Cover image of the article: Genotypes of the Congo-Crimean Hemorrhagic Fever Virus Occurring in the Turkestan Region

Image Credit:Arch Clin Infect Dis

Genotypes of the Congo-Crimean Hemorrhagic Fever Virus Occurring in the Turkestan Region

Authors

Gulzhan Narkenovna AbuovaGulzhan Narkenovna Abuova ORCID1,*, Natalia PshenichnayaNatalia Pshenichnaya ORCID2, Ludmila Stanislavovna Karan'Ludmila Stanislavovna Karan' ORCID2, Farida Abdullaevna Berdaliyeva3, Daulet Sabyrovich Aliyev3, Dana Kayratovna Sadyhova3, Tatyana Vasiliyevna PolukchiTatyana Vasiliyevna Polukchi ORCID3, Symbat Doszhanovna Nurmagambet3
1South Kazakhstan Medical Academy, Shymkent, Kazakhstan
2Central Research Institute of Epidemiology, Moscow, Russia
3South Kazakhstan Medical Academy, Shymkent, Kazakhstan
*Corresponding Author: Department of Infectious Diseases and Dermatovenerology, South Kazakhstan Medical Academy, Shymkent, Kazakhstan. Email: [email protected]

Archives of Clinical Infectious Diseases:Vol. 17, issue 6; e129126
Published online:Dec 11, 2022
Article type:Research Article
Received:Nov 02, 2022
Accepted:Nov 06, 2022
How to Cite:Abuova GN, Pshenichnaya N, Karan' LS, Berdaliyeva FA, Aliyev DS, et al. Genotypes of the Congo-Crimean Hemorrhagic Fever Virus Occurring in the Turkestan Region. Arch Clin Infect Dis. 2022;17(6):e129126. doi: https://doi.org/10.5812/archcid-129126

Abstract

Background:

The Turkestan region of Kazakhstan is the natural focus of the Congo-Crimean hemorrhagic fever (CCHF). Every year, some of the patients treated in hospitals are not included in official statistics and remain in the group of possible cases of CCHF.

Objectives:

This study aimed to verify the genotypes of the CCHF virus (CCHFV) in the Turkestan region and Shymkent City.

Methods:

Twelve blood samples from patients with CCHF were studied, the diagnosis of which was verified on the basis of positive specific immunoglobulins IgM to the virus. To isolate viral RNA, we used a special MAGNO-sorb kit. To detect RNA, CCHFV was used with a set of Amplisens CCHFV-FL by real-time polymerase chain reaction (PCR) using a Rotor-Gene Q device. For the reverse transcription reaction, we used a set of Reverta-L.

Results:

The study of the genome sequence of CСHFV from GenBank demonstrated that isolates from the Turkestan region belonged to genetic groups Asia-1 and Asia-2.

Conclusions:

For the first time in Kazakhstan’s history, a phylogenetic analysis of RNA sequences of viruses from patients with CCHF was performed in the Turkestan region, as a result of which genetic groups Asia-1, reassortant Asia-1, and Asia-2 were established

Highlights

1. Background

The Turkestan region of Kazakhstan is the endemic focus of the Congo-Crimean hemorrhagic fever (CCHF) (1). According to official statistics, 46 cases of CCHF were registered in the Turkestan region from 2016 to 2021 (2). Every year, some of the patients treated in hospitals are not included in the official statistics and remain in the group of possible cases of CCHF. The mortality rate in the region in some years varied between 14 - 30% (3). The heterogeneity of clinical manifestations and the different severity of the condition of patients with the corresponding severity of the outcomes of the CCHF are associated with the diversity of circulating genotypes of the virus in different countries (4-6). In Kazakhstan, only 1 study was conducted in the endemic (Kyzylorda) and non-endemic (Almaty) regions to identify the serological prevalence of the CCHF virus (CCHFV). A phylogenetic analysis of partial L and S segments showed the Asia-2 CCHF genotype and possible reassortment between Asia-1 and Asia-2 genotypes (7). Due to the lack of knowledge and the structure of the pathogen in the southern regions of Kazakhstan, an in-depth study of CCHFV is needed to analyze the phylogenetic tree of the RNA sequences of CCHFV in the Turkestan region and Shymkent City.

2. Objectives

This study aimed to verify the genotypes of CCHF in the Turkestan region and Shymkent City.

3. Methods

Twelve blood samples from patients with CCHF were studied, the diagnosis of which was verified on the basis of positive specific immunoglobulins IgM to the virus.
To isolate viral RNA, we used a special MAGNO-sorb kit, which was made by the Central Research Institute of Epidemiology, Moscow, Russian Federation, from 300-500 µL of blood samples. To detect RNA, CCHFV was carried out with a set of Amplisens CCHFV-FL by real-time polymerase chain reaction (PCR) using a Rotor-Gene Q device (Central Research Institute of Epidemiology, Russian Federation). For the reverse transcription reaction, we used a set of Reverta-L (Central Research Institute of Epidemiology, Moscow, Russian Federation) according to the manufacturer’s instructions. Amplicons for sequencing were obtained with the primers listed in Table 1. The S and M segments of virus RNA were sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, USA) using a kit of reagents BigDye V3.1. A phylogenetic analysis of RNA sequences was performed using MEGA X software.
Table 1.
Primers Used Complementary DNA for Congo-Crimean Hemorrhagic Fever Virus Sequencing
Name of the Primer5” – 3” SequenceSegment
CCHFV-S-F23TACGCCCACAGTGTTCTCTTGAGTS
CCHFV-S-R756CCTGTTGCAACAAGTGCTATTCCT
CCHFV-S-F645CGAGGCCCAGTGAGCCGTGAACA
CCHFV-S-R1234TCCAAAGCAGACACCCATCTCACT
CCHFV-S-F1094GCACTCTTGAGCACCCCAATGAA
CCHFV-S-R1660CGCACAGCCCTTTAAGTGTTT
CCHFV-M-F1256ATGTCACTCGACATTCAACTAGAATAGM
CCHFV-M-R1927TAGGCAATAACCCTGCCTGCA
CCHFV-M-F1862AGTGCCACAGGGAAGAGCTGTGA
CCHFV-M-R2446AGGGCAATGAGTTACATGCCTAGCA
CCHFV-M-F2368CTGCAGTTACAACATATGTCCCTA
CCHFV-M-R3099TCCATCTCTACTGCTGAAGTGCT
CCHFV-M-F2920TCATCAAYTGCACTTGAGCATCTGC
CCHFV-M-R3613TGGGCAGTCACCTGTACAGGTT
CCHFV-M-F3564TGTCTTCGAGTACTTGTCAGGTGA
CCHFV-M-R4332TGTGGTGTGTCTCCATGTGCAG

4. Results

Of the 12 blood serum samples, CCHFV RNA was found in 10 blood serum samples (Figure 1). The concentration range of viral RNA was 30 to 107 copies/mL. For samples with a viral RNA concentration above 104 copies/mL, parts of the S and M segments of CCHFV with lengths of 1530 and 2920 nucleotides, respectively, were genotyped. The study of the genome sequence of CСHFV from GenBank demonstrated that isolates from the Turkestan region belonged to genetic groups Asia-1 (sample 20) and Asia-2 (samples 5, 8, 10, 18; Figures 2 and 3).
The result of the detection of Congo-Crimean hemorrhagic fever virus RNA in the blood
Figure 1.
The result of the detection of Congo-Crimean hemorrhagic fever virus RNA in the blood
A phylogenetic analysis of fragments of the S segment of the Congo-Crimean hemorrhagic fever virus with a length of 1530 base pairs for the samples studied in this work, as well as for sequences from GenBank and the National Center for Biotechnology Information. The analysis was performed using neighbor-joining methods and the Tamura 3-parameter + G model, with bootstrap support of 500
Figure 2.
A phylogenetic analysis of fragments of the S segment of the Congo-Crimean hemorrhagic fever virus with a length of 1530 base pairs for the samples studied in this work, as well as for sequences from GenBank and the National Center for Biotechnology Information. The analysis was performed using neighbor-joining methods and the Tamura 3-parameter + G model, with bootstrap support of 500
A phylogenetic analysis of fragments of the M segment of the Congo-Crimean hemorrhagic fever virus with a length of 2920 base pairs for the samples studied in this work, as well as for fragments with a length of 2920 base pairs for sequences from GenBank and the National Center for Biotechnology Information. The analysis was performed using neighbor-joining methods and the Tamura 3-parameter+G model, with bootstrap support of 500
Figure 3.
A phylogenetic analysis of fragments of the M segment of the Congo-Crimean hemorrhagic fever virus with a length of 2920 base pairs for the samples studied in this work, as well as for fragments with a length of 2920 base pairs for sequences from GenBank and the National Center for Biotechnology Information. The analysis was performed using neighbor-joining methods and the Tamura 3-parameter+G model, with bootstrap support of 500

5. Discussion

Thus, in the Turkestan region of Kazakhstan, CCHFVs are circulating, corresponding to those in the endemic (Kyzylorda) and non-endemic (Almaty) regions of Kazakhstan, where the Asia-2 CCHF genotype and the reassortant between the Asia-1 and Asia-2 genotypes have been identified (7). In addition, the Asia-2 genotype shows its dominant position in the Turkestan region, as well as in China, Tajikistan, Uzbekistan, and Turkmenistan (8). As isolates belong to the Asia-1 genotype and taking into account the southernmost location of the region in the country, it can be assumed that there is a possible migration of this genotype of the virus from the countries of the Middle East, in particular Iran, where the Asia-1 genotype belonging to line IV is mainly registered (9), as well as Pakistan, Oman, Afghanistan, where the genotype of the Asia-1 virus also prevails (10).

5.1. Conclusions

For the first time in Kazakhstan’s history, a phylogenetic analysis of RNA sequences of viruses from patients with CCHF was performed in the Turkestan region, as a result of which genetic groups Asia-1, reassortant Asia-1, and Asia-2 were established.

Footnotes

  • Authors' Contribution: Study concept and design: Abuova G.N. Acquisition of data: Pshenicnaya N.Yu. Analysis and interpretation of data: Каran’ L.S. Drafting of the manuscript: Berdaliyeva F.А. and Aliyev D.S. Critical revision of the manuscript for important intellectual content: Berdaliyeva F.А. and Aliyev D.S. Statistical analysis: Sadyhova D.К. and Polukchi Т.V. Administrative, technical, and material support: Nurmagambet S.D. Study supervision: Abuova G.N.

  • Clinical Trial Registration Code: NCT00000161.

  • Conflict of Interests: The authors declare that they have no competing financial interests.

  • Funding/Support: The authors declare that they have no competing financial interests.

References

  • 1.
    Ermakova EL, Khodzhabekov KB, Berdalieva BF, Pshenichnaya PN, Abuova AG. [Prediction of an outcome in Crimean hemorrhagic fever]. Epidemiol Infect Dis. 2019;4_2019:28-34. Russian. https://doi.org/10.18565/epidem.2019.9.4.28-34.
  • 2.
    Berdalieva FA, Abuova GN, Aliev DS, Aueskhanov SP, Raimkulov GS. [Clinical aspects of Crimean-Congo hemorrhagic fever in patients in the Turkestan region]. [International Scientific and Practical Conference]. November 13-14, 2020; Ufa, Russia. Fundamental and Applied Aspects of Immunology, Genetics and Infectology; 2020. p. 41-7. Russian.
  • 3.
    Messina JP, Pigott DM, Golding N, Duda KA, Brownstein JS, Weiss DJ, et al. The global distribution of Crimean-Congo hemorrhagic fever. Trans R Soc Trop Med Hyg. 2015;109(8):503-13. [PubMed ID: 26142451]. [PubMed Central ID: PMC4501401]. https://doi.org/10.1093/trstmh/trv050.
  • 4.
    Say Coskun US, Asik Z. Genotypic analysis of S segment of Crimean-Congo hemorrhagic fever virus in Turkey. Acta Microbiol Immunol Hung. 2019;66(1):79-89. [PubMed ID: 30203691]. https://doi.org/10.1556/030.65.2018.041.
  • 5.
    Akinci E, Bodur H, Sunbul M, Leblebicioglu H. Prognostic factors, pathophysiology and novel biomarkers in Crimean-Congo hemorrhagic fever. Antiviral Res. 2016;132:233-43. [PubMed ID: 27378224]. https://doi.org/10.1016/j.antiviral.2016.06.011.
  • 6.
    Nasirian H. New aspects about Crimean-Congo hemorrhagic fever (CCHF) cases and associated fatality trends: A global systematic review and meta-analysis. Comp Immunol Microbiol Infect Dis. 2020;69:101429. [PubMed ID: 32062190]. https://doi.org/10.1016/j.cimid.2020.101429.
  • 7.
    Abdiyeva K, Turebekov N, Dmitrovsky A, Tukhanova N, Shin A, Yeraliyeva L, et al. Seroepidemiological and molecular investigations of infections with Crimean-Congo haemorrhagic fever virus in Kazakhstan. Int J Infect Dis. 2019;78:121-7. [PubMed ID: 30522982]. https://doi.org/10.1016/j.ijid.2018.10.015.
  • 8.
    Bente DA, Forrester NL, Watts DM, McAuley AJ, Whitehouse CA, Bray M. Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical syndrome and genetic diversity. Antiviral Res. 2013;100(1):159-89. [PubMed ID: 23906741]. https://doi.org/10.1016/j.antiviral.2013.07.006.
  • 9.
    Chinikar S, Bouzari S, Shokrgozar MA, Mostafavi E, Jalali T, Khakifirouz S, et al. Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran. J Arthropod Borne Dis. 2016;10(2):127-40. [PubMed ID: 27308271]. [PubMed Central ID: PMC4906752].
  • 10.
    Umair M, Khurshid A, Alam MM, Akhtar R, Salman M, Ikram A. Genetic diversity and phylogenetic analysis of Crimean-Congo Hemorrhagic Fever viruses circulating in Pakistan during 2019. PLoS Negl Trop Dis. 2020;14(6). e0008238. [PubMed ID: 32598383]. [PubMed Central ID: PMC7351229]. https://doi.org/10.1371/journal.pntd.0008238.

Copyright

Copyright © 2022, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

12
Feb
2018

Spatial and Phylodynamic Survey on Crimean-Congo Hemorrhagic Fever Virus Strains in Northeast of Iran

Faezeh Faghihi,
Zakkyeh Telmadarraiy,
Sadegh Chinikar,
Norbert Nowotny,
Anthony R. Fooks,
Nariman Shahhosseini

Faghihi F, Telmadarraiy Z, Chinikar S, Nowotny N, Fooks AR, et al. Spatial and Phylodynamic Survey on Crimean-Congo Hemorrhagic Fever Virus Strains in Northeast of Iran. Jundishapur J Microbiol. 2018;11(3):e59412. doi: https://doi.org/10.5812/jjm.59412

10
May
2016

Epidemiological Survey of Crimean-Congo Hemorrhagic Fever (CCHF), a Fatal Infectious Disease in Khuzestan Province, Southwest Iran, During 1999 - 2015

Mona Sharififard,
Sayed Mohammad Alavi,
Shokrollah Salmanzadeh,
Farhad Safdari,
Amin Kamali

Sharififard M, Alavi SM, Salmanzadeh S, Safdari F, Kamali A. Epidemiological Survey of Crimean-Congo Hemorrhagic Fever (CCHF), a Fatal Infectious Disease in Khuzestan Province, Southwest Iran, During 1999 - 2015. Jundishapur J Microbiol. 2016;9(5):e30883. doi: https://doi.org/10.5812/jjm.30883

8
Jul
2023
Evaluation of Crimean-Congo Hemorrhagic Fever in Kermanshah (2006 - 2020)

Evaluation of Crimean-Congo Hemorrhagic Fever in Kermanshah (2006 - 2020)

Mohammad Hossein Zamanian,
Roghayeh Nouri,
Maria Shirvani,
Zeinab Mohseniafshar,
Ronak Miladi,
Roknedin Mehdizad
,et al.

Zamanian MH, Nouri R, Shirvani M, Mohseniafshar Z, Miladi R, et al. Evaluation of Crimean-Congo Hemorrhagic Fever in Kermanshah (2006 - 2020). Zahedan J Res Med Sci. 2023;25(3):e128662. doi: https://doi.org/10.5812/zjrms-128662

31
Mar
2024
Investigation of Epidemiological Factors and Clinical Pathology in Suspected and Affected Patients with Crimean Congo Hemorrhagic Fever (CCHF) in Ahvaz

Investigation of Epidemiological Factors and Clinical Pathology in Suspected and Affected Patients with Crimean Congo Hemorrhagic Fever (CCHF) in Ahvaz

Safa Najafi,
Sirous Rafiei Asl,
Forough Kajbaf,
Zahra Changizi,
Zahra Abbasipour

Najafi S, Rafiei Asl S, Kajbaf F, Changizi Z, Abbasipour Z. Investigation of Epidemiological Factors and Clinical Pathology in Suspected and Affected Patients with Crimean Congo Hemorrhagic Fever (CCHF) in Ahvaz. J Inflamm Dis. 2024;28(1):e153345. doi: https://doi.org/10.69107/jid-153345

11
Dec
2016

An Outbreak of Crimean-Congo Hemorrhagic Fever in the South West of Iran

Mostafa Salehi-Vaziri,
Shokrollah Salmanzadeh,
Vahid Baniasadi,
Tahmineh Jalali,
Tahereh Mohammadi,
Sanam Azad-Manjiri
,et al.

Salehi-Vaziri M, Salmanzadeh S, Baniasadi V, Jalali T, Mohammadi T, et al. An Outbreak of Crimean-Congo Hemorrhagic Fever in the South West of Iran. Jundishapur J Microbiol. 2017;10(1):e60196. doi: https://doi.org/10.5812/jjm.41735

More by these authors

Gulzhan Narkenovna AbuovaPubMedScholar
Natalia PshenichnayaPubMedScholar
Ludmila Stanislavovna Karan'PubMedScholar
Farida Abdullaevna BerdaliyevaPubMedScholar
Daulet Sabyrovich AliyevPubMedScholar
Dana Kayratovna SadyhovaPubMedScholar
Tatyana Vasiliyevna PolukchiPubMedScholar
Symbat Doszhanovna NurmagambetPubMedScholar
Share
Cited by
Metrics