The Frequency of imp and vim Genes Among Pseudomonas aeruginosa Isolates From Children’s Medical Center of Tehran

Author(s):
Fatemeh Bagheri BejestaniFatemeh Bagheri Bejestani1, Mojdeh Hakemi-ValaMojdeh Hakemi-Vala2,*, Raheleh MomtaheniRaheleh Momtaheni1, Ozra Bagheri BejestaniOzra Bagheri Bejestani3, Mehrdad GholamiMehrdad Gholami2
1Pharmaceutical Sciences Branch, Islamic Azad University, Tehran, IR Iran
2Department of Microbiology, Medical School, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
3Molecular Biology Research Center, Baghiyatallah University of Medical Sciences, Tehran, IR Iran

Archives of Clinical Infectious Diseases:Vol. 10, issue 1; e60116
Published online:Jan 25, 2015
Article type:Research Article
Received:Jun 06, 2014
Accepted:Jan 13, 2015
How to Cite:Bagheri Bejestani F, Hakemi-Vala M, Momtaheni R, Bagheri Bejestani O, Gholami M. The Frequency of imp and vim Genes Among Pseudomonas aeruginosa Isolates From Children’s Medical Center of Tehran. Arch Clin Infect Dis. 2015;10(1):e60116. doi: https://doi.org/10.5812/archcid.20991

Abstract

Background:

The first report of Pseudomonas aeruginosa (P. aeruginosa) carbapenem resistant strains, and especially the Metallo-Beta-Lactam (MBL) producers was from Japan, however, further reports were global.

Objectives:

The current study aimed to determine the frequency of vim and imp genes among P. aeruginosa MBL producer isolated from Children Medicinal Center during from 2011 to 2012.

Materials and Methods:

In the current descriptive study, 90 P. aeruginosa strains were collected from different clinical samples of children referring to Children’s Medical Center of Tehran, Iran. All the isolates were identified and confirmed by the standard tests. Their resistance against common antibiotics was determined by disk diffusion method based on Clinical and Laboratory Standards Institute (CLSI) 2010 protocol. The MBL producers were screened by Combined Disk Diffusion test (CDDT) and using imp-imp/Ethylen Ediamine Tetra Acetic Acid (EDTA), and increasing of 7 mm≤ the diameter of inhibiting zone. The frequency of vim and imp genes was determined by Polymerase Chain Reaction (PCR).

Results:

Based on standard tests including Triple Sugar Iron Agar and Oxidation- Fermentation (OF) media and disability of the bacteria for glucose fermentation, 90 P. aeruginosa strains were confirmed. Their resistance against the following antibiotics was evaluated by disk diffusion method: 36.6% to cefotaxim, cefpodoxim and ticarcillin 33.3%, meropenem and aztreonam 32.2%, amikacin 28.8%, ciprofloxacin and ceftriaxon 27.7%, ceftazidime 22.3% and imipenem 15.5%. By PCR the frequency of imp gene with its 328 base pair band was (3.3%). The vim gene was not detected among the tested strains.

Conclusions:

Despite of high resistance of P. aeruginosa, the resistance rate of P. aeruginosa strains isolated from children in the current study was not high. Then accurate prescription of antibiotics can decrease the speed of resistance creation.

1. Background

Pseudomonas aeruginosa (P. aeruginosa) is the major cause of the life threatening agent in nosocomial infections. Although P. aeruginosa strains are intrinsically resistant against beta lactams, they are usually sensitive to carbapenems (1). Therefore, carbapenems are usually the last chance in multidrug resistant strains (2). Worldwide emergence of new resistant strains, due to change in their intrinsic and acquired resistant genes urge more studies to identify resistance profile of local colonies (3). After several worldwide reports on the emergence of P.aeruginosa resistant strains, it was found that being armed with different resistant mechanisms like enzyme production, changes in poring permeability, and efflux pumps were presumptive resistance reasons of the bacteria. Metallo-Beta-Lactamase (MBL) production, which is related to plasmidic genes like imp and vim is a common mechanism of the acquired resistance to carbapenems. MBL is related to class B Ambler which can hydrolyze Beta-Lactams, cephalosporins, and carbapenems. Their function is inhibited by Ethylenediaminetetraacetic Acid (EDTA) and thiol compounds (4-7). There are many reports on P. aeruginosa MBL producers from Asia, South Europe, and Brazil (8-10).

2. Objectives

The current study aimed to determine the frequency of vim and imp distribution among P. aeruginosa MBL producer strains isolated from patients of Children Medicinal Center during from 2011 to 2012.

3. Materials and Methods

Bacterial isolates: In this descriptive study, 90 Pseudomonas aeruginosa (P. aeruginosa) strains were isolated from different clinical samples of children under 18 years old referring to Children Medicinal Center of Tehran, Iran during from September 2011 to March 2012. The sample size was determined based on the frequency of MBL producer P. aeruginosa isolates (4.8%), with 95% confidence interval and distance 0.1 in the standard formula (N = (p)(q)(1.96)2/d2) (11).
Bacterial isolation and identification was done based on standard bacteriologic methods including Oxidase test, Glucose fermentation in Triple Sugar Iron agar (TSI) (Merck, Germany), and Oxidation-Fermentation (OF) test, growing in 42°C, and motility and pigmentation (12). Only the P. aeruginosa strains, isolated during six months (from September 2011 to March 2012) were included in this study. Therefore, all replicated isolates were excluded from the study. The ethical approved code was the same as that of grant number 11505. All information regarding the patient's name and gender were reserved in this study.
Antimicrobial sensitivity test: the sensitive or resistance of the isolated bacteria was evaluated against the following antibiotics, based on CLSI 2012: ceftazidime (30 μg), cefepime (30 μg), aztreonam (30 μg), imipenem (10 μg), meropenem (10 μg), amikacin (10 μg), and ciprofloxacin (30 μg), ceftriaxon (30 μg), cefotaxim (30 μg), cefpodoxim (10 μg), ticarcillin (75 μg) (all purchased from Mast Ltd,UK ) (13).
All plates were incubated at 37°C for 18 hours. Finally, the diameter of zone of inhibition was determined. Pseudomonas aeruginosa American ATCC 27853 and Escherichia coli 25922 were simultaneously used as control strains. Minimum Inhibitory Concentration (MIC) of imipenem was detected by E-test strips (Lioflichem, Denmark) in the similar conditions of antibiotic sensitivity test based on CLSI 2012 protocol.

3.1. Combination Disk Diffusion Test (CDDT)

Continuously, Metalo-Beta-Lactamase (MBL) producers were screened by imipenem disk alone and in combination with 5 μ EDTA (0.5 M). Any changes in diameter zone of inhibition ≥ 7 mm were considered as MBL positive (13).

3.2. DNA Extraction

To determine the frequency of resistant genes, at first DNA extraction was done by the boiling method. The concentration of extracted DNA was determined at 260 nm and using nano-drop. Simultaneously, P. aeruginosa strain PAO1 was used as the quality control strain.

3.3. Polymerase Chain Reaction Method

Frequency of imp and vim genes were detected by primers (and Polymerase Chain Reaction (PCR) programs as follow: Initiation denaturation 95°C five minutes, denaturation 95°C one minute, annealing 55°C one minute, extension 72°C one minute, and final extension 72°C five minutes (35 cycles). The primer sequences were obtained from the data bank, National Center for Biotechnology Information (NCBI). A P. aeruginosa isolate with mutated imp gene submitted with accession No. JX644173 was used as the control strain, simultaneously. The PCR products were visualized after staining by ethidium bromide and under Ultraviolent (UV) irradiation.
Table 1. Sequence of Used Primers
GenesPrimersPCR Product Size, bp
imp5’ GAAGGCGTTTATGTTCATAC 3’; 5’ GTAAGTTTCAAGAGTGATGC 3’587
vim5’ GTTTGGTCGCATATCGCAAC 3’; 5’ AATGCGCAGCACCAGGATAG 3’382

3.4. Data Analysis

All data was submitted in an excel sheet and the results were analyzed by SPSS software version 16.0.

4. Results

During six months from September 2011 to March 2012, 90 P. aeruginosa strains were isolated from different clinical samples from children referring to Children’s Medicinal Center of Tehran, Iran. All patients were under 18 years old. The clinical samples were included: 50 urine, 15 blood, 14 tracheal aspirates, five wound swabs, four biologic fluids, and two throat swabs. Bacteria were identified based on the results of the following biochemical and bacteriologic tests: Gram negative bacilli, oxidase positive, non-fermenter (K/K) on TSI and OF media, and green pigmentation on Muller-Hinton Agar. Resistance of the isolates against the tested antibiotics was as follows, based on disk diffusion method: 36.6% to cefotaxim, cefpodoxim and ticarcillin 33.3%, meropenem and aztreonam 32.2%, amikacin 28.8%, ciprofloxacin and ceftriaxon 27.7%, ceftazidime 22.3%, and imipenem 15.5%. MIC of imipenem resistant isolates was determined by E-test as 64 µg/mL (Table 2). The resistance criteria for the tested antibiotic disks, MIC for imipenem in E-test, and the difference more than 7 mm between the inhibition zones of imipenem and imipenem/EDTA were determined based on the CLSI 2012; therefore, the frequency of MBL production was (3.3%). The frequency of imp gene with its 587 base pair band was detected in three out of 90 P. aeruginosa (3.3%) isolates. The vim gene was not detected in any of MBL positive isolates (0%).
Table 2. The Minimum Inhibitory Concentration Range for imp Among P. aeruginosa Strains a
AntibioticPseudomonas aeruginosa
MIC50MIC90MIC Range
Imipenem32642 - 128

a Data is Presented as µg/mL.

5. Discussion

In the current study, 90 P. aeruginosa strains were isolated from non-duplicated clinical samples of children referring to Children’s Medicinal Center of Tehran, Iran during six months from September 2011 to March 2012. The resistance rate of all isolates was determined against common antibiotics by disk diffusion method; MIC was also determined for imipenem by E-test strips. It was cleared that out of 10 tested antibiotics the highest resistance rate was detected against cefotaxim (36.6%), and the least rate was found against imipenem (15.5%). Fazeli et al. indicated that resistance rate of P. aeruginosa against ceftazidime was 83.3%. The other study in Tabriz, Iran, declared that, 50% of P. aeruginosa strains were resistant against this group of antibiotics (14, 15). In another study conducted by Hakemi-Vala, 62.95% of P. aeruginosa strains isolated from burnt wounds showed resistance against ceftazidim (16). These results were in contrast to the obtained results which indicated that, only 23.3% of P. aeruginosa strains were resistant against ceftazidim. All aforementioned studies were performed in different parts of Iran in different time; therefore, their origin is not same and, the difference between the results may derive from the group of patients, time of sampling, and the origin. Pseudomonas aeruginosa are the responsible for the life threatening conditions in burnt patients with immunodeficiency. Then, isolation of P. aeruginosa strains with higher resistance against the antibiotics from such patients is not strange. Also, border cities, may have better conditions for immigration and exchange of resistant bacteria. Indiscriminate use of antibiotic is another reason for this discrepancy. In addition, the bacterial origin in the current study was the children referring to Children’s Medicinal Center of Tehran, Iran. Then, proper antibiotic consumption may be related to lower rates of antibiotic resistance.
In Fazeli et al. study, none of the P. aeruginosa strains were MBL producer based on CDDT and all the isolates were sensitive to imipenem and meropenem; also, none of bla, imp, and vim genes were detected by PCR (14). Some of these results were in contrast to our study which showed three out of 90 P. aeruginosa isolates were MBL producer (3.3%) and all these three isolates carried imp gene after PCR analysis. However, no vim gene was detected among tested P. aeruginosa isolates in both studies. As mentioned before, the difference between time of sampling, change in treatment protocol, and also different primers sequences, which were used, may be the main factors which cause the difference between the two studies.
In Shahcheraghi et al. study of 610 P. aeruginosa isolates 68 were imipenem resistant with (MIC ≥ 4 µg/mL) and 16 out of 68 were positive for Verona Integron encoded MBL (VIM-1) gene by PCR. The difference in imipenem resistant between the two studies (11.14% in Shahcheraghi study vs. to 3.3% in the recent study, respectively) may be related to the difference in time, hospitals, and also age of patients (adults vs. to children in the recent study), who were from different wards of hospitals, in Shahcheraghi study compare to children who referred to Children’s Medicinal Center of Tehran, Iran in the recent study (17).
Children are the most vulnerable part of a population, because of their immature immune system. So, the results of any research about their infectious diseases and microbial agents, including this study are very important. One of the weak points of this study is limitation of the recent results to only 90 bacterial strains which were isolated from children who referred to Children’s Medicinal Center of Tehran, Iran. To generalize giving results to all P. aeruginosa strains, originated from other children of Tehran, Iran and also Iran, the sample size must be extended and included more hospitals. However, the position of this hospital as the main Children’s referral Center in Tehran, Iran and even Iran is very important.
In conclusion, despite of many reports from Iran, or/even worldwide about high resistance rate to carbapenems among P. aeruginosa strains nowadays, hopefully, in this study the resistant rate to carbapenems among P. aeruginosa originated from the children of an important Children’s Health Center of Tehran, Iran was not high. Also, doing antimicrobial sensitivity test before any prescription is highly recommended. In addition, prudent consuming of the antibiotics under physician surveillance and awareness of patients about its right taking can reduce the emergence of resistant strains.

Acknowledgments

Footnotes

References

  • 1.
    Lee K, Lim YS, Yong D, Yum JH, Chong Y. Evaluation of the Hodge test and the imipenem-EDTA double-disk synergy test for differentiating metallo-beta-lactamase-producing isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol. 2003;41(10):4623-9. [PubMed ID: 14532193].
  • 2.
    Rodriguez-Martinez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53(11):4783-8. [PubMed ID: 19738025]. https://doi.org/10.1128/AAC.00574-09.
  • 3.
    Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-beta-lactamases in a large centralized laboratory. J Clin Microbiol. 2005;43(7):3129-35. [PubMed ID: 16000424]. https://doi.org/10.1128/JCM.43.7.3129-3135.2005.
  • 4.
    Poirel L, Nordmann P. Acquired carbapenem-hydrolyzing beta-lactamases and their genetic support. Curr Pharm Biotechnol. 2002;3(2):117-27. [PubMed ID: 12022255].
  • 5.
    Morita Y, Komori Y, Mima T, Kuroda T, Mizushima T, Tsuchiya T. Construction of a series of mutants lacking all of the four major mex operons for multidrug efflux pumps or possessing each one of the operons from Pseudomonas aeruginosa PAO1: MexCD-OprJ is an inducible pump. FEMS Microbiol Lett. 2001;202(1):139-43. [PubMed ID: 11506922].
  • 6.
    Samuelsen O, Buaro L, Giske CG, Simonsen GS, Aasnaes B, Sundsfjord A. Evaluation of phenotypic tests for the detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa in a low prevalence country. J Antimicrob Chemother. 2008;61(4):827-30. [PubMed ID: 18227087]. https://doi.org/10.1093/jac/dkn016.
  • 7.
    Jean SS, Hsueh PR, Lee WS, Yu KW, Liao CH, Chang FY, et al. Carbapenem susceptibilities and non-susceptibility concordance to different carbapenems amongst clinically important Gram-negative bacteria isolated from intensive care units in Taiwan: results from the Surveillance of Multicentre Antimicrobial Resistance in Taiwan (SMART) in 2009. Int J Antimicrob Agents. 2013;41(5):457-62. [PubMed ID: 23507415]. https://doi.org/10.1016/j.ijantimicag.2013.02.001.
  • 8.
    Livermore DM. The impact of carbapenemases on antimicrobial development and therapy. Curr Opin Investig Drugs. 2002;3(2):218-24. [PubMed ID: 12020049].
  • 9.
    Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect. 2002;8(6):321-31. [PubMed ID: 12084099].
  • 10.
    Polotto M, Casella T, de Lucca Oliveira MG, Rubio FG, Nogueira ML, de Almeida MT, et al. Detection of P. aeruginosa harboring bla CTX-M-2, bla GES-1 and bla GES-5, bla IMP-1 and bla SPM-1 causing infections in Brazilian tertiary-care hospital. BMC Infect Dis. 2012;12:176. [PubMed ID: 22863113]. https://doi.org/10.1186/1471-2334-12-176.
  • 11.
    Su SC, Vaneechoutte M, Dijkshoorn L, Wei YF, Chen YL, Chang TC. Identification of non-fermenting Gram-negative bacteria of clinical importance by an oligonucleotide array. J Med Microbiol. 2009;58(Pt 5):596-605. [PubMed ID: 19369521]. https://doi.org/10.1099/jmm.0.004606-0.
  • 12.
    Murray PR, Baron EJ, Jorgensen JH, Landry ML, P.faller MA. Manual of clinical microbiology. 9th ed. Washington DC: ASM Press; 2007. p. 164-719- 28, 749.
  • 13.
    Clinical and Laboratory Standards Institute. Performance standards for Antimicrobial Susceptibility Testing (CLSI). . 32(3). Wayne, PA, USA; 2012.
  • 14.
    Fazeli,H, Sadighian,H, Nasr Esfahani, B, Pourmand, M.R. Identification of Class-1 Integron and Various β-lactamase Classes among Clinical Isolates of Pseudomonas aeruginosa at Children's Medical Center Hospital. J Med Bacteriol. 2012;1(2):25-36.
  • 15.
    Ghorashi Z, Nezami N, Ghotaslou R, Ghorashi S. Pattern of Pseudomonas aeruginosa drug resistance in Tabriz Children Hospital. Pak J Biol Sci. 2010;13(8):400-4. [PubMed ID: 20836302].
  • 16.
    Hakemi-Vala M, Hallajzadeh M, Fallah F, Hashemi A, Goudarzi H. Characterization of the Extended-Spectrum beta-Lactamase Producers among Non-Fermenting Gram-Negative Bacteria Isolated from Burnt Patients. Arch Hyg Sci. 2013;2(1):1-6.
  • 17.
    Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol. 2010;33(3):243-8. [PubMed ID: 20954442].

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles