Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis

Author(s):
Sara NasirianSara Nasirian1, 2, Sara SaadatmandSara Saadatmand2, Hossein GoudarziHossein GoudarziHossein Goudarzi ORCID1, Mehdi GoudarziMehdi GoudarziMehdi Goudarzi ORCID1,*, Hadi AzimiHadi Azimi3
1Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2Department of Biology, Faculty of Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran
3Department of English Language Teaching, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Archives of Clinical Infectious Diseases:Vol. 13, issue 2; e14495
Published online:Apr 24, 2018
Article type:Research Article
Received:Jan 03, 2017
Accepted:Sep 19, 2017
How to Cite:Nasirian S, Saadatmand S, Goudarzi H, Goudarzi M, Azimi H. Molecular Investigation of Methicillin-Resistant Staphylococcus aureus Strains Recovered from the Intensive Care Unit (ICU) Based on Toxin, Adhesion Genes and agr Locus Type Analysis. Arch Clin Infect Dis. 2018;13(2):e14495. doi: https://doi.org/10.5812/archcid.14495

Abstract

Background:

Staphylococcus aureus, as one of the most common causes of nosocomial infections, has widely spread to all parts of the world and is becoming a serious concern in public health.

Objectives:

The present study aimed at evaluating the prevalence of adhesion and toxin gene profiles and their distribution among different agr types.

Methods:

The current cross-sectional study was performed in Tehran, Iran, by analyzing 125 methicillin resistant Staphylococcus aureus (MRSA) strains isolated from hospitalized patients at the ICUs from March, 2016 to January, 2017. In vitro antibiotic susceptibility testing of isolates was assessed using the Kirby-Bauer disk diffusion method. The MRSA strains were genetically typed by agr typing and virulence and adhesion genes profile by conventional PCR.

Results:

Antibiotic susceptibility testing showed that inducible macrolide-lincosamide-streptogramin B, constitutive macrolide-lincosamide-streptogramin B, and high-level mupirocin resistance phenotypes had a frequency of 18 (14.4%), 50 (56%), and 10 (31.3%), respectively. The predominant resistance profile among MDR-MRSA isolates included resistance profile to seven antibiotics (32%). A total of ten virulence genotypes were observed, from which genotype spa, clfA, clfB, fnbB, fnbA, ebp, and can / tst (36%, 45/125) comprised the majority followed by spa, clfA, clfB, and fnbB (24%, 30/125). Type I was the most prevalent agr type (52%), followed by type III (34.4%), type II (9.6%), I 5(5.3%), and IV (4%). All isolates carrying PVL-encoding genes and HLMUPR-MRSA strains corresponded exclusively to agr type I.

Conclusions:

The current data demonstrated that virulence gene profiles among different agr types of MRSA isolates were divers. The present study suggests that molecular characterization of MRSA strains should periodically be studied.

1. Background

Staphylococcus aureus, as one of the most common pathogens causing community and hospital infections, is responsible for a diverse spectrum of human infections ranging from skin and soft tissue infections to food poisoning, osteomyelitis, pneumonia, endocarditis, and bacteremia (1). These bacteria are equipped with a broad range of virulence factors and it was recently shown that it is able to carry resistance to many antimicrobial agents, especially methicillin (2).
The first Methicillin-Resistant Staphylococcus aureus (MRSA) was reported during 1961 in the UK (3). Resistance to methicillin is mediated by the mecA gene, which encodes a modified penicillin-binding protein (PBP2a). Unfortunately, data obtained from recent studies showed a worldwide increase in the prevalence of this organism and high rates of mortality and morbidity in healthcare settings so that currently MRSA has become a major public health concern, especially in intensive care unit (ICU) wards (4). The epidemiological success of this pathogen, in addition to the ability to express a variety of virulence factors, is also related to its remarkable ability to acquire resistance to new antimicrobial agents (2, 5).
It is evident that MRSA infections are related to expression of a broad range of virulent factors, which are controlled by the accessory gene regulator (agr) locus, via encoding a specific peptide, called auto-inducing peptide (AIP) (1, 6).
The agr locus consists of five genes (agrA, agrC, agrD, agrB, and hld) and codes for two divergent transcriptional units, RNAII and RNAIII, which are under the control of two distinct promoters, P2 and P3, respectively. The P2 operon encodes agrB, agrD, agrC, and agrA that generate the agr-sensing mechanism (7). The agr D gene encodes AIP. Furthermore, agrB is a transmembrane protein that appears to be involved in the secretion of an AIP signal, and agrC (histidine kinase) acts as a sensor of AIP concentrations and in turn modulates the activity of agrA. agrA, as a response regulator, and activates P2 or P3 promoters. agrA and agrC downregulate surface proteins and upregulate those secreted. Within the agr locus, there is a variable region comprised of the 39-end of the agrB gene, the agrD gene, and the 59-end of the agrC gene. Variation in the amino acid sequence of the last one-third of agrB and agrD, and the first half of agrC generates the four agr major groups. Associations between the agr genotype of isolates, specific virulence factors, and staphylococcal diseases have been reported previously (7, 8).

2. Objectives

The present study was conducted in order (i) to characterize the antibiotic resistance pattern, toxin, and adhesion profiles of MRSA obtained from various types of clinical samples recovered from intensive care units (ICUs) and (ii) to further investigate these isolates by agr typing.

3. Methods

3.1. Sampling and Methicillin Resistant Staphylococcus aureus Screening

The current cross-sectional study was conducted between March 2016 and January 2017 on 125 MRSA strains isolated from hospitalized patients at ICUs. The MRSA strains were recovered from wound (n = 53; 42.4%), blood (n = 32; 25.6%), catheter (n = 12; 9.6%), ear (n = 10; 8%), pus (n = 9; 7.2%), body fluids (n = 7; 5.6%), and urine (n = 2; 1.6%). The research was approved by the ethics committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran (IR.SBMU.SM.REC.1394.156). The inclusion criterion was having MRSA isolated from hospitalized patients at ICUs. The exclusion criterion was MRSA isolated from out-patients, community acquired, and other wards of hospitals. The bacterial isolates were presumptively identified on the basis of colony morphology, gram staining, growth on mannitol salt agar, and production of catalase, coagulase, and DNase. All the isolates were confirmed making use of polymerase chain reaction (PCR) for the nucA gene (9). The MRSA isolates were screened with cefoxitin disc (30 µg) and oxacillin disc (1 µg) on Mueller Hinton agar plates supplemented with 4% NaCl, in accordance with the Clinical and Laboratory Standard Institute (CLSI) guidelines (10). Isolates with phenotypic resistance to oxacillin were confirmed to harbor the mecA gene using PCR (2). The MRSA isolates were stored in tryptic soy broth (TSB; Merck, Germany) containing 20% glycerol at -70°C for further investigation.

3.2. Antibacterial Susceptibility Testing

The antimicrobial susceptibility test (AST) was performed using the disk-diffusion method, according to Clinical and Laboratory Standards Institute (CLSI) guidelines for kanamycin (K 30 µg), ciprofloxacin (CIP 5µg), clindamycin (CD 2 µg), tetracyclin (T 30 µg), erythromycin (E 15 µg), linezolid (LZD 30 µg), penicillin (PG 10 µg), teicoplanin (TEC 30 µg), quinupristin-dalfopristin (SYN 15 µg), amikacin (AK 30 µg), tobramycin (TN 10 µg), gentamicin (GM 10 µg), trimethoprim-sulfamethoxazole (TS 2.5 µg), and ceftriaxone (CRO 30 µg). The minimum inhibitory concentration (MIC) for vancomycin and mupirocin was determined with E-test strips (bioMe’rieux), according to the manufacturer’s instructions. Inducible macrolide, lincosamide, and streptogramin B (iMLSB) resistance was defined for the isolates that were susceptible to clindamycin and resistant against erythromycin, detected via D-zone test and broth microdilution method, according to the CLSI procedure (10). Constitutive MLSB (cMLSB) phenotype was defined for the isolates that were resistant to both erythromycin and clindamycin. Isolates, which showed resistance to at least three or more unique antibiotic classes in addition to beta-lactam were classified as multidrug resistant (MDR). All the antibiotic disks used in the present study were supplied by Mast Co, UK. Staphylococcus aureus ATCC25923 and ATCC29213 were used as quality control strains.

3.3. Bacterial DNA Extraction

Total genomic DNA was extracted from each MRSA isolate using the commercial kit InstaGene Matrix (BioRad, Hercules co., CA, USA), according to the manufacture’s instruction. Additional reagent was lysostaphin (Sigma-Aldrich co., USA) in a final concentration of 15 µg/mL.

3.4. Adhesion and Toxin Encoding Genes Detection

All the isolates were screened for possible presence of adhesion (spa, can, bbp, ebp, fnbB, fnbA, clfB, and clfA) and toxin (etb, eta, pvl, and tst) genes with degenerate primers as listed in Table 1.
Table 1.Oligonucleotide Primers Used in This Study
TargetPrimerPrimer Sequence (5’ → 3’)Product Size, bpReference
nucAFGCGATTGATGGTGATACGGTT270(2)
RAGCCAAGCCTTGACGAACTAAAGC
mecAFAGAAGATGGTATGTGGAAGTTAG583(2)
RATGTATGTGCGATTGTATTGC
luk-PVFTTCACTATTTGTAAAAGTGTCAGACCCACT180(11)
RTACTAATGAATTTTTTTATCGTAAGCCCTT
tsst-1FTTATCGTAAGCCCTTTGTTG398(2)
RTAAAGGTAGTTCTATTGGAGTAGG
etaFGCAGGTGTTGATTTAGCATT93(12)
RAGATGTCCCTATTTTTGCTG
etbFACAAGCAAAAGAATACAGCG226(12)
RGTTTTTGGCTGCTTCTCTTG
fnbAFCACAACCAGC AAATATAG1362(13)
RCTGTGTGGTAATCAATGTC
fnbBFGGAGAAGGAATTAAGGCG813(13)
RGCCGTCGCCTTGAGCGT
clfAFGTAGGTACGTTAATCGGTT1586(13)
RCTCATCAGGTTGTTCAGG
clfBFTGCAAGATCAAACTGTTCCT596(13)
RTCGGTCTGTAAATAAAGGTA
cnaFAGTGGTTACTAATACTG744(14)
RCAG GAT AGA TTG GTTTA
bbpFCAGTAAATGTGTCAAAAGA1055(15)
RTACACCCTGTTGAACTG
ebpFCAATCGATAGACACAAATTC526(15)
RCAGTTACATCATCATGTTTA
agrPan FATGCACATGGTGCACATGC-(7)
R1GTCACAAGTACTATAAGCTGCGAT441
R2TATTACTAATTGAAAAGTGGCCATAGC575
R3GTAATGTAATAGCTTGTATAATAATACCCAG323
R4CGATAATGCCGTAATACCCG659

3.5. Identification of agr Alleles Using Multiplex Polymerase Chain Reaction

Multiplex PCR was performed for agr types detection using a primer set comprised of a common forward primer (Pan) and reverse primers (agr1, agr2, agr3, and agr4) specific to each agr group. These primers were designed to amplify the 441-bp fragment of the agr group I strains, a 575-bp fragment of the agr group II strains, a 323-bp fragment of the agr group III strains, and a 659-bp fragment of the agr group IV strains. The primer sequences are listed in Table 1.

4. Results

In the current study, 125 MRSA isolates from 443 various clinical specimens were evaluated. All the isolates were confirmed as MRSA following phenotypic (cefoxitin disc screening) and genotypic (amplification of the mecA gene) methods. A total of 93 (74.4%) MRSA isolates were recovered from male and 32 from female (25.6%) patients. The mean age of patients was 39 years ranging from 4 to 71 years. The highest and lowest prevalence rate of MRSA infection in the present study was found to be in the 21- to 45-year-old (71.2%) and in the less than 20-year-old age groups (8%), respectively.

4.1. Antimicrobial Susceptibility Testing

The results of antimicrobial susceptibility testing (AST) showed the following resistance patterns among MRSA isolates: penicillin (122; 97.6%), kanamycin (105; 84%), gentamicin (95; 76%), erythromycin (88; 70.4%), tetracycline (78; 62.4%), clindamycin (70; 56%), ciprofloxacin (63; 50.4%), amikacin (60; 48%), tobramycin (58; 46.4%), ceftriaxone (49; 39.2%), mupirocin (32; 25.6%), trimethoprim-sulfamethoxazole (21; 16.8%), and quinupristin-dalfopristin (12; 9.6%). All of the isolates were susceptible to vancomycin, teicoplanin, and linezolid. Based on the results of E-test for vancomycin, 43 (34.4%) isolates had MIC of 0.5 µg/mL, 27 (21.6%) had MIC of 1 µg/mL, and 55 (44%) had MIC 2 µg/mL. Of the 32 mupirocin-resistant MRSA isolates, 10 (31.3%) showed MIC ≥ 512 µg/mL and were reported as high-level mupirocin resistance (HLMUPR) MRSA isolates. All the HLMUPR-MRSA strains were collected from wound samples. In the present study, iMLSB and cMLSB was detected in 18 (14.4%) and 50 (56%) MRSA isolates, respectively. Multi-drug resistance (MDR) was detected in 120 tested isolates (96%). Generally, nine different resistance profiles were identified among the investigated isolates. The predominant resistance profile among MDR isolates included a resistance profile to seven antibiotics (32%) followed by eight antibiotics (24%), five antibiotics (15.2%), nine antibiotic (14.4%), six antibiotics (8%), four antibiotics (3.2%), and three antibiotics (2.4%), simultaneously. The distribution of resistance patterns and clinical samples obtained from hospitalized patients at the ICU are presented in Table 2.
Table 2.Distribution of Different Clinical Sample and Resistance Profile in Methicillin Resistant Staphylococcus aureus Isolated from Intensive Care Units
Number of AntibioticsResistance ProfileNumber of Isolates (%)Type of Samples (No.;%)
9PG, K, E,T, CIP, AK, TN,CRO,MUP18 (14.4)W (18; 100)
8PG, K, GM, E,CD,AK,TN, CRO30 (24)W (10; 33.3), B (17; 56.7), C (3; 10)
7P,K,GM,E,T,CD,CIP40 (32)W (8; 20), B (7; 17.5), E (6; 15), C (9;22.5), P (5; 12.5),BF (5; 12.5)
6P,GM,AK,TN,MUP,SYN10 (8)W (10; 100)
5P,K,GM,T,TS15 (12)B (7; 46.7), E (3, 20), P (3; 20), U (2; 13.3)
P,T,CIP,MUP,TS4 (3.2)W (4; 100)
4K,AK,TS,SYN2 (1.6)W (2; 100)
3T,CIP,CRO1 (0.8)BF (1; 100)
1P5 (4)W (1; 20), B (1; 20), E (1; 20), P (1; 20), BF (1; 20)

Abbreviations: AK, Amikacin; B, Blood; BF, Body Fluid; C, Catheter; CD, Clindamycin; CIP, Ciprofloxacin; CRO, Ceftriaxone; E, Ear; E, Erythromycin, GM, Gentamicin; K, Kanamycin; MUP, Mupirocin; P, Pus; PG, Penicillin; SYN, Quinupristin-Dalfopristin; T, Tetracyclin; TN, Tobramycin; TS, Trimethoprim- Sulfamethoxazole; U, Urine; W, Wound.

4.2. Detection of Resistance and Toxin Encoding Genes

Among adhesion genes tested, the most prevalent was spa gene (125; 100%) followed by clfA (118; 94.4%), clfB (115; 92%), fnbB (112; 89.6%), fnbA (104; 83.2%), ebp (73; 58.4%), can (56; 44.8%), and bbp (4; 3.2%) genes. Among 125 MRSA strains, the most frequent toxin genes were tst (84; 67.2%), pvl (25; 20%), eta (15; 12%), and etb (9; 7.2%), respectively. Different patterns of the presence of adhesion and toxin encoding genes simultaneously in MRSA strains are presented in Table 3. The pvl gene was detected in MRSA strains isolated from wound (72%) and blood (28%) infections. Furthermore, pvl positive strains were distributed among MDR-MRSA strains with resistance profile to 7 and 9 antibiotics. Isolates carrying the tst gene had a resistance profile to 5, 7, 8, and 9 antibiotics.
Table 3.Virulence Patterns for Methicillin Resistant Staphylococcus aureus Strains Isolated from Intensive Care Units
Adhesion/ Toxin ProfileNumber of Isolates (%)
spa, clfA, clfB, fnbB, fnbA, ebp, can / tst45 (36)
spa, clfA, clfB, fnbB30 (24)
spa, clfA, clfB, fnbB, fnbA, ebp / pvl, tst20 (16)
spa, clfA, clfB, fnbB / tst, eta10 (8)
spa, clfA, clfB, fnbB, fnbA, ebp, can / pvl, tst, eta, etb5 (4)
spa, clfA, clfB, fnbA, bbp, can / tst, etb4 (3.2)
spa, clfA, fnbB, ebp, can2 (1.6)
spa, clfA, clfB, ebp1 (0.8)
spa, clfA1 (0.8)
spa7 (5.6)

4.3. Distribution of agr Types

Multiplex-PCR analysis for agr typing revealed that 65 isolates (52%) belonged to agr group I, 43 isolates (34.4%) to agr group III, 12 isolates (9.6%) to agr group II, and 5 isolates (4%) to agr group IV. All the isolates carrying PVL-encoding genes belonged to agr type I. The remaining genes encoding toxins and adhesions were distributed among different agr types. All the HLMUPR-MRSA strains belonged to the agr group I. Of 18 isolates with iMLSB phenotype, four isolates belonged to agr types I (22.2%) and 14 isolates (77.8%) to agr type III. The distribution of different agr types, adhesion, and toxin encoding genes among tested isolates is summarized in Table 4.
Table 4.Distribution of Methicillin Resistant Staphylococcus aureus Virulence Genes Among Different agr Typesa
Toxin and Adhesion GenesType of agrTotal
IIIIIIIV
tst41 (48.8)0 (0)43 (51.2)0 (0)84 (67.2)
pvl25 (100)0 (0)0 (0)0 (0)25 (20)
eta0 (0)2 (13.3)9 (60)4 (26.7)15 (12)
etb0 (0)7 (77.8)2 (22.2)0 (0)9 (7.2)
clfA65 (55.1)8 (6.8)43 (36.4)2 (1.7)118 (94.4)
clfB63 (54.8)10 (8.7)40 (34.8)2 (1.7)115 (92)
fnbB60 (53.6)12 (10.7)39 (34.8)1 (0.9)112 (89.6)
fnbA63 (60.6)9 (8.7)31 (29.8)1 (0.9)104 (83.2)
ebp27 (37)9 (12.3)36 (49.3)1 (1.4)73 (58.4)
can26 (46.4)2 (3.6)23 (41.1)5 (8.9)56 (44.8)
bbp1 (25)2 (50)1 (25)0 (0)4 (3.2)
Total65 (52)12 (9.6)43 (34.4)5 (4)125 (100)

aValues are expressed as No. (%).

5. Discussion

Antibiotic resistance became a great challenge in public health in the 21st century. In the recent years, the study of antibiotic resistance pattern and distribution of virulence factors among molecular types of MRSA has been an important principle for better understanding of epidemiological and clinical characterization of these bacteria (16). According to previous studies, MRSA strains have shown a wide pattern of resistance to β-lactams and other therapeutic options, such as macrolides, lincosamides, and aminoglycosides (2, 5, 16). In line with earlier reports from Iran (9, 17), Turkey (18), and Italy (19), in the present study a high level of resistance to penicillin (97.1%) was found, which can be due to the wide use of beta lactams in hospitals to treat various infections. In the current survey, a high resistance to erythromycin (70.4%) and tetracycline (62.4%) was observed. This finding is largely in accordance with that reported by Rashidi Nezhad et al. (16), Goudarzi et al. (5), and Dormanesh et al. (20). These findings reveal the fact that these antibiotics are used improperly in the treatment of common infections as well as the acquisition of resistance determinants carried by transposons, plasmids or integrons. In addition, resistance rate to aminoglycosides has been investigated by several investigators. Gentamycin is an antibiotic used to treat several types of serious infections, especially staphylococcal infections. The resistance rate to gentamicin was 76% in the present study, which is in line with Goudarzi’s study (2) yet was higher than those reported by Havaei et al. (21) and lower than that those reported by Wang et al. (22). The results demonstrated relatively high resistance to kanamycin (84%), amikacin (48%), and tobramycin (46.4%), which is in agreement with earlier rates reported by Ko et al. (23), Rashidi Nezhad et al. (16) and also a study conducted by Goudarzi et al. (2). Antibiotic inactivation by plasmid or transposon-mediated aminoglycoside modifying enzymes (AMEs) is known to be the main mechanism of aminoglycoside resistance. In the present study, 25.6% of MRSA isolates were found to be resistant to mupirocin, among which 10 (31.3%) isolates were confirmed as HLMUPR strains. Various percentages of the mupirocin resistance were reported in MRSA strains isolated from Iran (28.3%) (5, 24), India (5%) (25), Jordan (2.6%) (26), and Greek (1.6%) (27). Although the main reasons of resistance to mupirocin are not completely clear, high resistance to mupirocin among tested isolates may be due to misuse of mupirocin in the treatment of MRSA skin and soft tissue infections and also eradication of nasal carriage of S. aureus in health care workers. However, the study population and type of clinical samples should also be considered. In a survey performed on S. aureus strains isolated from burn patients conducted by Abbasi Montazeri et al. (28), it was shown that two factors affecting mupirocin resistance among S. aureus isolates were previous exposure to mupirocin and previous infection by Pseudomonas aeruginosa. Although isolates of vancomycin-resistant S. aureus (VRSA) and vancomycin-intermediate S. aureus (VISA) strains have emerged in many parts of the world, the current results showed that vancomycin, teicoplanin, and linezolid had good activity against S. aureus isolated from clinical samples. This finding is similar to that of previous studies conducted in Iran (6), Italy (19), and Taiwan (22). These findings highlight the high relevance of proper antibiotic prescription, good surveillance programs, and principles of infection control in health care systems. Generally, these findings suggest a gradual decrease in the vulnerability of S. aureus to ampicillin, erythromycin, and tetracycline whereas other antibiotics, including vancomycin, teicoplanin, and linezolid have maintained their high efficiency. In a study reported from Iran, resistance rate to trimethoprim-sulfamethoxazole was found to vary between 19.3% and 69% (2). In the present survey, it was found that 16.8% of MRSA strains were resistant to trimethoprim-sulfamethoxazole.
The results demonstrated that 18 (14.4%) isolates and 50 (56%) isolates had iMLSB and cMLSB phenotype, respectively. This finding is similar to those reported by a study conducted in Turkey, which showed that the prevalence rates of iMLSB, cMLSB, and MSB phenotype among MRSA strains were 18%, 23%, and 48%, respectively (29). Low resistance rate of iMLSB phenotype was detected in many countries such as Canada (35.3%) (26 az rashidi), Iran (4.18%) (24 az rashidi), and USA (7%) (30), revealing the fact that the incidence of the iMLSB resistance phenotype varies widely from one region to another. These data suggest that failure to identify iMLSB phenotype may lead to failure in treatment with clindamycin (30). In the current study, the frequency of cMLSB phenotype was found to be higher than that of iMLSB phenotype; a similar finding was noted previously by Ghanbari et al. (31).
Hospital-associated MRSA (HA-MRSA) and community-associated MRSA (CA-MRSA) are generally distinguished from each other based on virulence and antibiotic resistance markers (2). Despite the fact that pvl carriage cannot be implemented as the only indicator of CA-MRSA, care should be taken to diagnose and treat infections caused by S. aureus strains harboring the pvl gene. The current study witnessed a frequency of 20% for pvl gene, similar to that reported by Goudarzi in Iran (24).
The most frequent toxin gene in the present study was found to be tst (67.2%), which is higher than that reported in Colombia (10%) (32), Malaysia (0.5%) (33), Sweden (22%) (34), and Iran (51.4%) (2).
In the present study, the frequency of eta was 12%, which was close to the rate reported in Czech (10%) (35) yet higher than the reported rate from Colombia (3%) (32) and lower than the previous rate reported from Turkey (19.2%) (36). The frequency rate of etb gene reported in the present study was relatively low (7.2%), which is in accordance with the results of other studies from Colombia (32) and Turkey (36).
It is well established that biofilm formation in S. aureus is regulated through expression of adhesion-related genes. In the current study, the most prevalent gene was the spa gene (100%) followed by clfA (94.4%), clfB (92%), fnbB (89.6%), fnbA (83.2%), ebp (58.4%), can (44.8%), and bbp (3.2%) genes. Similar findings on the frequency of clfA and clfB genes were reported by Ghasemian et al. (13), who reported high prevalence of clfA and clfB genes in comparison to other investigated adhesions. In the present study, the frequency of fnbA and fnbB genes were relatively high (13), similar to previous studies, emphasizing the important role these genes in MRSA colonization. The obtained results in present study about frequency of ebp (58.4%) and can (44.8%) encoding genes are, however, in contrast with those reported by Ghasemian et al. (13), who reported a frequency rate of 78% and 7%, respectively, for can and ebps genes in MRSA isolates. The existing difference in the frequencies of can and ebps genes in MRSA isolates may be justified in terms of clinical isolates and factors affecting gene regulation, which can have a role in the prevalence of these genes for colonization.
As for the frequency of agr specificity groups, the present study showed that the majority of tested isolates belonged to agr type I (52%). Indrawattana et al. (37) reported high frequency of agr type I (58.7%) among S. aureus isolated from clinical isolates. One study performed by Goudarzi et al. (5) in Iran showed agr type I as the dominant agr type among MRSA isolates. In contrast to the findings of the present study, showing that all the isolates carrying PVL-encoding genes and HLMUPR were associated with this agr type I, Goudarzi et al. (5) showed that PVL-positive isolates belonged to agr type III. The agr group III was the second most-common agr type identified in this study (34.4%). These findings are in line with those of previous reports about the predominance of agr III in Iran (5). In conformity with the results of the present study, low frequency of agr group II and agr group IV was reported in studies conducted by Ben Ayed et al. (38) and Ghasemian et al. (39). The frequency of toxin and adhesive molecule-encoding genes in isolates with agr type I was found to be higher than that for type III in the present study, which is in line with the results reported by other studies in various areas (40). Also, distribution of agr types is known to vary between geographic regions. This research also found that all toxin and adhesion genes were more prevalent in isolates with agr type I, a finding, which was previously shown by Nowrouzian et al. (34), reporting high frequency of sea and tst genes in MRSA isolates harboring the agr type III. The body of these findings help hypothesize that agr type I can have an indispensible role in the regulation of staphylococcal toxins and adhesions.
To summarize, this research investigated toxin and adhesion markers in S. aureus isolated from hospitalized patients at ICUs. The results of the current study showed that agr type I was predominant among tested isolates with high frequency of toxin and adhesion genes. The high frequency of agr type I in this study may reflect the indispensible role of this type in regulation of staphylococcal toxins and adhesions. To appreciate the prevalence and epidemiology of adhesion and toxin genes in different molecular types of S. aureus, ongoing surveillance and further studies are necessary.

Acknowledgments

References

  • 1.
    Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis. 2008;46 Suppl 5:S350-9. [PubMed ID: 18462090]. [PubMed Central ID: PMC2474459]. https://doi.org/10.1086/533591.
  • 2.
    Goudarzi M, Goudarzi H, Sa Figueiredo AM, Udo EE, Fazeli M, Asadzadeh M, et al. Molecular Characterization of Methicillin Resistant Staphylococcus aureus Strains Isolated from Intensive Care Units in Iran: ST22-SCCmec IV/t790 Emerges as the Major Clone. PLoS One. 2016;11(5). e0155529. [PubMed ID: 27171373]. [PubMed Central ID: PMC4865093]. https://doi.org/10.1371/journal.pone.0155529.
  • 3.
    Jevons MP. "Celbenin" - resistant Staphylococci. Br Med J. 1961;1(5219):124-5. https://doi.org/10.1136/bmj.1.5219.124-a.
  • 4.
    Dulon M, Haamann F, Peters C, Schablon A, Nienhaus A. MRSA prevalence in European healthcare settings: a review. BMC Infect Dis. 2011;11:138. [PubMed ID: 21599908]. [PubMed Central ID: PMC3128047]. https://doi.org/10.1186/1471-2334-11-138.
  • 5.
    Goudarzi M, Seyedjavadi SS, Nasiri MJ, Goudarzi H, Sajadi Nia R, Dabiri H. Molecular characteristics of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from patients with bacteremia based on MLST, SCCmec, spa, and agr locus types analysis. Microb Pathog. 2017;104:328-35. [PubMed ID: 28159661]. https://doi.org/10.1016/j.micpath.2017.01.055.
  • 6.
    Eftekhar F, Rezaee R, Azad M, Azimi H, Goudarzi H, Goudarzi M. Distribution of adhesion and toxin genes in staphylococcus aureus strains recovered from hospitalized patients admitted to the ICU. Arch Ped Infect Dis. 2016;5(1). https://doi.org/10.5812/pedinfect.39349.
  • 7.
    Gilot P, Lina G, Cochard T, Poutrel B. Analysis of the genetic variability of genes encoding the RNA III-activating components Agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis. J Clin Microbiol. 2002;40(11):4060-7. [PubMed ID: 12409375]. [PubMed Central ID: PMC139642]. https://doi.org/10.1128/JCM.40.11.4060-4067.2002.
  • 8.
    Tsompanidou E, Sibbald MJ, Chlebowicz MA, Dreisbach A, Back JW, van Dijl JM, et al. Requirement of the agr locus for colony spreading of Staphylococcus aureus. J Bacteriol. 2011;193(5):1267-72. [PubMed ID: 21169484]. [PubMed Central ID: PMC3067592]. https://doi.org/10.1128/JB.01276-10.
  • 9.
    Goudarzi M, Seyedjavadi SS, Azad M, Goudarzi H, Azimi H. Distribution of spa types, integrons and associated gene cassettes in staphylococcus aureus strains isolated from intensive care units of hospitals in Tehran, Iran. Arch Clin Infect Dis. 2016;11(4). https://doi.org/10.5812/archcid.38813.
  • 10.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; Twenty-Second Informational Supplement. CLSI; 2016.
  • 11.
    Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70(2):631-41. [PubMed ID: 11796592]. [PubMed Central ID: PMC127674]. https://doi.org/10.1128/IAI.70.2.631-641.2002.
  • 12.
    Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of Virulence Genes Among Methicillin Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur J Microbiol. 2014;7(6). e10741. [PubMed ID: 25371805]. [PubMed Central ID: PMC4217665]. https://doi.org/10.5812/jjm.10741.
  • 13.
    Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. Several virulence factors of multidrug-resistant staphylococcus aureus isolates from hospitalized patients in Tehran. Int J Enteric Pathog. 2015;3(2). https://doi.org/10.17795/ijep25196.
  • 14.
    Kumar JD, Negi YK, Gaur A, Khanna D. Detection of virulence genes in Staphylococcus aureus isolated from paper currency. Int J Infect Dis. 2009;13(6):e450-5. [PubMed ID: 19477670]. https://doi.org/10.1016/j.ijid.2009.02.020.
  • 15.
    Peacock SJ, Moore CE, Justice A, Kantzanou M, Story L, Mackie K, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70(9):4987-96. [PubMed ID: 12183545]. [PubMed Central ID: PMC128268]. https://doi.org/10.1128/IAI.70.9.4987-4996.2002.
  • 16.
    Rashidi Nezhad R, Meybodi SM, Rezaee R, Goudarzi M, Fazeli M. Molecular characterization and resistance profile of methicillin resistant staphylococcus aureus strains isolated from hospitalized patients in intensive care unit, Tehran-Iran. Jundishapur J Microbiol. 2017;10(3). https://doi.org/10.5812/jjm.41666.
  • 17.
    Goudarzi M, Fazeli M, Goudarzi H, Azad M, Seyedjavadi SS. Spa Typing of Staphylococcus aureus Strains Isolated From Clinical Specimens of Patients With Nosocomial Infections in Tehran, Iran. Jundishapur J Microbiol. 2016;9(7). e35685. [PubMed ID: 27679706]. [PubMed Central ID: PMC5035396]. https://doi.org/10.5812/jjm.35685.
  • 18.
    Guney AK. A study on class i integrons and antimicrobial resistance among clinical staphylococci isolates from a Turkish hospital. Clin Microbiol. 2014;3(6):173. https://doi.org/10.4172/2327-5073.1000173.
  • 19.
    Campanile F, Bongiorno D, Borbone S, Stefani S. Hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) in Italy. Ann Clin Microbiol Antimicrob. 2009;8:22. [PubMed ID: 19552801]. [PubMed Central ID: PMC2708121]. https://doi.org/10.1186/1476-0711-8-22.
  • 20.
    Dormanesh B, Siroosbakhat S, Khodaverdi Darian E, Afsharkhas L. Methicillin-Resistant Staphylococcus aureus Isolated From Various Types of Hospital Infections in Pediatrics: Panton-Valentine Leukocidin, Staphylococcal Chromosomal Cassette mec SCCmec Phenotypes and Antibiotic Resistance Properties. Jundishapur J Microbiol. 2015;8(11). e11341. [PubMed ID: 26862375]. [PubMed Central ID: PMC4741056]. https://doi.org/10.5812/jjm.11341.
  • 21.
    Havaei SA, Ghanbari F, Rastegari AA, Azimian A, Khademi F, Hosseini N, et al. Molecular Typing of Hospital-Acquired Staphylococcus aureus Isolated from Isfahan, Iran. Int Sch Res Notices. 2014;2014:185272. [PubMed ID: 27350987]. [PubMed Central ID: PMC4897504]. https://doi.org/10.1155/2014/185272.
  • 22.
    Wang WY, Chiueh TS, Sun JR, Tsao SM, Lu JJ. Molecular typing and phenotype characterization of methicillin-resistant Staphylococcus aureus isolates from blood in Taiwan. PLoS One. 2012;7(1). e30394. [PubMed ID: 22291948]. [PubMed Central ID: PMC3264593]. https://doi.org/10.1371/journal.pone.0030394.
  • 23.
    Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, et al. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol. 2005;43(1):421-6. [PubMed ID: 15635004]. [PubMed Central ID: PMC540159]. https://doi.org/10.1128/JCM.43.1.421-426.2005.
  • 24.
    Goudarzi M, Bahramian M, Satarzadeh Tabrizi M, Udo EE, Figueiredo AM, Fazeli M, et al. Genetic diversity of methicillin resistant Staphylococcus aureus strains isolated from burn patients in Iran: ST239-SCCmec III/t037 emerges as the major clone. Microb Pathog. 2017;105:1-7. [PubMed ID: 28179118]. https://doi.org/10.1016/j.micpath.2017.02.004.
  • 25.
    Gadepalli R, Dhawan B, Mohanty S, Kapil A, Das BK, Chaudhry R, et al. Mupirocin resistance in Staphylococcus aureus in an Indian hospital. Diagn Microbiol Infect Dis. 2007;58(1):125-7. [PubMed ID: 17240103]. https://doi.org/10.1016/j.diagmicrobio.2006.10.012.
  • 26.
    Aqel AA, Ibrahim A, Shehabi A. Rare occurrence of mupirocin resistance among clinical Staphylococcus isolates in Jordan. Acta Microbiol Immunol Hung. 2012;59(2):239-47. [PubMed ID: 22750783]. https://doi.org/10.1556/AMicr.59.2012.2.8.
  • 27.
    Petinaki E, Spiliopoulou I, Kontos F, Maniati M, Bersos Z, Stakias N, et al. Clonal dissemination of mupirocin-resistant staphylococci in Greek hospitals. J Antimicrob Chemother. 2004;53(1):105-8. [PubMed ID: 14657085]. https://doi.org/10.1093/jac/dkh028.
  • 28.
    Abbasi-Montazeri E, Khosravi AD, Feizabadi MM, Goodarzi H, Khoramrooz SS, Mirzaii M, et al. The prevalence of methicillin resistant Staphylococcus aureus (MRSA) isolates with high-level mupirocin resistance from patients and personnel in a burn center. Burns. 2013;39(4):650-4. [PubMed ID: 23499497]. https://doi.org/10.1016/j.burns.2013.02.005.
  • 29.
    Debdas D, Joshi S. Incidence of clindamycin resistance in clinical isolates of Staphylococcus aureus. J Infect Dev Ctries. 2011;5(4):316-7. [PubMed ID: 21537077]. https://doi.org/10.3855/jidc.1598.
  • 30.
    Schreckenberger PC, Ilendo E, Ristow KL. Incidence of constitutive and inducible clindamycin resistance in Staphylococcus aureus and coagulase-negative staphylococci in a community and a tertiary care hospital. J Clin Microbiol. 2004;42(6):2777-9. [PubMed ID: 15184468]. [PubMed Central ID: PMC427875]. https://doi.org/10.1128/JCM.42.6.2777-2779.2004.
  • 31.
    Ghanbari F, Ghajavand H, Havaei R, Jami MS, Khademi F, Heydari L, et al. Distribution of erm genes among Staphylococcus aureus isolates with inducible resistance to clindamycin in Isfahan, Iran. Adv Biomed Res. 2016;5:62. [PubMed ID: 27135031]. [PubMed Central ID: PMC4832884]. https://doi.org/10.4103/2277-9175.179184.
  • 32.
    Jimenez JN, Ocampo AM, Vanegas JM, Rodriguez EA, Garces CG, Patino LA, et al. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellin, Colombia. Mem Inst Oswaldo Cruz. 2011;106(8):980-5. [PubMed ID: 22241120]. https://doi.org/10.1590/S0074-02762011000800013.
  • 33.
    Lim KT, Hanifah YA, Mohd Yusof MY, Thong KL. Investigation of toxin genes among methicillin-resistant Staphylococcus aureus strains isolated from a tertiary hospital in Malaysia. Trop Biomed. 2012;29(2):212-9. [PubMed ID: 22735842].
  • 34.
    Nowrouzian FL, Dauwalder O, Meugnier H, Bes M, Etienne J, Vandenesch F, et al. Adhesin and superantigen genes and the capacity of Staphylococcus aureus to colonize the infantile gut. J Infect Dis. 2011;204(5):714-21. [PubMed ID: 21844297]. https://doi.org/10.1093/infdis/jir388.
  • 35.
    Sila J, Sauer P, Kolar M. Comparison of the prevalence of genes coding for enterotoxins, exfoliatins, panton-valentine leukocidin and tsst-1 between methicillin-resistant and methicillin-susceptible isolates of Staphylococcus aureus at the university hospital in olomouc. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2009;153(3):215-8. [PubMed ID: 19851435]. https://doi.org/10.5507/bp.2009.036.
  • 36.
    Demir C, Aslantaş, Ö, Duran, N, Ocak, S, Özer, B. Investigation of toxin genes in Staphylococcus aureus strains isolated in Mustafa Kemal University hospital. Turk J Med Sci. 2011;41(2):434-52. https://doi.org/10.3906/sag-1003-657.
  • 37.
    Indrawattana N, Sungkhachat O, Sookrung N, Chongsa-nguan M, Tungtrongchitr A, Voravuthikunchai SP, et al. Staphylococcus aureus clinical isolates: antibiotic susceptibility, molecular characteristics, and ability to form biofilm. Biomed Res Int. 2013;2013:314654. [PubMed ID: 24069597]. [PubMed Central ID: PMC3773402]. https://doi.org/10.1155/2013/314654.
  • 38.
    Ben Ayed S, Boutiba-Ben Boubaker I, Ennigrou S, Ben Redjeb S. Accessory gene regulator (agr) typing of Staphylococcus aureus isolated from human infections. Arch Inst Pasteur Tunis. 2008;85(1-4):3-8. [PubMed ID: 19469411].
  • 39.
    Ghasemian A, Peerayeh SN, Bakhshi B, Mirzaee M. Detection of accessory gene regulator groups genes and cassette chromosome mec types among Staphylococcus aureus isolated from intensive care unit patients. Asian Pac J Trop Dis. 2015;5(2):153-7. https://doi.org/10.1016/s2222-1808(14)60643-5.
  • 40.
    Shopsin B, Mathema B, Alcabes P, Said-Salim B, Lina G, Matsuka A, et al. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J Clin Microbiol. 2003;41(1):456-9. [PubMed ID: 12517893]. [PubMed Central ID: PMC149583]. https://doi.org/10.1128/JCM.41.1.456-459.2003.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles