only is the rate of resistance to individual antibiotics or antibiotic classes a concern, but also emergence of multidrug-resistant isolates (resistance to at least three unrelated antibiotic classes) is an even more serious therapeutic problem (11).

Carbapenems (eg, imipenem and meropenem) have a broad spectrum of anti-bacterial activities and are increasingly used as the last-resort antibiotic treatment of serious infections, caused by multi-drug resistant P. aeruginosa isolates (12). Epidemiological research has revealed that diseases caused by drug-resistant P. aeruginosa are associated with a significant increase in the length of hospital stay, intensive care, morbidity, mortality, need for surgical interventions, and the overall cost of treating patients and families (13). Also, antibiotic resistance can emerge during the course of therapy.

Selection of the most appropriate drug to initiate treatment is vital to improving the clinical results. Given the changes in the antibiotic resistance profile of isolates in each region and hospital setting, it is important for each area to formulate its antibiotic stewardship according to the regional resistance patterns. Therefore, in this study, we aimed to study the antibiotic resistance and virulence factors of P. aeruginosa.

2. Objectives

The aim of this study was to examine the antibiotic resistance patterns and presence of nan1 and int1 virulence genes (encoding neuraminidase and class 1 integrons, respectively) in P. aeruginosa clinical isolates and to analyze the values with respect to the hospital wards, specimens, and antibiotic resistance of the strains.

3. Methods

3.1. Isolation and Confirmation of P. aeruginosa Isolates

In this cross sectional study, strains recovered consecutively from different samples (blood, tracheal tube, urine, wound, and sputum) of hospitalized patients in different wards between 2014 and 2016 in Gonabad, Iran, were tested. Briefly, aerobic blood culture was performed, using a manual blood cultivator tube. Aerobic culture of other specimens was performed on common bacteriological culture media, including blood agar (BA), chocolate agar, and MacConkey (MC) agar (Merck Co., Germany). All cultures were maintained under incubation at 35 ± 2°C for 24 hours.

Characterization and identification of bacteria were carried out, based on standard procedures. Bacterial colonies were removed and Gram staining and subcultures were performed on MC agar. The isolates were recognized as P. aeruginosa, based on Gram staining, colony morphology, oxidase test, motility, catalase test, pigment production, triple-sugar iron fermentation, H2S production, urease level, indole test, and citrate utilization test.

For the final confirmation of the isolates, different biochemical tests, embedded in the API-20NE diagnostic system (bioMerieux, France), were applied (4). The isolates identified as presumptive P. aeruginosa were further specified at species level by species-specific polymerase chain reaction (PCR). The isolated strains were stored in brain-heart infusion (BHI) broth (Merck Co., Germany), containing 20% (v/v) glycerol (Merck Co., Germany) at -20°C until the antimicrobial susceptibility test was conducted in the laboratory of clinical microbiology.

3.2. Antibiotic Susceptibility

P. aeruginosa strains were cultured from BHI broth-glycerol stocks on MC medium and were grown overnight at 35 ± 2°C. All the isolates were tested for their antimicrobial susceptibility patterns, using the standard guidelines issued by the clinical and laboratory standards institute (CLSI) (14). All the inoculated plates were incubated for 16-18 hours in an ambient air incubator at 35 ± 2°C, and the results were recorded by measuring the inhibition zone as sensitive (S), intermediate (I), or resistant (R), according to the CLSI guidelines.

Susceptibility to 24 antimicrobial agents (MAST Co., UK) was tested with disc diffusion method on cation-adjusted Mueller-Hinton Agar plates, according to the CLSI recommendations (15). The agents included ciprofloxacin (CIP, 5 μg), cefepime (CPM, 30 μg), doripenem (DOR, 10 μg), norfloxacin (NOR, 5 μg), ofloxacin (OFX, 5 μg), gentamicin (GM, 10 μg), colistin (CO, 10 μg), ceftazidime (CAZ, 30 μg), imipenem (IMP, 10 μg), piperacillin-tazobactam (PTZ, 100/10 μg), piperacillin (PRL, 100 μg), tobramycin (TB, 10 μg), aztreonam (ATM, 30 μg), ticarcillin (TC, 75 μg), amikacin (AK, 30 μg), meropenem (MEM, 10 μg), ticarcillin-clavulanate (TIM, 75/10 μg), and levofloxacin (LEV, 5 μg). For the quality control, P. aeruginosa ATCC 27853 was used.

3.3. PCR Assay

Bacterial DNA extraction: A single pure colony of each isolate was inoculated from the MC agar plate into 5 mL of Mueller-Hinton broth and incubated for 16 to 18 hours at 35 ± 2°C. Subsequently, 1.5 ml of the overnight culture was harvested by centrifugation at 7000 g for 5 minutes. After the supernatant was decanted, the pellet was resuspended in 500 μL of deionized water. The bacterial cells were lysed by heating at 95°C for 10 minutes. Then, bacterial cell debris was removed by centrifugation at 13000 g for 5 minutes. The supernatant of the total sample was applied as the main source of DNA template for PCR reaction (16).

Molecular confirmation of the isolates as P. aeruginosa: For molecular confirmation of the isolates confirmed by conventional tests, PCR was performed. All the isolates, identified as presumptive P. aeruginosa by morphological and biochemical tests, were further confirmed by species-specific PCR to detect the exoA gene. The exoA primer sequences, annealing temperature, and the expected size of amplicon for PCR assay are presented in Table 1. P. aeruginosa ATCC 27853 was used as the positive control.

Table 1. Nucleotide Sequences of Primers and Conditions Used to Amplify Species-Specific and Virulence Markers in P. aeruginosa Isolates by PCR
Virulence FactorTarget GenePrimer NameSequence (5’ to 3’)Length (Base)AnnealingAmplicon Size, pbReferences
Exotoxin AExoAExoA-FGACAACGCCCTCAGCATCACCAGC2468396(15)
ExoA-RCGCTGGCCCATTCGCTCCAGCGCT24
Class 1 integronsInt1Int1-FGTTCGGTCAAGGTTCTG1750923(17)
Int1-RGCCAACTTTCAGCACATG18
Neuraminidasenan1nan1-FACGCTCCGTCCAGCCGGA1860221(18)
nan1-FGTCTGGACGACGGCGGCA18

Nucleotide Sequences of Primers and Conditions Used to Amplify Species-Specific and Virulence Markers in P. aeruginosa Isolates by PCR

Detection of virulence factors and antibiotic resistance markers in P. aeruginosa isolates: Genes encoding the virulence factors (nan1 and int1) were investigated by PCR, using specific primers. The PCR assays have been previously described by other researchers (Table 1). The primer sequences, annealing temperature, and expected size of amplicons for each PCR assay are shown in Table 1 (15, 17, 18). PCR reaction was carried out with 1X PCR buffer, 2 mM of MgCl2, 0.2 mM of deoxyribonucleoside triphosphates (dATP, dCTP, dGTP, and dTTP), 0.25 µM of each primer (forward and reverse primers), 1.5 U of Taq DNA polymerase (Jena Bioscience, Germany), and 3 µL of template DNA in a total volume of 25 µL.

PCR reaction was performed and the amplicons were analyzed by electrophoresis on 1% agarose gel, using tris-borate-EDTA buffer (pH = 8.0). Subsequently, the agarose gel was stained with ethidium bromide and visualized on an ultraviolet transilluminator system. The expected size of amplifications (PCR products) was estimated by comparison with a related DNA ladder (Figures 1 - 3).

Resistance of <i>Pseudomonas aeruginosa</i> Strains Isolated from Hospitalized Patients to the Selected Antimicrobial Agents (Percentage)
Figure 1.

Resistance of Pseudomonas aeruginosa Strains Isolated from Hospitalized Patients to the Selected Antimicrobial Agents (Percentage)

Lane M, 50-bp DNA ladder; Lanes 1 to 3, <i>P. aeruginosa</i>; and Lane 4, <i>P. aeruginosa</i> ATCC 27853 (positive control).
Figure 2.

Lane M, 50-bp DNA ladder; Lanes 1 to 3, P. aeruginosa; and Lane 4, P. aeruginosa ATCC 27853 (positive control).

Lanes: M, 100-bp DNA ladder; 1, 2, 4 and 5, negative samples; 3 and 6, positive samples; C+, positive control (923 bp); and C-, negative control.
Figure 3.

Lanes: M, 100-bp DNA ladder; 1, 2, 4 and 5, negative samples; 3 and 6, positive samples; C+, positive control (923 bp); and C-, negative control.

3.4. Statistical Analysis

Statistical analysis of the results was performed by Pearson’s Chi-square test, and the significance level was set at P < 0.05, using SPSS version 22.

4. Results

4.1. Patient Data

A total of 95 P. aeruginosa isolates were studied during the study period. The isolates were recovered from 30 (31.6%) males and 65 (68.4%) females. Overall, 34 (35.5%) infected patients were included in the age group of 30 - 44 years. There were 24 (25.3%) patients hospitalized in the intensive care unit (ICU). A total of 31 (32.6%) strains were isolated from blood; therefore, blood was the most common specimen from which the isolates were recovered. Table 2 shows the demographic features of the patients infected with P. aeruginosa.

Table 2. Demographic Features of the Patients Infected with P. aeruginosa (N = 95)
CategoriesResultsa
Gender
Male30 (31.6)
Female65 (68.4)
Age, y
< 3010 (10.5)
30 - 4434 (35.5)
45 - 5930 (31.6)
> 6021 (22.1)
Ward
Burn23 (24.2)
Internal medicine23 (24.2)
ICU24 (25.3)
CCU5 (5.3)
Surgery14 (14.7)
Women6 (6.3)
Specimen
Wound18 (18.9)
Sputum7 (7.4)
Blood31 (32.6)
Tracheal tube12 (12.6)
Urine27 (28.4)

Demographic Features of the Patients Infected with P. aeruginosa (N = 95)

4.2. Phenotypic Data and Antibiotic Susceptibility Patterns

As observed on Mueller-Hinton Agar plate, the green and yellow pigments were seen in 75.8% and 20% of the isolates, respectively. According to the in vitro antibiotic susceptibility test, colistin was the most effective antibiotic against the isolates (100% of the isolates were sensitive), while ticarcillin was the least effective antimicrobial agent (43.2% of the isolates were resistant). As revealed, 21.1% of P. aeruginosa strains were resistant to the quinolone class of antimicrobial agents (ciprofloxacin, ofloxacin, norfloxacin, and levofloxacin).

Also, ceftazidime resistance was detected in the isolates (10.5%). Resistance rates for the studied isolates are presented in Figure 1. In the current study, 7.4% of the isolates were resistant to fourth-generation cephalosporins (cefepime). Characteristics of cefepime-resistant P. aeruginosa isolates are shown in Table 3. All these 7 isolates were resistant to ceftazidime and imipenem, and five of them had nan1 virulence factor.

Table 3. Characteristics of Cefepime-Resistant P. aeruginosa Isolates
Isolate No.SpecimenHospital WardPigment ColorVirulence FactorAntimicrobial Susceptibility Pattern
nan1Int1COCAZIMIAKCIPPTZ
3WoundICUGreen--SRRRSR
4WoundBurnNP--SRRRRS
23Tracheal tubeICUGreen+-SRRRRR
34UrineInternalGreen++SRSSRS
53BloodInternalYellow+-SRRRRR
58WoundBurnYellow++SRRRRR
92Tracheal tubeICUYellow+-SRRRRR

Characteristics of Cefepime-Resistant P. aeruginosa Isolates

As multiple antibiotic resistance results were interpreted, about 5.26% of the tested isolates were co-resistant to ceftazidime, amikacin, and piperacillin/tazobactam. Table 4 depicts the multiple antibiotic resistance patterns of the isolates. The most common patterns were TIMR-TCR (31 isolates), followed by TIMR-PTZR (10 isolates) and GEM, TOB, AK (7 isolates).

Table 4. Antibiotic Co-Resistance Patterns of P. aeruginosa Isolated from Hospitalized Patients (n = 95)
PatternAntibiotic Resistance PatternsNo. (%)
AIMI, MEM, CPM, CAZ6 (6.31)
BMEM, NOR, CAZ, TOB5 (5.26)
CCIP, CPM, GEM6 (6.31)
DCIP, CAZ, TOB6 (6.31)
ECAZ, AK, PTZ5 (5.26)
FGEM, TOB, AK7 (7.36)
GIMI, MEM, DOR6 (6.31)
HTIM, PTZ10 (10.52)
ITIM, TC31 (32.63)
JPRL, AK, CAZ5 (5.26)
KAK, TOB, GEM5 (5.26)

Antibiotic Co-Resistance Patterns of P. aeruginosa Isolated from Hospitalized Patients (n = 95)

4.3. Detection of Virulence-Associated Genes

All bacterial isolates, identified as presumptive P. aeruginosa by diagnostic microbiological (morphological and biochemical) tests, were further confirmed by species-specific PCR to detect the exoA gene. Gene exoA was detected in all 95 isolates. Among 95 P. aeruginosa isolates on which PCR assay was performed, approximately 44.2% had nan1 gene. Isolates harboring Int1 gene were only detected in 29 isolates (30.5% of the strains) (Figure 4).

Lane C+, positive control (221 bp); lane C-, negative control; lane M, 100-bp DNA ladder; lane 1 to 3, positive samples.
Figure 4.

Lane C+, positive control (221 bp); lane C-, negative control; lane M, 100-bp DNA ladder; lane 1 to 3, positive samples.

5. Discussion

Treatment of diseases caused by P. aeruginosa has become increasingly difficult. The consecutive increase in the population of immunocompromised patients and the evolutionary features of pathogenic bacteria to promptly mutate and adapt to antibacterial threats in the environment (eg, hospital) make the treatment of bacterial infections a serious problem (1).

This study investigated the demographic and microbiological features of patients infected with P. aeruginosa. In our study, consistent with previous research, the majority of the studied patients were female and older than 30 years (3). This may be due to factors such as differences in the immune system, lifestyle, and professional performance of individuals infected with this opportunistic pathogen. In the present study, patients hospitalized in the ICU were the main susceptible group to P. aeruginosa infections, which is also noted in other studies (19).

The percentage of carbapenem-resistant isolates in the present research is comparable to other studies in Iran (4). Evidently, the prevalence rates vary in different studies, which could be explained by differences in the sample size, distribution of risk factors, and treatment regimen patterns. In the present study, 8.4% of the isolates were imipenem-resistant, similar to previous research (4). Nevertheless, Franco and colleagues reported that 34.5% of blood isolated strains were resistant to imipenem in 2010 (20).

In the current study, 7.36% of the bacteria were resistant to the aminoglycoside antibiotic class (9.5% of the isolates were resistant to amikacin). Raja et al. reported that 6.73% of P. aeruginosa isolates were resistant to amikacin in Malaysia (21), which is in agreement with the present findings. In a multicenter study in Iran, the results showed that 20% of the isolates were resistant to amikacin (4). In another study in Pakistan on P. aeruginosa strains isolated from lower respiratory tract infections, Fatima and colleagues showed that 35% of the isolates were resistant to amikacin (22). Our results showed that 22.1% of the strains were resistant to gentamicin.

The antibiotic resistant patterns reported by Jafari and colleagues showed that 49% of the isolates were resistant to gentamacin (23). Various studies have shown different resistance patterns, which may be due to differences in treatment regimens used for infected patients in healthcare settings. To alleviate the rate of multi-drug resistance (MDR) and spread of resistance, clinicians should switch to therapies with a narrower spectrum. In the current study, 6.31% of the isolates had an IMIR-MEMR-CPMR-CAZR pattern; therefore, these drugs are not suitable for the treatment of P. aeruginosa-related infections. Our findings also showed that all the bacterial strains (100%) were susceptible to colistin. However, the point to be noted is that colistin is a toxic antibiotic and used as a last-line treatment option for the treatment of infections caused by P. aeruginosa.

The frequency of nan1 gene among the tested P. aeruginosa was high (44.2%), which suggests the key role of neuraminidase enzyme in the pathogenesis of this group of isolates. The propagation of virulence-related genes varied with respect to the site of infection in infected patients. In this regard, Mitov et al. reported 15.4% distribution of nan1 gene in wound isolates from patients and a variable frequency rate of the gene in the isolates from different specimens of affected patients (6.7% to 62.5%) (18). In the present study, among 7 cefepime-resistant P. aeruginosa isolates, 5 had the nan1 gene. In our study, the frequency of int1 gene (30.5%) was lower than those reported by Gu et al. in China (40.8%) (24). This may be due to differences in the distribution of antibiotic resistance in various geographical regions.

The point to be noted is that P. aeruginosa is intrinsically resistant to penicillin (ie, benzylpenicillin), first-generation cephalosporin (cephalothin and cefazolin), second-generation cephalosporin (cefuroxime), cephamycin (cefoxitin and cefotetan), ampicillin, amoxicillin, ampicillin-sulbactam, amoxicillin-clavulanate, cefotaxime, ceftriaxone, ertapenem, tetracycline, tigecycline, trimethoprim, trimethoprim-sulfamethoxazole, chloramphenicol, and fosfomycin. Therefore, these drugs are not clinically effective and should not be reported. In fact, intrinsic antibiotic resistance is so common that in vitro susceptibility testing is unnecessary (14).

Today, a major concern of medical and clinical practitioners is the emerging MDR and pandrug-resistant pathogenic bacteria and their associated complications in developing countries (25-28). This is principally true for P. aeruginosa and its capability to emerge as MDR clones. The most difficult challenge of P. aeruginosa infections is its capability to promptly show resistance to several unrelated classes of antibiotics during the period of clinical therapy.

The emerging outbreak of MDR and PDR P. aeruginosa strains is related to different factors, such as its inherent resistance to a variety of antibiotics, its capability to gain antimicrobial resistance determinants, history of surgical interventions and chronic infections, irrational use of antibiotics, and abundance use of broad-spectrum antibiotics, which increase the selection of bacterial resistant clones (27).

Synergistic responses are an important feature of some drug combinations (eg, piperacillin-tazobactam). The main focus of combination-antibiotic therapy against P. aeruginosa is preventing the emergence of antimicrobial resistance and treatment failure. The combination of an anti-Pseudomonal-beta-lactam with an aminoglycoside has been often the therapeutic regimen of choice for this pathogenic bacterium. In this regard, antibiotic resistance trends from large multicenter and national surveillance studies provide important information. It should be also noted that in many cases, antibiotic resistance is transmitted to the human community and healthcare settings through other environmental and food sources (29-35).

Simultaneous determination of antibiotic susceptibility profiles and virulence determinants is a contemporary approach for the examination of microbiological aspects of infections caused by P. aeruginosa. The large sample size of the present study allowed elucidation of statistically significant results with regard to the prevalence of antibiotic resistance and virulence genes in the tested isolates from markedly varying sites and sources of isolation.

Finally, selection of the most effective anti-Pseudomonal drug (including in vitro test and report) is a decision best made by each clinical microbiology laboratory in consultation with the infectious diseases practitioners and pharmacologists, as well as therapeutic and hospital infection control committees.

Acknowledgments

Footnotes

References

  • 1.
    Lister PD, Wolter DJ, Hanson ND. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev. 2009;22(4):582-610. [PubMed ID: 19822890]. https://doi.org/10.1128/CMR.00040-09.
  • 2.
    Schwartz T, Armant O, Bretschneider N, Hahn A, Kirchen S, Seifert M, et al. Whole genome and transcriptome analyses of environmental antibiotic sensitive and multi-resistant Pseudomonas aeruginosa isolates exposed to waste water and tap water. Microb Biotechnol. 2015;8(1):116-30. [PubMed ID: 25186059]. https://doi.org/10.1111/1751-7915.12156.
  • 3.
    Anvarinejad M, Japoni A, Rafaatpour N, Mardaneh J, Abbasi P, Amin Shahidi M, et al. Burn Patients Infected With Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa: Multidrug-Resistant Strains. Arch Trauma Res. 2014;3(2). ee18182. [PubMed ID: 25147779]. https://doi.org/10.5812/atr.18182.
  • 4.
    Poorabbas B, Mardaneh J, Rezaei Z, Kalani M, Pouladfar G, Alami MH, et al. Nosocomial Infections: Multicenter surveillance of antimicrobial resistance profile of Staphylococcus aureus and Gram negative rods isolated from blood and other sterile body fluids in Iran. Iran J Microbiol. 2015;7(3):127-35. [PubMed ID: 26668699].
  • 5.
    Soltani J, Poorabbas B, Miri N, Mardaneh J. Health care associated infections, antibiotic resistance and clinical outcome: A surveillance study from Sanandaj, Iran. World J Clin Cases. 2016;4(3):63-70. [PubMed ID: 26989670]. https://doi.org/10.12998/wjcc.v4.i3.63.
  • 6.
    Lanotte P, Watt S, Mereghetti L, Dartiguelongue N, Rastegar-Lari A, Goudeau A, et al. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J Med Microbiol. 2004;53(Pt 1):73-81. [PubMed ID: 14663109]. https://doi.org/10.1099/jmm.0.05324-0.
  • 7.
    Chen J, Su Z, Liu Y, Wang S, Dai X, Li Y, et al. Identification and characterization of class 1 integrons among Pseudomonas aeruginosa isolates from patients in Zhenjiang, China. Int J Infect Dis. 2009;13(6):717-21. [PubMed ID: 19208492]. https://doi.org/10.1016/j.ijid.2008.11.014.
  • 8.
    Perry J, Waglechner N, Wright G. The Prehistory of Antibiotic Resistance. Cold Spring Harb Perspect Med. 2016;6(6). [PubMed ID: 27252395]. https://doi.org/10.1101/cshperspect.a025197.
  • 9.
    Fair RJ, Tor Y. Antibiotics and bacterial resistance in the 21st century. Perspect Medicin Chem. 2014;6:25-64. [PubMed ID: 25232278]. https://doi.org/10.4137/PMC.S14459.
  • 10.
    Dumas JL, van Delden C, Perron K, Kohler T. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett. 2006;254(2):217-25. [PubMed ID: 16445748]. https://doi.org/10.1111/j.1574-6968.2005.00008.x.
  • 11.
    Mesaros N, Nordmann P, Plesiat P, Roussel-Delvallez M, Van Eldere J, Glupczynski Y, et al. Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin Microbiol Infect. 2007;13(6):560-78. [PubMed ID: 17266725]. https://doi.org/10.1111/j.1469-0691.2007.01681.x.
  • 12.
    Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother. 2006;50(5):1633-41. [PubMed ID: 16641429]. https://doi.org/10.1128/AAC.50.5.1633-1641.2006.
  • 13.
    Hirsch EB, Tam VH. Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert Rev Pharmacoecon Outcomes Res. 2010;10(4):441-51. [PubMed ID: 20715920]. https://doi.org/10.1586/erp.10.49.
  • 14.
    M100-S24. 2014.
  • 15.
    Khan AA, Cerniglia CE. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Appl Environ Microbiol. 1994;60(10):3739-45. [PubMed ID: 7986047].
  • 16.
    Yang JL, Wang MS, Cheng AC, Pan KC, Li CF, Deng SX. A simple and rapid method for extracting bacterial DNA from intestinal microflora for ERIC-PCR detection. World J Gastroenterol. 2008;14(18):2872-6. [PubMed ID: 18473413].
  • 17.
    Lin D, Foley SL, Qi Y, Han J, Ji C, Li R, et al. Characterization of antimicrobial resistance of Pseudomonas aeruginosa isolated from canine infections. J Appl Microbiol. 2012;113(1):16-23. [PubMed ID: 22487022]. https://doi.org/10.1111/j.1365-2672.2012.05304.x.
  • 18.
    Mitov I, Strateva T, Markova B. Prevalence of virulence genes among bulgarian nosocomial and cystic fibrosis isolates of pseudomonas aeruginosa. Braz J Microbiol. 2010;41(3):588-95. [PubMed ID: 24031533]. https://doi.org/10.1590/S1517-83822010000300008.
  • 19.
    Nathwani D, Raman G, Sulham K, Gavaghan M, Menon V. Clinical and economic consequences of hospital-acquired resistant and multidrug-resistant Pseudomonas aeruginosa infections: a systematic review and meta-analysis. Antimicrob Resist Infect Control. 2014;3(1):32. [PubMed ID: 25371812]. https://doi.org/10.1186/2047-2994-3-32.
  • 20.
    Franco MR, Caiaffa-Filho HH, Burattini MN, Rossi F. Metallo-beta-lactamases among imipenem-resistant Pseudomonas aeruginosa in a Brazilian university hospital. Clinics (Sao Paulo). 2010;65(9):825-9. [PubMed ID: 21049207].
  • 21.
    Raja NS, Singh NN. Antimicrobial susceptibility pattern of clinical isolates of Pseudomonas aeruginosa in a tertiary care hospital. J Microbiol Immunol Infect. 2007;40(1):45-9. [PubMed ID: 17332906].
  • 22.
    Fatima A, Naqvi SB, Khaliq SA, Perveen S, Jabeen S. Antimicrobial susceptibility pattern of clinical isolates of Pseudomonas aeruginosa isolated from patients of lower respiratory tract infections. Springerplus. 2012;1(1):70. [PubMed ID: 23397507]. https://doi.org/10.1186/2193-1801-1-70.
  • 23.
    Jafari M, Fallah F, Borhan RS, Navidinia M, Karimi A, Tabatabaei S, et al. The first report of CMY, aac (6′)-Ib and 16S rRNA methylase genes among Pseudomonas aeruginosa isolates from Iran. Arch Pediatr Infect Dis. 2013;1(3):109-12.
  • 24.
    Gu B, Tong M, Zhao W, Liu G, Ning M, Pan S, et al. Prevalence and characterization of class I integrons among Pseudomonas aeruginosa and Acinetobacter baumannii isolates from patients in Nanjing, China. J Clin Microbiol. 2007;45(1):241-3. [PubMed ID: 17122024]. https://doi.org/10.1128/JCM.01318-06.
  • 25.
    Navidinia M. The clinical importance of emerging ESKAPE pathogens in nosocomial infections. J Param Sci. 2016;7(3).
  • 26.
    Nateghian A, Robinson J, Vosough P, Navidinia M, Malekan M, Mehrvar A, et al. Comparison of Antimicrobial Sensitivity to Older and Newer Quinolones versus Piperacillin-Tazobactam, Cefepime and Meropenem in Febrile Patients with Cancer in two Referral Pediatric Centers in Tehran, Iran. Mediterr J Hematol Infect Dis. 2014;6(1). ee2014045. [PubMed ID: 25045453]. https://doi.org/10.4084/MJHID.2014.045.
  • 27.
    Meletis G, Exindari M, Vavatsi N, Sofianou D, Diza E. Mechanisms responsible for the emergence of carbapenem resistance in Pseudomonas aeruginosa. Hippokratia. 2012;16(4):303-7. [PubMed ID: 23935307].
  • 28.
    Vaez H, Faghri J, Nasr Esfahani B, Moghim S, Fazeli H, Sedighi M, et al. Antibiotic Resistance Patterns and Genetic Diversity in Clinical Isolates of Pseudomonas aeruginosa Isolated From Patients of a Referral Hospital, Isfahan, Iran. Jundishapur J Microbiol. 2015;8(8). ee20130. [PubMed ID: 26468363]. https://doi.org/10.5812/jjm.20130v2.
  • 29.
    Mardaneh J, Soltan Dallal MM, Taheripoor M, Rajabi Z. Isolation, Identification and Antimicrobial Susceptibility Pattern of Tatumella ptyseos Strains Isolated From Powdered Infant Formula Milk Consumed in Neonatal Intensive Care Unit: First Report From Iran. Jundishapur J Microbiol. 2014;7(6). ee10608. [PubMed ID: 25371802]. https://doi.org/10.5812/jjm.10608.
  • 30.
    Shaghaghian S, Pourabbas B, Alborzi A, Askarian M, Mardaneh J. Vancomycin-Resistant Entrococci colonization in chronic hemodialysis patients and its risk factors in southern Iran (2005-2006). Iran Red Crescent Med J. 2012;14(10):686-91. [PubMed ID: 23285424].
  • 31.
    Mardaneh J, Soltan-Dallal MM. Isolation and Identification of E. cowanii from Powdered Infant Formula in NICU and Determination of Antimicrobial Susceptibility of Isolates. Iran J Pediatr. 2014;24(3):261-6. [PubMed ID: 25562018].
  • 32.
    Mardaneh J, Dallal MM. Isolation, identification and antimicrobial susceptibility of Pantoea (Enterobacter) agglomerans isolated from consumed powdered infant formula milk (PIF) in NICU ward: First report from Iran. Iran J Microbiol. 2013;5(3):263-7. [PubMed ID: 24475334].
  • 33.
    Anvarinejad M, Pouladfar GR, Pourabbas B, Amin Shahidi M, Rafaatpour N, Dehyadegari MA, et al. Detection of Salmonella spp. with the BACTEC 9240 Automated Blood Culture System in 2008 - 2014 in Southern Iran (Shiraz): Biogrouping, MIC, and Antimicrobial Susceptibility Profiles of Isolates. Jundishapur J Microbiol. 2016;9(4). ee26505. [PubMed ID: 27284396]. https://doi.org/10.5812/jjm.26505.
  • 34.
    Mardaneh J, Soltan Dallal MM. Isolation and Identification Enterobacter asburiae from Consumed Powdered Infant Formula Milk (PIF) in the Neonatal Intensive Care Unit (NICU). Acta Med Iran. 2016;54(1):39-43. [PubMed ID: 26853289].
  • 35.
    Mardaneh J, Soltan Dallal MM. Study of Cronobacter sakazakii Strains Isolated from Powdered Milk Infant Formula by Phenotypic and Molecular Methods in Iran. Arch Pediatr Infect Dis. 2016;5(1). https://doi.org/10.5812/pedinfect.38867.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles