Logo

Image Credit:

Extended-Spectrum Beta-Lactamases Producing Pseudomonas aeruginosa Isolated From Patients With Ventilator Associated Nosocomial Infection

Author(s):
Mohammad Sadegh RezaiMohammad Sadegh Rezai1, Fatemeh AhangarkaniFatemeh AhangarkaniFatemeh Ahangarkani ORCID2, Alireza RafieiAlireza Rafiei3, Azin HajalibeigAzin Hajalibeig1, Masoumeh Bagheri-NesamiMasoumeh Bagheri-NesamiMasoumeh Bagheri-Nesami ORCID1,*
1Pediatric Infectious Diseases Research Center, Mazandaran University of Medical Sciences, Sari, Iran
2Student Research Committee, Antimicrobial Resistance Research Center, Mazandaran University of Medical Sciences, Sari, Iran
3Department of Immunology, Molecular and Cell Biology Research Center, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran


Archives of Clinical Infectious Diseases:Vol. 13, issue 4; e13974
Published online:Aug 05, 2018
Article type:Research Article
Received:May 23, 2017
Accepted:Dec 10, 2017
How to Cite:Mohammad Sadegh RezaiFatemeh AhangarkaniAlireza RafieiAzin HajalibeigMasoumeh Bagheri-NesamiExtended-Spectrum Beta-Lactamases Producing Pseudomonas aeruginosa Isolated From Patients With Ventilator Associated Nosocomial Infection.Arch Clin Infect Dis.13(4):e13974.https://doi.org/10.5812/archcid.13974.

Abstract

Background:

Ventilator-associated infections caused by extended-spectrum beta-lactamases (ESBL)-producing Pseudomonas aeruginosa leads to severe complications.

Objectives:

This research evaluated ESBL-producing P. aeruginosa carrying integron class 1 and class 2 isolated from patients with ventilator-associated nosocomial infections, admitted in to the intensive care unit (ICU) of eighteen hospitals in the north of Iran.

Methods:

The antibiotic susceptibility test was performed using minimum inhibitory concentration (MIC). The ESBL isolates were tested by the polymerase chain reaction (PCR) for the presence or absence of CTX, VEB, SHV, GES, and integron class 1 and 2 genes.

Results:

Out of the total of 205 patients at the ICUs with nosocomial infections (NIs), ESBL-producing P. aeruginosa was responsible for 14.63% of NIs. The prevalence of ventilator-associated infection for ventilator-associated pneumonia (VAP) was (25 patients) 83.33%, also 16.6% (five patients) had sepsis due to VAP. Distribution of CTX, VEB, SHV, and GES genes was 13 (43.33%), four (13.33%), ‎26 (86.66%), and zero (0%), respectively‎. The strains carrying integron class 1 and class ‎‎2‎ were 26 (86.66%) and two (6.66%), respectively. Regarding ESBL genes, six types of strains were observed to carry these genes.

Conclusions:

The presence of P. aeruginosa isolates containing different ESBL genes isolated from patients admitted to ICUs of eighteen hospitals, signifies the importance of employing antimicrobial stewardship in hospitals for avoiding unnecessary antibiotics prescription for empiric therapy, especially for critically ill patients at the ICUs.

1. Background

Patients requiring intensive care unit (ICU) admission are prone to nosocomial infections (NIs), five to seven-fold more compared to general hospital wards (1). In spite of significant changes in the spectrum of microorganisms causing ICU-associated NIs, Pseudomonas aeruginosa has held a nearly unchanged position in the rank order of pathogens causing ICU-related NIs during the last four decades, especially among patients, who have undergone mechanical ventilation (2-4). Furthermore, ventilator-associated pneumonia (VAP) caused by P. aeruginosa remains a severe and dreaded complication. Risk of mortality and morbidity in VAP is increased due to wrong or delayed initial antibiotic therapy, especially when VAP is caused by multidrug-resistant pathogens (5). Eighty-six percent of nosocomial cases of pneumonia are associated with VAP. The mortality due to VAP has been reported to range between 0% and 50% (6). Compared with community-acquired strains, nosocomial P. aeruginosa isolates tend to be more resistant (2). Nowadays, antimicrobial resistance is a major problem for the treatment and management of NIs, especially for patients admitted to ICUs (7). Patients with drug-resistant organisms are at risk of negative outcome. Pseudomonas aeruginosa is naturally resistant to many antimicrobial agents and it can also acquire resistance against available antibiotics through multiple mechanisms (8). Furthermore, ESBL-producing bacteria cause serious infections and have high mortality rates. ESBL-bacteria are capable of efficiently hydrolyzing many beta-lactam antibiotics, including cephalosporins and monobactams (9, 10). The most commonly encountered ESBLs are derived from the sulf-hydryl variable (SHV), cefotaxime-beta lactamases (CTX), vietnam extended-spectrum β-lactamase (VEB), and Guyana extended-spectrum ß-lactamases (GES) genes (11-14). Integrons are one of the mobile genetic elements, which are able to carry genes for resistance to different antibiotics. Integrons are divided to four classes based on the type of integrase genes. Resistance genes, which are located in the gene cassettes, can be separated and entered to other integrons. This is an important phenomenon in the creation and distribution of new resistance cassettes. Importance of association of multidrug resistance and presence of integron plays an important role in the development of multiple resistance (15-17). A shift in the distribution of ESBL-producing strains has recently occurred with reports from North America, Europe, South America, Africa, and Asia, with a dramatic increase of CTX, TEM, and SHV variants (18-21). Also, the incidence of ESBL-producing strains has increased in different geographic regions of Iran, such as north of Iran (9, 10, 22-32).

2. Objectives

Designing a control program will require insight of a range of disciplines, including epidemiology, molecular biology, and evolutionary biology of resistance genes. Regarding the clinical importance of class 1 and 2 integrons in antibiotic resistance and considering that there are no reports available on prevalence of integrons as mobile genetic elements carrying antibiotic resistance gene cassette in ESBL P. aeruginosa isolated from ventilator-associated NIs in ICU wards of northern Iran, this study attempted to screen for ESBL genes, and confirm their resistant characteristics.

3. Methods

3.1. Study Population and Specimen Types

This study was conducted at 18 hospitals in Mazandaran province, north of Iran, with 1200 ward beds and 100 intensive care unit beds during years 2014 and 2015. This study was approved by the ethics committee of Mazandaran University of Medical Sciences (Code No: 879 Date: July 9, 2014). For all patients, samples were taken within 48 hours of admission from mechanical ventilation. Non-duplicate isolates of P. aeruginosa were collected from various specimens of all patients with microbiologically confirmed ventilator-associated NIs. All patients aged 18 years and older with ventilation for at least 48 hours were assessed daily for evidence of ventilator-associated NIs. Patients, who were chronically mechanically ventilated were excluded. Only microbiologically confirmed episodes of VAP were considered for analysis.

3.2. Microbiological Methods

All samples were routinely cultured on MacConkey and blood agar plates. Blood samples were cultured in blood culture bottles. Isolates were identified at the species level using standard biochemical tests and microbiological methods (33).

3.3. Antibiotic Susceptibility

Susceptibility of the clinical isolates to routinely used antibiotics was determined by the standard broth dilution (microdilution broth) technique. The minimal inhibitory concentrations (MIC) was determined according to the recommendations of clinical and laboratory standards institute 2010 (CLSI). The antibiotics that were used were amikacin, ciprofloxacin, imipenem, gentamicin, ceftazidime, tobramycin, piperacillin-tazobactam, cefepime, colistin, and co-trimoxazole. The antibiotics were purchased from Sigma chemical company.

3.4. Detection of ESBL-Producing Pseudomonas aeruginosa

To screen for ESBL-producing strains with MIC of > 8 μg/mL to cephalosporins, at least one of them including cefotaxime, cefepime, ceftazidime, and ceftriaxone were tested using the double-disk synergy test. The presence of ESBL was assayed, using the following antibiotic disks: cefotaxime (30 μg), cefotaxime/clavulanic acid (30/10 μg), ceftazidime (30 μg), and ceftazidime/clavulanic acid (30/10 μg) (MAST, UK). Escherichia coli ATCC 25922 strains served as positive controls (9, 25, 34).

3.5. DNA Isolation and Genotyping

Bacterial DNA was extracted using a commercial gene extraction kit (Takapou Zist, Iran), according to the company’s recommendation. Then, ESBL-positive strains were screened for CTX, VEB, GES, SHV, and integron class 1 and class 2 genes performed by PCR amplification. The primer sequences and PCR annealing temperature are shown in Table 1. In all experiments, the following reference strains were used as positive controls: K. pneumoniae 7881 (CTXM), K. pneumoniae 7881 strain (containing SHV), P. aeruginosa ATCC 27853 (VEB-1), and K. pneumoniae (containing GES), which were kindly provided by Professor P. Nordmann CHU Bicetre, France. Escherichia coli 96K062 was used as a positive control for class 1 and 2 integrons. A non-ESBL-producing strain (E. coli ATCC 25922) was used as a negative control.

Table 1.The Sequences of Primers and Thermal Condition Used in PCR Amplification
Target GenesPrimer Used (5’ - 3’)RefThermal Cycling ConditionPCR Product Size
CTXTTTGCGATGTGCAGTACCAGTAA(35)94°C 5 min → 40 × [94°C 45 sec, 53.1°C 45 sec, 72°C 1 min] → 72°C 7 min593 bp
CGATATCGTTGGTGGCATA
VEBCGACTTCCATTTCCCGATGC(36)93°C 3 min → 40 × [93°C 1 min, 54.9°C 1 min, 72°C 1 min] → 72°C 7 min585 bp
GGACTCTGCAACAAATACGC
GESATGCGCTTCATTCACGCAC(37)1 cycle of 5 min at 95°C; 30 cycles of 1 min at 95°C, 45 sec at 55°C, 30 sec at 72°C; 1 cycle of 8 min at 72°C846 bp
CTATTTGTCCGTGCTCAGG
SHVAAGATCCACTATCGCCAGCAG(38)1 cycle of 3 min at 94°C; 35 cycles of 30 sec at 94°C, 1 min at 60°C, 1 min at 72°C; 1 cycle of 7 min at 72°C231 bp
ATTCAGTTCCGTTTCCCAGCGG
INT1CAGTGGACATAAGCCTGTTC(39)1 cycle of 2 min at 94°C; 35 cycles of 30 sec at 94°C, 30 sec at 55°C, 30 sec at 72°C; 1 cycle of 3 min at 72°C160 bp
CCCGAGGCATAGACTGTA
INT2TTGCGAGTATCCATAACCTG(40)1 cycle of 5 min at 95°C; 30 cycles of 45 sec at 94°C, 40 sec at 58°C, 1 min at 72°C; 1 cycle of 7 min at 72°C288 bp
TTACCTGCACTGGATTAAGC

The Sequences of Primers and Thermal Condition Used in PCR Amplification

3.6. Statistical Analysis

The SPSS software version 16 and descriptive tests, such as frequency analysis and median value, were used for statistical analysis.

4. Results

From a total of 205 hospitalized patients with NIs at ICUs of eighteen hospitals during years 2014 and 2015, thirty patients had ventilator-associated nosocomial infection caused by ESBL-producing P. aeruginosa. Seventeen patients (56.7%) were male and 13 (43.3%) were female. The average age was 54.47 ± 30 years old. The average duration of hospitalization at ICU wards was 29 ± 13.5 days. The prevalence of ventilator-associated infection for VAP was (25 patients) 83.33%; also, 16.6% (five patients) had sepsis due to VAP. Distribution of CTX, VEB, and SHV genes in ESBL-producing P. aeruginosa was 13 (43.33%), four (13.33%), ‎and 26 (86.66%), respectively. The ESBL-producing P. aeruginosa carrying integron class 1 and class ‎‎2‎ were 26 (86.66%) and two (6.66%), respectively. Figure 1 and 2 show the agarose gel of the strains containing ESBL and Integrons gene, respectively. Fourteen strains contained the SHV gene, thirteen strains contained two ESBL genes (10 strains had CTX and SHV, two strains had VEB and SHV, and one strain had VEB and CTX), two strains contained three ESBL genes (VEB, CTX, and SHV), and one strain had only CTX gene. The presence or absence of ESBL genes, susceptibility, and resistance to different antimicrobial agents for ESBL-related genes and Integron class 1 and 2 are shown in Table 2 and 3, respectively. Two isolates (6.66%) had both classes of integrons, simultaneously. The incidence of ESBL genes in intergron positive isolates is illustrated in Figure 3. None of isolates had the GES gene.

The Agarose Gel of the Strains Containing ESBL Genes
Figure 1.

The Agarose Gel of the Strains Containing ESBL Genes

The Agarose Gel of the Strains Containing Integrons
Figure 2.

The Agarose Gel of the Strains Containing Integrons

Table 2.Antibiotic Susceptibility Pattern of P. aeruginosa Containing ESBL Related Genesa
Gene
SHVVEBCTXGES
Negative, N = 4Positive, N = 26Negative, N = 26Positive, N = 4Negative, N = 17Positive, N = 13Negative, N = 30Positive, N = 0
Amikacin0
R10069.2373.077576.4769.2373.33
I015.3815.38011.7615.3813.33
S015.3811.532511.7615.3813.33
Ciprofloxacin0
R5046.1546.155064.7023.0746.66
I2523.0723.072511.7638.4623.33
S2530.7630.762523.5238.4630
Imipenem0
R2526.9223.065035.2915.3826.66
I5015.3819.232523.5215.3820
S2557.6957.692541.1746.1553.33
Gentamicin0
R7588.4684.6110082.3592.3086.66
I00000--
S2511.5315.38017.647.6913.33
Ceftazidime0
R10061.5365.387570.5861.5366.66
I026.9223.072523.5223.0723.33
S011.5311.5305.8815.3810
Tobramycin0
R5046.1538.4610041.1753.8446.66
I2523.0726.92029.4115.3823.33
S2530.7634.61029.4130.7630
Piperacillin-Tazobactam0
R7584.6180.7610082.2376.9283.33
I2515.3819.23011.7623.0716.66
S0--0---
Cefepime0
R10076.9292.307510053.8476.66
I019.2315.3825038.4616.66
S03.843.84007.693.33
Colistin0
R5057.6953.847570.5838.4656.66
I5026.9230.762523.5238.4630
S-15.3826.9205.8823.0713.33
Co-trimoxazole0
R10088.4684.6110094.1176.9286.66
I-3.843.84007.693.33
S-11.5311.5305.8815.3810

Antibiotic Susceptibility Pattern of P. aeruginosa Containing ESBL Related Genesa

Table 3.Antibiotic Susceptibility Pattern of P. aeruginosa Containing Integron Class 1 and Class 2a
Gene
AntibioticsIntegron Class 1 Positive, N = 26Integron Class 2 Positive, N = 2
RISRIS
Amikacin76.911.511.550500
Ciprofloxacin42.326.930.810000
Imipenem23.123.153.850050
Gentamicin88.5011.510000
Ceftazidime69.219.211.550500
Tobramycin5015.434.650500
Piperacillin-Tazobactam80.819.2010000
Cefepime76.919.23.850500
Colistin57.730.811.550500
Co-trimoxazole88.53.87.710000

Antibiotic Susceptibility Pattern of P. aeruginosa Containing Integron Class 1 and Class 2a

Incidence of ESBL Genes in Intergron Positive Isolates
Figure 3.

Incidence of ESBL Genes in Intergron Positive Isolates

5. Discussion

Culprits of late VAP are typically MDR bacteria, such as ESBL bacteria (41). This research found that ESBL P. aeruginosa was responsible for 36.5% of VAP at ICUs of 18 hospitals in the north of Iran, during years 2014 to 2015. Pseudomonas aeruginosa with a frequency of 24.4% is the most important pathogen causing VAP (42-44). Similar to the current findings, Gupta et al. reported that Pseudomonas spp. with incidence of 35 (28%) was the most prevalent pathogen isolated from patients admitted in ICU. The similarity of the results of the current study and Gupta et al.’s findings may be explained by the homology of patients of the examined wards of the hospitals. On the other hand, the most important risk factor significantly associated with infections caused by Pseudomonas spp. at ICU in Gupta et al.’s study was mechanical ventilation, similar to the current study (45); although VAP spreads to the blood in 10% of cases (6). This study found 16.6% sepsis due to VAP caused by ESBL P. aeruginosa. Pelekanou et al. investigated the differences in innate and adaptive immune responses in 36 patients with sepsis and VAP and 32 patients with sepsis due to other infections. They found more pronounced immunoparalysis in patients with VAP than in those with other bacterial infections. This was supported by the decreased number of CD3+/CD4+ cells, the increase in monocyte apoptosis, and the lower release of pro-inflammatory cytokines, namely tumor necrosis factor-alpha, and interleukin-6, from monocytes after stimulation with lipopolysaccharide in the group of patients with VAP (46-48).

The current study revealed that on average 26.6% to 86.66% of resistance to routine antibiotics used for infection, are caused by P. aeruginosa. Imipenem with 53.3% sensitivity was the most effective antibiotic. In some studies conducted in developed countries, the rate of antibiotic resistance to beta-lactam antibiotics and fluoroquinolones of P. aeruginosa was lower than the current results (49-51). In this regard, it is necessary to avoid prescribing unnecessary antibiotics, intravenous administration of short-term antibiotics to prevent infection in high-risk patients, and conservative use of medical equipment such as ventilator in developed countries (22).

In P. aeruginosa, various classes of ESBLs (A, B and D) have been found. Five types of class A ESBLs (PER, VEB, GES and IBC, TEM and SHV) were recently reported (38). The prevalence of different ESBL genotypes varies in different countries. The VEB, GES , SHV, and CTX genotypes are more prevalent in Asian countries, thus, the presence of these genes was evaluated in the current study (52).

Although more than 300 different ESBL variants have been described, TEM and SHV variants were the most common ESBLs during the past decade; strains expressing CTX have begun to emerge in many regions (53, 54).

This study found that the most prevalent gene for ESBL production was SHV, which was detected in 26 (86.6%) isolates. It has been proven that prevalence of ESBL genes varies in different geographic regions, for example in line with the current study, Imani Foolad et al. (55), reported that the most common ESBL gene detected among P. aeruginosa isolates in Tehran hospitals was SHV (37.5%). On the other hand, Bokaeian et al. (56), in Zahedan found that TEM was the most prevalent ESBL gene and only 6.6% of P. aeruginosa isolates contained the SHV gene.

The incidence of CTX gene among carbapenem resistant isolates in the current study was estimated about 16% and on the other hand, SHV and VEB had rates of 26.9% and 50% among imipenem resistance P. aeruginosa in the current study, which indicates the critical therapeutic problem of NIs caused by P. aeruginosa.

Furthermore, VEB and GES genes as plasmid-mediated ESBLs are uncommon and have been found mainly in P. aeruginosa. The VEB-type beta-lactamases are a rare type of enzyme responsible for conferring ESBL; they are usually integron borne and horizontally transferred (53). The VEB enzymes are well inhibited by clavulanate, and lead to significant reductions in ceftazidime. Thirteen percent of isolates in the current study had the VEB gene and the MIC showed that antibiotic resistance rate among VEB-containing isolates was 50% to 100%, and cefepime and ceftazidime were the most resisted antibiotics and imipenem was the most sensitive antibiotic. Similar to the current results, Davoudian et al. (54), reported that among 10 ESBL-positive ICU P. aeruginosa, one (10%) isolate contained the VEB gene yet 50% of the ESBL isolates in their study were resistant to third generation cephalosporins, indicating that the presence of other ESBL enzymes, metallo-beta-lactamases or mechanisms including efflux pumps for cephalosporin resistance may be cooperated in this phenomenon.

In the current study, 46% of fluoroquinolone-resistant isolates had the SHV gene. Horizontal transfer of genes encoding acquired beta-lactamases, such SHV, seems to play a primary role in the dissemination of these resistance traits among fluoroquinolone-resistant clinical strains of P. aeruginosa. The incidence of CTX and SHV, simultaneously, was the most prevalent after SHV in the current study.

Similar to the current findings, the GES gene was not seen in P. aeruginosa strains in several studies of Iran. The GES gene plays an important role in resistance to carbapenem antibiotics yet the absence of this gene in imipenem resistant isolates in these studies could be explained by other mechanisms of acquiring carbapenem-resistant phenotype, such as other ESBL enzymes (57-59).

This study found that 86.6% and 6.6% of isolates were Integron class 1 and class 2 positive. About 15.4% to 85% of integron class 1 positive strains contained ESBL genes and the incidence of ESBL genes was associated with the presence of integrons. In fact, integrons are expression vectors for antibiotic resistance genes that are included as gene cassettes (60). Mobile elements, such as integrons, may facilitate the spread of ESBL genes among bacteria. The rate of class 1 integron in several studies was around 40% for P. aeruginosa (61-64). It seems that the prevalence of integrons in the current study was higher than other studies, which can be due to differences in the prevalence of class 1 integron gene in different geographic areas, the number, and type of samples. As this study only evaluated the ESBL P. aeruginosa, the higher rate of integron positivity in comparison with other studies is not surprising. The correct identification of the genes involved in ESBL-mediated resistance is necessary for the surveillance and epidemiological studies of their transmission (65). Molecular typing of ESBL-producing P. aeruginosa, such as pulsed-field gel electrophoresis (PFGE) or multilocus sequence typing (MLST) is useful for surveillance purposes and is recommended for future study. The result of this study was alarming for clinicians to consider the risk of healthcare-associated pneumonia, such as pneumonia caused by ESBL-producing bacteria in patients admitted to ICUs.

References

  • 1.
    Custovic A, Smajlovic J, Hadzic S, Ahmetagic S, Tihic N, Hadzagic H. Epidemiological surveillance of bacterial nosocomial infections in the surgical intensive care unit. Mater Sociomed. 2014;26(1):7-11. [PubMed ID: 24757393]. [PubMed Central ID: PMC3990379]. https://doi.org/10.5455/msm.2014.26.7-11.
  • 2.
    Trouillet JL, Vuagnat A, Combes A, Kassis N, Chastre J, Gibert C. Pseudomonas aeruginosa ventilator-associated pneumonia: comparison of episodes due to piperacillin-resistant versus piperacillin-susceptible organisms. Clin Infect Dis. 2002;34(8):1047-54. [PubMed ID: 11914992]. https://doi.org/10.1086/339488.
  • 3.
    Boyer A, Doussau A, Thiébault R, Venier AG, Tran V, Boulestreau H, et al. Pseudomonas aeruginosa acquisition on an intensive care unit: relationship between antibiotic selective pressure and patients' environment. Crit Care. 2011;15(1):R55.
  • 4.
    Trautmann M, Lepper PM, Haller M. Ecology of Pseudomonas aeruginosa in the intensive care unit and the evolving role of water outlets as a reservoir of the organism. Am J Infect Control. 2005;33(5):S41-9.
  • 5.
    Krishnamurthy V, Vijaykumar GS, Sudeepa Kumar M, Prashanth HV, Prakash R, Nagaraj ER. Phenotypic and Genotypic Methods for Detection of Extended Spectrum β Lactamase Producing Escherichia coli and Klebsiella pneumoniae Isolated from Ventilator Associated Pneumonia. J Clin Diagn Res. 2013;7(9):1975-8. https://doi.org/10.7860/jcdr/2013/6544.3376.
  • 6.
    Koenig SM, Truwit JD. Ventilator-associated pneumonia: diagnosis, treatment, and prevention. Clin Microbiol Rev. 2006;19(4):637-57. [PubMed ID: 17041138]. [PubMed Central ID: PMC1592694]. https://doi.org/10.1128/CMR.00051-05.
  • 7.
    Fahimzad A, Eydian Z, Karimi A, Shiva F, Sayyahfar S, Kahbazi M, et al. Surveillance of Antibiotic Consumption Point Prevalence Survey 2014: Antimicrobial Prescribing in Pediatrics Wards of 16 Iranian Hospitals. Arch Iran med. 2016;19(3):204-9.
  • 8.
    Bayani M, Siadati S, Rajabnia R, Taher AA. Drug resistance of Pseudomonas aeruginosa and Enterobacter cloacae isolated from ICU, Babol, Northern Iran. Int J Mol Cellular Med. 2013;2(4):204.
  • 9.
    Rezai MS, Pourmousa R, Dadashzadeh R, Ahangarkani F. Multidrug resistance pattern of bacterial agents isolated from patient with chronic sinusitis. Caspian J Int Med. 2016;7(2):114.
  • 10.
    Bagheri-Nesami M, Rafiei A, Eslami G, Ahangarkani F, Rezai MS, Nikkhah A, et al. Assessment of extended-spectrum β-lactamases and integrons among Enterobacteriaceae in device-associated infections: multicenter study in north of Iran. Antimicrobial Resis Infect Control. 2016;5(1):52.
  • 11.
    Subashini J, Kannabiran K. Screening and Identification of Extended Spectrum β-lactamase (ESBL) Pathogens in Urine Sample of UTI Patient?s. Trop Med Surg. 2013;1(3). https://doi.org/10.4172/2329-9088.1000120.
  • 12.
    Nordmann P, Dortet L, Poirel L. Rapid Detection of Extended-Spectrum- -Lactamase-Producing Enterobacteriaceae. J Clin Microbiol. 2012;50(9):3016-22. https://doi.org/10.1128/jcm.00859-12.
  • 13.
    Poirel L, Le Thomas I, Naas T, Karim A, Nordmann P. Biochemical Sequence Analyses of GES-1, a Novel Class A Extended-Spectrum beta -Lactamase, and the Class 1 Integron In52 from Klebsiella pneumoniae. Antimicrob Agents Ch. 2000;44(3):622-32. https://doi.org/10.1128/aac.44.3.622-632.2000.
  • 14.
    Ardalan N, Jamaran S, Memari F, Davari K, Rostami B, Ramazanzadeh R. Risk Factors Associated with Community-acquired CTX-M Producing Klebsiella pneumoniae Typing by Rep-PCR in Sanandaj, Iran. Biosci Biotech Res Asia. 2016;13(3):1311-7. https://doi.org/10.13005/bbra/2271.
  • 15.
    Marquez C, Labbate M, Ingold AJ, Roy Chowdhury P, Ramirez MS, Centron D, et al. Recovery of a functional class 2 integron from an Escherichia coli strain mediating a urinary tract infection. Antimicrob Agents Chemother. 2008;52(11):4153-4. [PubMed ID: 18794381]. [PubMed Central ID: PMC2573131]. https://doi.org/10.1128/AAC.00710-08.
  • 16.
    Lavakhamseh H, Mohajeri P, Rouhi S, Shakib P, Ramazanzadeh R, Rasani A, et al. Multidrug-Resistant Escherichia coli Strains Isolated from Patients Are Associated with Class 1 and 2 Integrons. Chemotherapy. 2016;61(2):72-6. [PubMed ID: 26562504]. https://doi.org/10.1159/000438666.
  • 17.
    Azizi O, Shakibaie MR, Badmasti F, Modarresi F, Ramazanzadeh R, Mansouri S, et al. Class 1 integrons in non-clonal multidrug-resistant Acinetobacter baumannii from Iran, description of the new blaIMP-55 allele in In1243. J Med Microbiol. 2016;65(9):928-36. [PubMed ID: 27430533]. https://doi.org/10.1099/jmm.0.000315.
  • 18.
    Coque TM, Baquero F, Canton R. Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. Euro Surveill. 2008;13(47). [PubMed ID: 19021958].
  • 19.
    Falagas ME, Karageorgopoulos DE. Extended-spectrum beta-lactamase-producing organisms. J Hosp Infect. 2009;73(4):345-54. [PubMed ID: 19596491]. https://doi.org/10.1016/j.jhin.2009.02.021.
  • 20.
    Reinert RR, Low DE, Rossi F, Zhang X, Wattal C, Dowzicky MJ. Antimicrobial susceptibility among organisms from the Asia/Pacific Rim, Europe and Latin and North America collected as part of TEST and the in vitro activity of tigecycline. J Antimicrob Chemother. 2007;60(5):1018-29. [PubMed ID: 17855724]. https://doi.org/10.1093/jac/dkm310.
  • 21.
    Villegas MV, Kattan JN, Quinteros MG, Casellas JM. Prevalence of extended-spectrum β-lactamases in South America. Clin Microbiol Infect. 2008;14:154-8.
  • 22.
    Behzadnia S, Davoudi A, Rezai MS, Ahangarkani F. Nosocomial infections in pediatric population and antibiotic resistance of the causative organisms in north of iran. Iran Red Crescent Med J. 2014;16(2).
  • 23.
    Rezai MS, Salehifar E, Rafiei A, Langaee T, Rafati M, Shafahi K, et al. Characterization of multidrug resistant extended-spectrum beta-lactamase-producing Escherichia coli among uropathogens of pediatrics in North of Iran. Bio Med Res Int. 2015;2015.
  • 24.
    Bagheri-Nesami M, Rezai MS, Ahangarkani F, Rafiei A, Nikkhah A, Eslami G, et al. Multidrug and co-resistance patterns of non-fermenting Gram-negative bacilli involved in ventilator-associated pneumonia carrying class 1 integron in the North of Iran. Germs. 2017;7(3):123.
  • 25.
    Davoudi A, Najafi N, Alian S, Tayebi A, Ahangarkani F, Rouhi S, et al. Resistance pattern of antibiotics in patient underwent open heart surgery with nosocomial infection in North of Iran. Global J Health Sci. 2016;8(2):288.
  • 26.
    Davoudi AR, Najafi N, Shirazi MH, Ahangarkani F. Frequency of bacterial agents isolated from patients with nosocomial infection in teaching hospitals of Mazandaran University of Medical Sciences in 2012. Caspian J Intern Med. 2014;5(4):227. [PubMed ID: 25489435]. [PubMed Central ID: PMC4247487].
  • 27.
    Saffar MJ, Enayti AA, Abdolla IA, Razai MS, Saffar H. Antibacterial susceptibility of uropathogens in 3 hospitals, Sari, Islamic Republic of Iran, 2002-2003. E Mediterr Health J. 2008;14(3).
  • 28.
    Rezai MS, Bagheri-nesami M, Hajalibeig A, Ahangarkani F. [Multidrug and cross-resistance pattern of ESBL-producing enterobacteriaceae agents of nosocomial infections in intensive care units]. J Mazandaran U Med Sci. 2017;26(144):39-49. Persain.
  • 29.
    Rezai MS, Rafiei A, Ahangarkani F, Bagheri-Nesami M, Nikkhah A, Shafahi K, et al. Emergence of extensively drug resistant acinetobacter baumannii-encoding integrons and extended-spectrum beta-lactamase genes isolated from ventilator-associated pneumonia patients. Jundishapur J Microbiol. 2017;10(7).
  • 30.
    Peymani A, Naserpour-Farivar T, Zare E, Azarhoosh KH. Distribution of blaTEM, blaSHV, and blaCTX-M genes among ESBL-producing P. aeruginosa isolated from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017;58(2):E155-60. [PubMed ID: 28900355]. [PubMed Central ID: PMC5584084].
  • 31.
    Alikhani MY, Karimi Tabar Z, Mihani F, Kalantar E, Karami P, Sadeghi M, et al. Antimicrobial resistance patterns and prevalence of blaPER-1 and blaVEB-1 genes among ESBL-producing Pseudomonas aeruginosa isolates in West of Iran. Jundishapur J Microbiol. 2014;7(1). [PubMed ID: 25147662]. [PubMed Central ID: PMC4138671]. https://doi.org/10.5812/jjm.8888.
  • 32.
    Sedighi M, Halajzadeh M, Ramazanzadeh R, Amirmozafari N, Heidary M, Pirouzi S. Molecular detection of beta-lactamase and integron genes in clinical strains of Klebsiella pneumoniae by multiplex polymerase chain reaction. Rev Soc Bras Med Trop. 2017;50(3):321-8. [PubMed ID: 28700049]. https://doi.org/10.1590/0037-8682-0001-2017.
  • 33.
    Koneman EW, Allen SD, Janda WM, Schreckenberger R, Winn W. Introduction to microbiology, part II: guidelines for the collection, transport, processing, analysis and reporting of cultures from specific specimen sources. Color Atlas and Textbook of Diagnostic Microbiology, 5th ed. Lippincot-Raven: Philadelphia. 1997:121-70.
  • 34.
    Ramazanzadeh R, Rouhi S, Hosainzadegan H, Shakib P, Nouri B. Co-occurrence of Extended-Spectrum Beta-Lactamases in Isolated Enterobacter spp. From Patients Specimens. Arch Clin Infect Dis. 2016;11(3). https://doi.org/10.5812/archcid.26837.
  • 35.
    Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto CA, et al. Molecular epidemiology of CTX-M-producing Escherichia coli isolates at a tertiary medical center in western Pennsylvania. Antimicrob Agents Chemother. 2009;53(11):4733-9. [PubMed ID: 19687234]. [PubMed Central ID: PMC2772316]. https://doi.org/10.1128/AAC.00533-09.
  • 36.
    Naas T, Bogaerts P, Bauraing C, Degheldre Y, Glupczynski Y, Nordmann P. Emergence of PER and VEB extended-spectrum beta-lactamases in Acinetobacter baumannii in Belgium. J Antimicrob Chemother. 2006;58(1):178-82. [PubMed ID: 16670107]. https://doi.org/10.1093/jac/dkl178.
  • 37.
    Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008;52(8):2818-24. [PubMed ID: 18505851]. [PubMed Central ID: PMC2493136]. https://doi.org/10.1128/AAC.00171-08.
  • 38.
    Weldhagen GF, Poirel L, Nordmann P. Ambler class A extended-spectrum beta-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob Agents Chemother. 2003;47(8):2385-92. [PubMed ID: 12878494]. [PubMed Central ID: PMC166056].
  • 39.
    Chen CH, Huang CC. Risk factor analysis for extended-spectrum β-lactamase-producing Enterobacter cloacaebloodstream infections in central Taiwan. BMC Infect Diseas. 2013;13(1). https://doi.org/10.1186/1471-2334-13-417.
  • 40.
    Correa FE, Dantas FG, Grisolia AB, Crispim Bdo A, Oliveira KM. Identification of class 1 and 2 integrons from clinical and environmental Salmonella isolates. J Infect Dev Ctries. 2014;8(12):1518-24. [PubMed ID: 25500649]. https://doi.org/10.3855/jidc.4734.
  • 41.
    Kalanuria AA, Ziai W, Mirski M. Ventilator-associated pneumonia in the ICU. Crit Care. 2014;18(2):208. [PubMed ID: 25029020]. [PubMed Central ID: PMC4056625]. https://doi.org/10.1186/cc13775.
  • 42.
    American Thoracic S, Infectious Diseases Society of A. Guidelines for the management of adults with hospital-acquired, ventilator-associated, and healthcare-associated pneumonia. Am J Respir Crit Care Med. 2005;171(4):388-416. [PubMed ID: 15699079]. https://doi.org/10.1164/rccm.200405-644ST.
  • 43.
    Vincent JL, Bihari DJ, Suter PM, Bruining HA, White J, Nicolas-Chanoin MH, et al. The Prevalence of Nosocomial Infection in Intensive Care Units in Europe. Jama. 1995;274(8):639. https://doi.org/10.1001/jama.1995.03530080055041.
  • 44.
    Chastre J, Fagon JY. Ventilator-associated pneumonia. Am J Respir Crit Care Med. 2002;165(7):867-903. [PubMed ID: 11934711]. https://doi.org/10.1164/ajrccm.165.7.2105078.
  • 45.
    Gupta R, Malik A, Rizvi M, Ahmed SM. Incidence of Multidrug-Resistant Pseudomonas Spp. in ICU Patients with Special Reference to ESBL, AMPC, MBL and Biofilm Production. J Glob Infect Dis. 2016;8(1):25-31. [PubMed ID: 27013841]. [PubMed Central ID: PMC4785753]. https://doi.org/10.4103/0974-777X.176142.
  • 46.
    Planquette B, Timsit JF, Misset BY, Schwebel C, Azoulay E, Adrie C, et al. Pseudomonas aeruginosa ventilator-associated pneumonia. predictive factors of treatment failure. Am J Respir Crit Care Med. 2013;188(1):69-76. [PubMed ID: 23641973]. https://doi.org/10.1164/rccm.201210-1897OC.
  • 47.
    Christaki E. Host immune response in sepsis due to ventilator-associated pneumonia: how is it different? Crit Care. 2009;13(6):1009. [PubMed ID: 20017893]. [PubMed Central ID: PMC2811897]. https://doi.org/10.1186/cc8174.
  • 48.
    Pelekanou A, Tsangaris I, Kotsaki A, Karagianni V, Giamarellou H, Armaganidis A, et al. Decrease of CD4-lymphocytes and apoptosis of CD14-monocytes are characteristic alterations in sepsis caused by ventilator-associated pneumonia: results from an observational study. Crit Care. 2009;13(6):R172. [PubMed ID: 19883512]. [PubMed Central ID: PMC2811921]. https://doi.org/10.1186/cc8148.
  • 49.
    Bouza E, Garcia-Garrote F, Cercenado E, Marin M, Diaz MS. Pseudomonas aeruginosa: a survey of resistance in 136 hospitals in Spain. The Spanish Pseudomonas aeruginosa Study Group. Antimicrob Agents Chemother. 1999;43(4):981-2. [PubMed ID: 10103217]. [PubMed Central ID: PMC89243].
  • 50.
    Niitsuma K, Saitoh M, Kojimabara M, Kashiwabara N, Aoki T, Tomizawa M, et al. [Antimicrobial susceptibility of Pseudomonas aeruginosa isolated in Fukushima Prefecture]. Jpn J Antibiot. 2001;54(2):79-87. [PubMed ID: 11338681].
  • 51.
    Shawar RM, MacLeod DL, Garber RL, Burns JL, Stapp JR, Clausen CR, et al. Activities of tobramycin and six other antibiotics against Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrob Agents Chemother. 1999;43(12):2877-80. [PubMed ID: 10582875]. [PubMed Central ID: PMC89580].
  • 52.
    Chen Z, Niu H, Chen G, Li M, Li M, Zhou Y. Prevalence of ESBLs-producing Pseudomonas aeruginosa isolates from different wards in a Chinese teaching hospital. Int J Clin Exp Med. 2015;8(10):19400-5. [PubMed ID: 26770582]. [PubMed Central ID: PMC4694482].
  • 53.
    Maurya AP, Talukdar AD, Chanda DD, Chakravarty A, Bhattacharjee A. Integron-borne transmission of VEB-1 extended-spectrum beta-lactamase in Pseudomonas aeruginosa in a tertiary care hospital in India. Antimicrob Agents Chemother. 2014;58(11):6966-9. [PubMed ID: 25182643]. [PubMed Central ID: PMC4249423]. https://doi.org/10.1128/AAC.02365-14.
  • 54.
    Davodian E, Sadeghifard N, Ghasemian A, Noorbakhsh S. Presence of blaPER-1 and blaVEB-1 beta-lactamase genes among isolates of Pseudomonas aeruginosa from South West of Iran. J Epidemiol Glob Health. 2016;6(3):211-3. [PubMed ID: 26944896]. https://doi.org/10.1016/j.jegh.2016.02.002.
  • 55.
    Imani Foolad A, Rostami Z, Shapouri R. [Antimicrobial resistance and ESBL prevalence in Pseudomonas aeruginosa strains isolated from clinical specimen by phenotypic and genotypic methods]. J Ardabil U Med Sci. 2010;10(3):189-98. Persain.
  • 56.
    Bokaeian M, Shahraki Zahedani S, Soltanian Bajgiran M, Ansari Moghaddam A. Frequency of PER, VEB, SHV, TEM and CTX-M Genes in Resistant Strains of Pseudomonas aeruginosa Producing Extended Spectrum beta-Lactamases. Jundishapur J Microbiol. 2015;8(1). e13783. [PubMed ID: 25789123]. [PubMed Central ID: PMC4350043]. https://doi.org/10.5812/jjm.13783.
  • 57.
    Jabalameli F, Mirsalehian A, Sotoudeh N, Jabalameli L, Aligholi M, Khoramian B, et al. Multiple-locus variable number of tandem repeats (VNTR) fingerprinting (MLVF) and antibacterial resistance profiles of extended spectrum beta lactamase (ESBL) producing Pseudomonas aeruginosa among burnt patients in Tehran. Burns. 2011;37(7):1202-7. [PubMed ID: 21703769]. https://doi.org/10.1016/j.burns.2011.05.012.
  • 58.
    Kalantar-Neyestanaki D, Emaneini M, Jabalameli F, Taherikalani M, Mirsalehian A. ISPpu22, a novel insertion sequence in the oprD porin gene of a carbapenem-resistant Pseudomonas aeruginosa isolate from a burn patient in Tehran, Iran. Iran J Microbiol. 2015;7(5):247-50. [PubMed ID: 26719780]. [PubMed Central ID: PMC4695505].
  • 59.
    Pakbaten Toupkanlou S, Najar Peerayeh S, Pirhajati Mahabadi R. Class A and D extended-spectrum β-lactamases in imipenem resistant Pseudomonas aeruginosa isolated from burn patients in Iran. Jundishapur J Microbiol. 2015;8(8). [PubMed ID: 26468357]. [PubMed Central ID: PMC4600860]. https://doi.org/10.5812/jjm.18352v2.
  • 60.
    Stokes HW, O'Gorman DB, Recchia GD, Parsekhian M, Hall RM. Structure and function of 59-base element recombination sites associated with mobile gene cassettes. Mol Microbiol. 1997;26(4):731-45. [PubMed ID: 9427403].
  • 61.
    Chen J, Su Z, Liu Y, Wang S, Dai X, Li Y, et al. Identification and characterization of class 1 integrons among Pseudomonas aeruginosa isolates from patients in Zhenjiang, China. Int J Infect Dis. 2009;13(6):717-21. [PubMed ID: 19208492]. https://doi.org/10.1016/j.ijid.2008.11.014.
  • 62.
    Fonseca EL, Vieira VV, Cipriano R, Vicente AC. Class 1 integrons in Pseudomonas aeruginosa isolates from clinical settings in Amazon region, Brazil. FEMS Immunol Med Microbiol. 2005;44(3):303-9. [PubMed ID: 15907453]. https://doi.org/10.1016/j.femsim.2005.01.004.
  • 63.
    Nikokar I, Tishayar A, Flakiyan Z, Alijani K, Rehana-Banisaeed S, Hossinpour M, et al. Antibiotic resistance and frequency of class 1 integrons among Pseudomonas aeruginosa, isolated from burn patients in Guilan, Iran. Iran J Microbiol. 2013;5(1):36-41. [PubMed ID: 23466812]. [PubMed Central ID: PMC3577559].
  • 64.
    Rajabnia R, Asgharpour F, Ferdosi Shahandashti E, Khalilian M, Norkhomami S, shafii M, et al. Class 1 Integron in Pseudomonas aeruginosa Isolates From Different Places and Devices of ICU in Babol, Iran. Jundishapur J Microbiol. 2013;6(2). https://doi.org/10.5812/jjm.4850.
  • 65.
    Ahmed OI, El-Hady SA, Ahmed TM, Ahmed IZ. Detection of bla SHV and bla CTX-M genes in ESBL producing Klebsiella pneumoniae isolated from Egyptian patients with suspected nosocomial infections. Egypt J Med Hum Genet. 2013;14(3):277-83. https://doi.org/10.1016/j.ejmhg.2013.05.002.
comments

Leave a comment here

Indexed in

Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles