The Impact of Mutations in Topoisomerase Genes and the Plasmid-Mediated Quinolone Resistance (PMQR) Determinants on the Resistance to Fluoroquinolones in Klebsiella pneumoniae

Author(s):
Alisha AkyaAlisha Akya1, Roya Chegene LorestaniRoya Chegene Lorestani2,*, Azam ElahiAzam Elahi2, Keyghobad GhadiriKeyghobad Ghadiri3
1Nosocomial Infections Research Center, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, IR Iran
2Department of Microbiology, Faculty of Medicine, Kermanshah University of Medical Sciences, Kermanshah, IR Iran
3Nosocomial Infections Research Center, Kermanshah University of Medical Sciences, Kermanshah, IR Iran

Archives of Clinical Infectious Diseases:Vol. 12, issue 4; e57290
Published online:Apr 26, 2017
Article type:Research Article
Received:Aug 21, 2016
Accepted:Feb 12, 2017
How to Cite:Akya A, Chegene Lorestani R, Elahi A, Ghadiri K. The Impact of Mutations in Topoisomerase Genes and the Plasmid-Mediated Quinolone Resistance (PMQR) Determinants on the Resistance to Fluoroquinolones in Klebsiella pneumoniae. Arch Clin Infect Dis. 2017;12(4):e57290. doi: https://doi.org/10.5812/archcid.57290

Abstract

Background:

Klebsiella pneumoniae causes a variety of infections including community acquired pneumonia and nosocomial infections.

Objectives:

The aim of this study was to determine the plasmid-associated quinolone-resistance (PMQR) genes and mutations in quinolone-resistance determining region (QRDR) of topoisomerase genes in K. pneumoniae.

Methods:

One hundred clinical K. pneumoniae isolates were collected from Kermanshah hospitals for this study. The minimum inhibitory concentrations (MIC) for levofloxacin and ciprofloxacin was determined by broth microdilution method. The presence of PMQR genes (qnrA, qnrB, qnrS, aac (6´)-Ib, and qepA) among isolates resistant to fluoroquinolones was detected by PCR. All PCR products for topoisomerase genes (gyrA, gyrB and parC) were sequenced and analyzed.

Results:

Sequence analysis showed mutations in gyrA at codons 83 and 87 in 24 (85.7%) and 20 (71.4%) of isolates, respectively. For parC mutations were detected at codons 80 and 84 in 15 (53.6%) and 7 (25%) isolates, respectively. At the outside of QRDR in gyrA and gyrB, mutations were also observed. The mutation was not detected in the QRDR of gyrB. The qnrB, qnrS, and aac (6')-Ib-cr were found in 1 (3.6%), 11 (39.3%) and 25 (89.3%) of isolates, respectively. Howevr, the qnrA and qepA genes were not detected among isolates.

Conclusions:

The resistance to fluoroquinolones is relatively high among K. pneumonia and mutations in QRDR of topoisomerase genes play an important role for this resistance. The plasmid-mediated genes also increase the level of resistance. The mutations outside the QRDR of topoisomerase genes also occur, but their exact role in resistance needs to be clarified.

1. Background

Klebsiella pneumoniae causes a variety of infections, in particular, the community-acquired pneumonia and nosocomial infections. Hospital-acquired infections caused by this organism include urinary tract infection, pneumonia, septicemia, and wound infection. It has been estimated that about 8% of nosocomial infections are caused by K. pneumoniae (1, 2). Given the acquisition of various resistant genes, the choice of effective antibiotics to treat infections caused by this bacterium has been limited. The broad-spectrum fluoroquinolones have been used to treat a wide range of bacterial infections (3). Fluoroquinolones bind to and inhibit the enzyme activity of topoisomerase II (DNA gyrase) and topoisomerase IV required for appropriate bacterial DNA functions. DNA gyrase is a tetramer enzyme consisting of two subunits A and two subunits B, which are coded by the gyrA and gyrB genes, respectively. Topoisomerase IV is also coded by two genes, parC and parE (4). DNA gyrase is involved in creating the negative super coiled DNA and the role of topoisomerase IV is to separate daughter chromosomes at the end of DNA replication cycles (5, 6).
Given the widespread use of fluoroquinolones, resistance to these drugs has been reported worldwide (7). So far, several mechanisms of resistance to fluoroquinolones have been identified which include mutations in topoisomerase genes (8) and reduce intracellular drug accumulation within the bacterial cell and the acquisition of plasmid-mediated quinolone-resistance genes (PMQR) (8). The mutation in topoisomerase genes is the common mechanism of resistance to fluoroquinolones and usually occurs in a certain quinolone-resistance determining region of DNA (QRDR). Mutations in gyrA are more common than gyrB gene (9). In gyrA, mutations usually occur at nucleotide 201 to 320 encoded amino acids 67 to 106, in particular at serine 83 and aspartate 87 (10). Mutations at codon 426 and 447 of gyrB usually make a low-level of resistance to fluoroquinolones (11, 12). Mutations in the amino acid 78, 80 and 84 positions of parC in K. pneumoniae resistant to fluoroquinolones have also been reported worldwide although with different rates (10, 13).
The acquisition of PMQR genes by K. Pneumoniae also plays an important role in the resistance to fluoroquinolones. Three PMQR genes have been reported which include qnr, aac(6')-Ib-cr and qepA. The qnr gene family encodes proteins that protect topoisomerase II and IV from quinolones impacts. The aac(6')-Ib-cr gene, which was first discovered in 2003, decreases the activity of fluoroquinolones including ciprofloxacin and norfloxacin (14, 15). The qepA gene causes a high level of resistance to hydrophilic fluoroquinolones (16).

2. Objectives

To better understand the role of these mechanisms in antibiotic resistance, this study aimed to determine mutations in the QRDR of gyrA, gyrB and parC genes and the frequency of PMQR genes in K. pneumoniae isolates resistant to fluoroquinolones.

3. Methods

3.1. Bacterial Isolates

In this experimental study, One hundred non-duplicate isolates of K. pneumoniae were collected from 2013 to 2014 in three general hospitals in Kermanshah during an increase of K. pneumoniae infection among hospitalized patients. The clinical samples included urine (n = 54, 54%), burn (n = 15, 15%), respiratory tract secretions (n = 15, 15%), and others (blood, wound and ascitic fluid) (n = 16, 16%). They were collected form 59 (59%) female and 41 (41%) male people with the average age of 39.5 ± 26 years old. All isolates were identified by bacteriological and biochemical tests followed by confirmation using API20E Kit (bio-Merieux, France).

3.2. Antibiotic Susceptibility Testing

Minimum inhibitory concentrations (MIC) of levofloxacin and ciprofloxacin (Sigma, USA) were determined by a standard broth microdilution method according to CLSI protocols (17). Briefly, Mueller-Hinton broth (Merck, Germany) with a final inoculum of 5 × 105 CFU/mL in 96-well plates were incubated at 37°C for 24 hours. E. coli strain ATCC 25922 was used as the standard drug- susceptible control for MIC measurements. The breakpoints recommended by CLSI were used for ciprofloxacin (susceptible ≤ 1 µg/mL; resistant ≥ 4 mg/mL) and levofloxacin (susceptible ≤ 2 µg/ mL; resistant ≥ 8 mg/mL).

3.3. DNA Extraction and PCR Assay

The DNA of isolates resistant to flouroquinolones was extracted using the boiling method. Amplification of the QRDR of gyrA, gyrB, and parC genes was carried out by PCR using specific primers (SinaClon, Iran) (Table 1). The PMQR genes (qnrA, qnrB, aac(6´)-Ib and qepA) were amplified using specific primers by PCR (SinaClon, Iran) (Table 1). After electrophoresis of PCR products on 1% agarose gel (Merck Co, Germany) and staining with ethidium bromide, the gels were visualized by gel-Documentation apparatus (BioRad, USA). PCR products were sequenced and analyzed by BLAST tools (http:// blast.ncbi.nlm.nih.gov/Blast.cgi).
Table 1.Primers Used in This Study
PrimerDNA Sequence 5′-3′Target SiteAmplicon Size, bpReference
gyrA6CGA CCT TGC GAG AGA AATQRDR of gyrA626(18)
gyrA631RGTT CCA TCA GCC CTT CAA
gyrB-FTCTACTGCTTYACCAACAACAQRDR of gyrB704(19)
gyrB-RCGTCCGCATCGGTCATGAT
parCFATGGCAGAGCGCCTTGCGQRDR of parC437(19)
parCRGCCGTCRAAGTTTGGCAC
qnrA-FATTTCTCACGCCAGGATTTGqnrA516(20)
qnrA-RGATCGGCAAAGGTTAGGTCA
qnrB-FGATCGTGAAAGCCAGAAAGGqnrB469(20)
qnrB-RACGATGCCTGGTAGTTGTCC
qnrS-FACGACATTCGTCAACTGCAAqnrS417(20)
qnrS-RTAAATTGGCACCCTGTAGGC
aac(6′)-Ib-FTTGCGATGCTCTATGAGTGGCTAaac(6′)-Ib482(15)
aac(6′)-Ib-RCTCGAATGCCTGGCGTGTTT
qepA-FGGACATCTACGGCTTCTTCGqepA720(14)
qepA-RAGCTGCAGGTACTGCGTCAT

Abbreviations: bp, base pair; F, forward primer; R, reverse primer.

3.4. Restriction Digestion

RFLP was used to differentiate the naive aac(6´)-Ib gene from those of the cr variant of this gene involved in flouroquinolones resistance. All PCR products for aac(6´)-Ib gene were digested by BtsCI restriction endonuclease (Fermentase, England). The presence of two DNA fragments with 272 and 210 bp by digestion indicated of aac(6´)-Ib, whereas an undigested DNA indicated of aac(6´)-Ib-cr variant.

3.5. Sequencing and Data Analysis

All PCR products for gyrA, gyrB, and parC genes were purified using a DNA purification kit and sequenced (SinaClon, Iran). The DNA sequence was performed using an ABI 3730XL DNA analyzer (Macrogen Inc, Korea). Sequence data were analyzed for homology using the national center for biotechnology information GenBank database (http://www.ncbi.nlm.nih.gov/). The nucleotide sequence data have been deposited in the pubmed genebank nucleotide sequence database (http://www.ncbi.nlm.nih.gov/).
All data were statistically analyzed using SPSS version 20 for associations between mutations with the PMQR genes and the level of flouroqinolone resistance by Kruskal-Wallis and Mann-Whitney tests.

4. Results

The antibiotic susceptibility and MIC of ciprofloxacin and levofloxacin for 100 K. pneumoniae isolates have been shown in Table 2 and Figure 1.
Table 2.Susceptibility of K. pneumoniae Isolates to Flouroquinolones
AntibioticSensitive, %Intermediate, %Resistance, %MIC50aMIC90bMIC Range
Ciprofloxacin666280.5640.015 - 1024
Levofloxacin711280.51280.015 - 256

aThe MIC at which 50% of the isolates are inhibited.

bThe MIC at which 90% of the isolates are inhibited.

The Distribution of Isolates According to Their MIC (µg/mL)
Figure 1.

The Distribution of Isolates According to Their MIC (µg/mL)

DNA sequence analysis of the QRDR of gyrA showed mutations at codon 83 of 24 (85.7%) and at codon 87 of 20 (71.4%) isolates (Table 3). Sequence analysis of parC showed 15(53.6%) isolates with a mutation at codon 80 and 7 (25%) isolates with a mutation at codon 84.
Table 3.The Frequency of Mutations and Amino Acid Changes Within gyrA, gyrB and parC of 28 Isolates Resistant to Fluroquinolonesz
GeneAmino Acid PositionNucleotide ChangesAmino Acids SubstituteNo. of Isolates (%)
gyrASerine 83/TCC → TTCPhenylalanine12 (42.9)
Asp87GAC → GCCAlanine
Serine 83/TCC → TTCPhenylalanine1 (3.6)
Asp87/GAC → GCCAlanine
Glu94CAG → CACHistidine
Serine 83/TCC → TTCPhenylalanine4 (14.3)
Asp87/GAC → AACAsparagine
Serine 83/TCC → TTCPhenylalanine3 (10.7)
Asp87/GAC → AACAsparagine
Thr161ACC → ATCIsoleucine
Serine 83TCC → ATCIsoleucine2 (7.1)
Serine 83TCC → TACTyrosine2 (7.1)
Glu94CAG → CACHistidine1 (3.6)
WT--3 (10.7)
gyrBAsp368GAC → AATAsparagine1 (3.6)
WT--27 (96.4)
ParCSer80AGC → ATCIsoleucine15 (53.6)
Glu84GAA → AAALysine7 (25)
WT--6 (21.4)

zAbbreviation: WT, wild type.

In three isolates, an extra mutation outside QRDR in gyrA at position 161 was detected which did not make significant changes in MIC of ciprofloxacin and levofloxacin in comparison with isolates without this mutation (P = 0.645). Similarly, one isolate with an extra mutation outside QRDR in gyrA at codon 94 had no significant impact on MIC compared with the isolates without this mutation for both antibiotics tested (P = 0.610). Sequence analysis of gyrB showed a mutation outside QRDR in one isolates at codon 368, which apparently did not increase bacterial MIC.
The qnrB and qnrS were found in 11 (39.3%) and 1 (3.6%) isolates, respectively. Of the 28 isolates selected for detection of the aac(6')-Ib-cr, 25 of 28 (89.3%) isolates were positive for aac (6')-Ib and all of them was the aac(6')-Ib-cr variant. PMQR genes enhanced the resistance of isolates to fluoroquinolones (Table 4).
Table 4.Fluoroquinolone (FQ) Resistance Determinants Detected in the K. pneumoniae and corresponding Minimum Inhibitory Concentration (MIC) of Ciprofloxacin (CIP) and levofloxacin (LVX)
PMQR GenesMutations in gyrA and/or parCMIC, μg/mL RangeNo. of Isolates (%)
CIPLVX
4 - 1632 - 128> 2564 - 1632 - 128> 256
qnrB+Ser83 + Asp87 + ser80 + Asp368111 (3.6)
aac-Ib-cr
qnrB+Ser83 + Asp87 + ser80/Glu8442426 (21.4)
aac(6´)-Ib-cr
aac(6´)-Ib-crSer83 + Asp87 + ser80/Glu84331527 (25)
-Ser83 + Asp87 + ser80/Glu841122 (7.1)
aac(6´)-Ib-crSer83 + Asp87 + Thr161 + Glu84313 (10.7)
aac(6´)-Ib-crSer83 + Asp87 + Glu94 + ser80111 (3.6)
qnrB+Ser83 + ser80111 (3.6)
aac(6´)-Ib-cr
-Ser83 + ser80111 (3.6)
qnrB+Ser83111 (3.6)
aac(6´)-Ib-cr
aac(6´)-Ib-crSer83111 (3.6)
aac(6´)-Ib-cr+-111 (3.6)
qnrS
qnrB+-111 (3.6)
aac(6´)-Ib-cr
aac(6´)-Ib-cr-111 (3.6)
qnrB+Glu94111 (3.6)
aac(6´)-Ib-cr

5. Discussion

The results of previous studies indicated that the rate of resistance to ciprofloxacin is higher than levofloxacin among Enterobacteriaceae (21, 22). However, in our study, all isolates resistant to ciprofloxacin were also resistant to levofloxacin but the average MIC for ciprofloxacin was higher than levofloxacin that indicate levofloxacin is slightly more effective against K. pneumoniae isolates.
The impact of mutations in DNA gyrase and topoisomerase IV on the resistance to fluoroquinolones in bacteria have previously been studied (23). In Gram-negative bacteria, mutations usually occur in subunit GyrA protein of DNA gyrase which is the first target of fluoroquinolones. DNA sequence analysis of our data showed 5 types of mutations in gyrA gene with amino acid changes among K. pneumoniae isolates which is consistent with the results of previous studies (13, 19). Mutation at codon 83 in gyrA was the most frequent one among fluoroquinolone resistant K. pneumonia and substitution of the serine by phenylalanine was the most common changes. This result is consistent with the results of other studies (24). Moreover, mutation outside QRDR of gyrA was also detected in three strains at codon 161. Another Iranian paper has reported this mutation among K. pneumoniae isolates (24).
The MIC of fluoroquinolones for isolates with two mutations in gyrA gene was higher than isolates with only one mutation that is similar to other studies’ results (25-28). Sequence analysis of QRDR in parC gene revealed two mutations with amino acid changes which have been reported by several previous studies (19, 29). In the present study, all isolates with mutations in parC showed also mutations in gyrA that may suggest the topoisomerase IV is the second target for the fluoroquinolones (12). The isolates with mutations in both gyrA and parC simultaneously showed the higher MIC levels, which is compatible with the results of previous studies (13, 30). In three isolates, mutations in gyrA outside of QRDR were detected, but these mutations apparently do not significantly change the MIC value in comparison with isolates without mutations. In three isolates, MIC level was high, but without any mutations in the QRDR of gyrA, gyrB and parC genes. Since the plasmid genes can cause a low level of resistance, there may be other resistance mechanisms that involve such efflux pumps and mutation in parE gene as it has been reported by other studies. For instance, Al-Marzooq et al. and Park et al. have reported the K. pneumoniae isolates with resistant to ciprofloxacin but with no mutations in gyrA and parC. They suggested PMQR genes play an important role in the resistance to ciprofloxacin (13, 31).
The aac (6') -Ib-cr gene has recently been reported among bacteria and was the most common gene in our study. This is consistent with the results of other studies in Iran, South Korea and Sweden (32-34). In some studies in China and Thailand a low prevalence for aac (6') -Ib-cr has been reported (35, 36). Similarly, in these studies the frequency of aac (6') -Ib-cr was also higher than other genes. The frequency of qnrB gene in our study was high that is supported by the results of other studies (37, 38). On the other hand, the qnrS gene had a very low frequency, which is also similar to the results of previous studies, including studies in Iran, South Korea and China (33, 35). Furthermore, qnrA and qepA genes has not been found in several studies, including in Iran, Korea, Malaysia, which support our data for these genes (38, 39).

5.1. Conclusions

In conclusion, resistance to fluoroquinolones is relatively high among K. pneumoniae in Kermanshah. The MIC of isolates for fluoroquinolones increases by the accumulation of mutations within QRDR and harboring more PMQR genes. It seems that mutations in QRDR of topoisomerase genes play an important role in K. pneumoniae resistant to fluoroquinolones. The plasmid mediated genes also increase the level of resistance. The mutations outside the QRDR of topoisomerase genes also occur in K. pneumoniae isolates but their exact role in resistance is not clear.

Acknowledgments

Footnotes

References

  • 1.
    Sahly H, Podschun R. Clinical, bacteriological, and serological aspects of Klebsiella infections and their spondylarthropathic sequelae. Clin Diagn Lab Immunol. 1997;4(4):393-9. [PubMed ID: 9220153].
  • 2.
    Livermore DM. Current epidemiology and growing resistance of gram-negative pathogens. Korean J Intern Med. 2012;27(2):128-42. [PubMed ID: 22707882]. https://doi.org/10.3904/kjim.2012.27.2.128.
  • 3.
    Sarkozy G. Quinolone:a class of antimicrobial agents. J Vet Med. 2001;46(9-10):257-74.
  • 4.
    Hooper DC. Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis. 2001;7(2):337-41. [PubMed ID: 11294736]. https://doi.org/10.3201/eid0702.700337.
  • 5.
    Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother. 2003;51(5):1109-17. [PubMed ID: 12697644]. https://doi.org/10.1093/jac/dkg222.
  • 6.
    Ambrozic Avgustin J, Keber R, Zerjavic K, Orazem T, Grabnar M. Emergence of the quinolone resistance-mediating gene aac(6')-Ib-cr in extended-spectrum-beta-lactamase-producing Klebsiella isolates collected in Slovenia between 2000 and 2005. Antimicrob Agents Chemother. 2007;51(11):4171-3. [PubMed ID: 17846136]. https://doi.org/10.1128/AAC.01480-06.
  • 7.
    Zibaei M, Firoozeh F. Detection of qnrA gene among quinolone-resistant Escherichia coli isolated from urinary tract infections in Khorram Abad during 2011-2012. KAUMS J. 2013;17(5):488-94.
  • 8.
    Hooper DC. Mechanisms of quinolone resistance. In: Hooper DC, Rubenstein E, editors. Quinolone antimicrobial agents. Washington: American Society for Microbiology Press; 2003. p. 41-67.
  • 9.
    El-Sokkary MMA, Abdelmegeed ES. Antibacterial resistance pattern among Escherichia coli strains isolated from Mansoura hospitals in Egypt with a special reference to quinolones. Afr J Microbiol Res. 2015;9(9):662-70.
  • 10.
    Ito CA, Gales AC, Tognim MC, Munerato P, Dalla Costa LM. Quinolone-resistant Escherichia coli. Braz J Infect Dis. 2008;12(1):5-9. [PubMed ID: 18553006].
  • 11.
    De la Fuente CM, Dauros SP, Bello TH, Dominguez YM, Mella MS, Sepulveda AM, et al. [Mutations in gyrA and gyrB genes among strains of Gram-negative bacilli isolated from Chilean hospitals and their relation with resistance to fluoroquinolones]. Rev Med Chil. 2007;135(9):1103-10. [PubMed ID: 18064363].
  • 12.
    Gharib AA, El-Aziz NKA. Molecular an analysis of quinolone resistance-determining regions in avian pathogenic Escherichia coli. Int J Adv Res. 2013;1:145-57.
  • 13.
    Al-Marzooq F, Mohd Yusof MY, Tay ST. Molecular analysis of ciprofloxacin resistance mechanisms in Malaysian ESBL-producing Klebsiella pneumoniae isolates and development of mismatch amplification mutation assays (MAMA) for rapid detection of gyrA and parC mutations. Biomed Res Int. 2014;2014:601630. [PubMed ID: 24860827]. https://doi.org/10.1155/2014/601630.
  • 14.
    Kang HY, Tamang MD, Seol SY, Kim J. Dissemination of Plasmid-mediated qnr, aac(6')-Ib-cr, and qepA Genes Among 16S rRNA Methylase Producing Enterobacteriaceae in Korea. J Bacteriol Virol. 2009;39(3):173. https://doi.org/10.4167/jbv.2009.39.3.173.
  • 15.
    Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6')-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006;50(11):3953-5. [PubMed ID: 16954321]. https://doi.org/10.1128/AAC.00915-06.
  • 16.
    Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, Kato H, et al. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother. 2007;51(9):3354-60. [PubMed ID: 17548499]. https://doi.org/10.1128/AAC.00339-07.
  • 17.
    CLSI informational supplement. Performance standards for antimicrobial susceptibility testing. Wayne: Clinical and Laboratory Standards Institute; 2011.
  • 18.
    Weigel LM, Steward CD, Tenover FC. gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrob Agents Chemother. 1998;42(10):2661-7. [PubMed ID: 9756773].
  • 19.
    Paltansing S, Kraakman M, Ras JMC, Wessels E, Bernards AT. Characterization of fluoroquinolone and cephalosporin resistance mechanisms in Enterobacteriaceae isolated in a Dutch teaching hospital reveals the presence of an Escherichia coli ST131 clone with a specific mutation in parE. J Antimicrob Chemother. 2012;68(1):40-5.
  • 20.
    Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother. 2006;50(8):2872-4. [PubMed ID: 16870791]. https://doi.org/10.1128/AAC.01647-05.
  • 21.
    Fu Y, Zhang W, Wang H, Zhao S, Chen Y, Meng F, et al. Specific patterns of gyrA mutations determine the resistance difference to ciprofloxacin and levofloxacin in Klebsiella pneumoniae and Escherichia coli. BMC Infect Dis. 2013;13:8. [PubMed ID: 23295059]. https://doi.org/10.1186/1471-2334-13-8.
  • 22.
    Morgan-Linnell SK, Becnel Boyd L, Steffen D, Zechiedrich L. Mechanisms accounting for fluoroquinolone resistance in Escherichia coli clinical isolates. Antimicrob Agents Chemother. 2009;53(1):235-41. [PubMed ID: 18838592]. https://doi.org/10.1128/AAC.00665-08.
  • 23.
    Frank T, Mbecko JR, Misatou P, Monchy D. Emergence of quinolone resistance among extended-spectrum beta-lactamase-producing Enterobacteriaceae in the Central African Republic: genetic characterization. BMC Res Notes. 2011;4:309. [PubMed ID: 21867486]. https://doi.org/10.1186/1756-0500-4-309.
  • 24.
    Asadpour L. Study of Amino Acid Alteration in graA & parC Genes in Quinolone Resistant Klebsiella pnemoniae. Crescent J Med Biol Sci. 2016;4(1).
  • 25.
    Willmott CJ, Maxwell A. A single point mutation in the DNA gyrase A protein greatly reduces binding of fluoroquinolones to the gyrase-DNA complex. Antimicrob Agents Chemother. 1993;37(1):126-7. https://doi.org/10.1128/aac.37.1.126.
  • 26.
    Al-Agamy MHM, Shibl AM, Radwan HH. Detection of mutations in quinolone-resistant determining regions in clinical isolates of Escherichia coli from Saudi Arabia. Afr J Biotechnol. 2012;11(5):1054-8.
  • 27.
    Heisig P, Schedletzky H, Falkenstein-Paul H. Mutations in the gyrA gene of a highly fluoroquinolone-resistant clinical isolate of Escherichia coli. Antimicrob Agents Chemother. 1993;37(4):696-701. [PubMed ID: 8388197].
  • 28.
    Vila J, Ruiz J, Marco F, Barcelo A, Goni P, Giralt E, et al. Association between double mutation in gyrA gene of ciprofloxacin-resistant clinical isolates of Escherichia coli and MICs. Antimicrob Agents Chemother. 1994;38(10):2477-9. [PubMed ID: 7840592].
  • 29.
    Deguchi T, Fukuoka A, Yasuda M, Nakano M, Ozeki S, Kanematsu E, et al. Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae. Antimicrob Agents Chemother. 1997;41(3):699-701. [PubMed ID: 9056017].
  • 30.
    Drago L, Nicola L, Mattina R, De Vecchi E. In vitro selection of resistance in Escherichia coli and Klebsiella spp. at in vivo fluoroquinolone concentrations. BMC Microbiol. 2010;10:119. [PubMed ID: 20409341]. https://doi.org/10.1186/1471-2180-10-119.
  • 31.
    Park DJ, Yu JK, Park KG, Park YJ. Genotypes of ciprofloxacin-resistant Klebsiella pneumoniae in Korea and their characteristics according to the genetic lineages. Microb Drug Resistance. 2015;21(6):622-30.
  • 32.
    Eftekhar F, Seyedpour S. Prevalence of qnr and aac(6')-Ib-cr Genes in Clinical Isolates of Klebsiella Pneumoniae from Imam Hussein Hospital in Tehran. Iran J Med Sci. 2015;40(6):515-21. [PubMed ID: 26538780].
  • 33.
    Yang HY, Nam YS, Lee HJ. Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea. Can J Infect Dis Med Microbiol. 2014;25(3):163-9. [PubMed ID: 25285114].
  • 34.
    Karah N, Poirel L, Bengtsson S, Sundqvist M, Kahlmeter G, Nordmann P, et al. Plasmid-mediated quinolone resistance determinants qnr and aac(6')-Ib-cr in Escherichia coli and Klebsiella spp. from Norway and Sweden. Diagn Microbiol Infect Dis. 2010;66(4):425-31. [PubMed ID: 20226333]. https://doi.org/10.1016/j.diagmicrobio.2009.12.004.
  • 35.
    Jiang Y, Zhou Z, Qian Y, Wei Z, Yu Y, Hu S, et al. Plasmid-mediated quinolone resistance determinants qnr and aac(6')-Ib-cr in extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J Antimicrob Chemother. 2008;61(5):1003-6. [PubMed ID: 18299311]. https://doi.org/10.1093/jac/dkn063.
  • 36.
    Pasom W, Chanawong A, Lulitanond A, Wilailuckana C, Kenprom S, Puang-Ngern P. Plasmid-mediated quinolone resistance genes, aac(6')-Ib-cr, qnrS, qnrB, and qnrA, in urinary isolates of Escherichia coli and Klebsiella pneumoniae at a teaching hospital, Thailand. Jpn J Infect Dis. 2013;66(5):428-32. [PubMed ID: 24047744].
  • 37.
    Saiful Anuar AS, Mohd Yusof MY, Tay ST. Prevalence of plasmid-mediated qnr determinants and gyrase alteration in Klebsiella pneumoniae isolated from a university teaching hospital in Malaysia. Eur Rev Med Pharmacol Sci. 2013;17(13):1744-7. [PubMed ID: 23852897].
  • 38.
    Shams E, Firoozeh F, Moniri R, Zibaei M. Prevalence of plasmid-mediated quinolone resistance genes among extended-spectrum β-Lactamase-producing Klebsiella pneumoniae human isolates in Iran. J Pathogens. 2015;2015.
  • 39.
    Alheib O, Al Kayali R, Abajy MY. Prevalence of Plasmid-Mediated Quinolone Resistance (PMQR) Determinants Among Extended Spectrum Beta-Lactamases (ESBL)-Producing Isolates of Escherichia coli and Klebsiella pneumoniae in Aleppo, Syria. Arch Clin Infect Dis. 2015;10(3). https://doi.org/10.5812/archcid.20631.
Indexed in

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles