1. Background
Acinetobacter baumannii is an oxidase-negative and catalase-positive non-motile gram-negative pathogen. It is responsible for infections in skin and soft tissue, bloodstream, meningitis, urinary tract infection, pneumonia, ventilator-associated pneumonia and endocarditis, and patients in intensive care units and immunocompromised patients are at high risk for acquiring this pathogen (1, 2). Large genomic plasticity and mutation of endogenous structural or regulatory genes, overexpression of β-lactamase (AmpC) and OXA-51-like β-lactamase, mutation in the gyrA and parC genes, chromosomally encoded efflux systems, alterations of the drug target, decreased expression of the outer membrane proteins, enzymatic modification of antibiotics, target gene mutation, and horizontal acquisition of genetic elements may be responsible for increased antimicrobial resistance in Acinetobacter species (3-7). Chromosome, transposons, and plasmids encode for efflux pump transporters and up- or down-regulated in regulatory genes can change the expression of these pumps (8). Acinetobacter baumannii has very low susceptibility to several unrelated drug classes, including penicillins, cephalosporins, carbapenems, fluoroquinolones, aminoglycosides, trimethoprim, tetracyclines, and chloramphenicol (1, 9-13). Efflux pumps of the resistance-nodulation-division superfamily (RND) like MexB, AcrB and AdeABC, AdeDE, AdeIJK, and AdeFGH, are associated with high resistance to antimicrobial agents in Escherichia coli, Pseudomonas aeruginosa, and A. baumannii (14). Mutations in the targets of these drugs, topoisomerase IV and DNA gyrase, primarily are responsible for resistance to fluoroquinolones. Active efflux AdeABC, AdeIJK, and AdeFGH are a secondary route to fluoroquinolone resistance (15, 16).
Classification of efflux pumps has resulted in five distinct groups: Multidrug and toxic compound extrusion (MATE) family; the major facilitator superfamily (MFS); resistance-nodulation-division (RND) superfamily; adenosine triphosphate (ATP)-binding cassette (ABC) superfamily; and small multidrug resistance (SMR) family (14, 17-20). A transporter (efflux) protein, a periplasmic accessory protein, and an outer membrane channel protein are the three components of RND (12, 17).
Almost 90% of clinical isolates have AdeFGH, and show multidrug resistance when overexpressed (21). This contributes to high-level resistance to sulfonamides, trimethoprim, tigecycline, chloramphenicol, tetracyclines, sulfamethoxazole, fluoroquinolones, and clindamycin (14, 21, 22). The present study was performed to investigate ciprofloxacin resistance with AdeG in A. baumannii strains collected from two hospitals.
2. Methods
2.1. Bacterial Strains and Growth Conditions
Isolates were obtained from Shahid Motahari and Milad Hospitals of Tehran, Iran, from July 2016 to March 2017. MacConkey agar was selected for culture of the samples and their recognition was examined by both biochemical methods, such as oxidase, triple sugar iron (TSI), SIM and oxidation-fermentation (OF), growth on cetrimide agar, growth at 420C, decarboxylation of lysine and arginine dihydrolase test. Molecular assay by specific primers for presence of blaOXA-51 gene was investigated. Primer and PCR condition were described previously (23).
2.2. Antimicrobial Susceptibility Test
Antibiotic susceptibility testing was prepared by disc diffusion agar on Mueller-Hinton for routine antibiotics and the interpretation of the results was done according to the pattern of the Clinical and Laboratory Standards Institute protocol (CLSI) guide line (24) against: amikacin (30 µg), cefepime (30 µg), ceftazidime (30 µg), cefotaxime (30 µg), ciprofloxacin (5 µg), gentamicin (10 µg), imipenem (10 µg), meropenem (10 µg), minocycline (30 µg), trimethoprim-sulfamethoxazole (25 µg), piperacillin-tazobactam (110 µg), and colistin.
2.3. Efflux Pumps Gene Detection
Genomic DNA Purification Kit (Thermo Company- USA, Cat. No. K0512) was applied for extraction of bacterial DNA. The DNA template, Taq DNA Polymerase Master Mix Red-MgCl2 (Ampliqon- Denmark, Cat. No. A180301) and forward/reverse primers were mixed for the PCR reaction. Conditions of PCR reaction for detection of adeG gene are shown in Table 2. Electrophoresis system at 100 V for 60 minutes composed of 1% agarose gel in 1X TBE and was applied and stained with red safe. Amplified DNA product was visualized under UV light through the Gel Doc instrument.
| Primer | Sequence (5’ - 3’) | Reference |
|---|---|---|
| adeG- F | CTCCGTCCATTCCATAAACC | This study |
| adeG- R | AGATGGCAGACAGTGCAAAC |
Primer for adeG Gene Excretions
| Gene | Initial Denaturation | Denaturation | Annealing | Extension | Final Extension | No. Cycles |
|---|---|---|---|---|---|---|
| adeG | 95°C - 5 min | 95°C - 20 s | 60°C - 30 s | 72°C - 30 s | 72°C - 5 min | 30 |
Amplification Condition for Detection of adeG Gene
2.4. Inhibitory Role of Carbonyl Cyanide3-Chlorophenyl Hydrazone
To investigate the role of efflux pump in ciprofloxacin resistance, carbonyl cyanide3-chlorophenylhydrazone (CCCP) (Sigma, C2759) as an efflux pump inhibitor at final concentration of 25 µg/mL was added to micro titer plates, including Mueller-Hinton (M-H) broth, and compared with plates without CCCP. Control in this test was the plate with CCCP but without ciprofloxacin. The contributor of efflux pump in antibiotic resistance was confirmed if the plate with CCCP showed a four-fold decrease in the MIC compared with the plate without CCCP.
2.5. Reverse Transcription (RT)-Polymerase Chain Reaction
RNXTM-PLUS solution (Cinaclon Company, Iran, Cat No. RN7713C) was applied for extraction of total RNA from A. baumannii strains, according to instructions of the manufacturer. The RNase-free DNase I (Cinaclon Company, Iran, Cat No. PR891627) was used for removing additional DNA from RNA. cDNA synthesis was prepared by using 1 µg RNA samples, 1 µL random hexamer primers, and AccuPower RocketScript RT Premix (Bioneer, china, Cat No. K-2101).
2.6. Semi quantitative Real-Time RT-PCR
To quantify the expression rates of the adeG gene, reverse transcription-PCR was examined. Real-time PCR assays were performed using a real-time PCR detection system (Corbett) with the SYBR Green qPCR MasterMix (Yekta Tajhiz Azma, Iran, Cat No: YT2551). The level of gene expression of efflux pump was normalized with the 16S ribosomal RNA gene as a housekeeping gene. Comparing the gene expression in isolates with reference stain (A. baumannii ATCC 19606) could determine the expression of the adeG gene. Amplification was designed including 10 of SYBR Green qPCR MasterMix, 0.5 µL of primers, 8 µL water, and 1 µL cDNA in a 20 µL total volume. The reaction conditions were 95°C for 5 minutes for the first denaturation; 95°C for 20 seconds for denaturation, 60°C for one minute for annealing for 40 cycles, and melt curve at 72 to 95°C.
3. Results
The breakpoint pattern of the 51 isolates of A. baumannii to tested antibiotic with disk diffusion was cefotaxime (100%), piperacillin-tazobactam, cefepime, ciprofloxacin (98%), ceftazidime, imipenem, meropenem, amikacin (96%), gentamicin (90%), minocycline (86%), trimethoprim-sulfamethoxazole (92%), and colistin (0%). The PCR results showed that all of the isolates had the adeG gene.
When resistant isolates were tested in 25 µg/L CCCP concentration, the MICs of ciprofloxacin was decreased by 32 folds or more in seven strains, 16 folds in two strains, eight folds in 10 strains, four folds in 25 strains, and two folds in six strains. Therefore, 44 of the isolates showed a four-fold of more decrease of MICs after addition of CCCP. Thirty-four of 44 overexpressed the AdeG efflux pump. Seven strains had elevated levels (between 1001- to 3000-fold increase) compared to the reference strain, seven isolates had intermediate rates (approximately 501- to 1000-fold), 14 isolates had low (approximately 101- to 500-fold) levels of overexpression, and six strains had very low (approximately 2- to 100-fold) levels of overexpression.
4. Discussion
Acinetobacter baumannii have evolved to a clinically important nosocomial pathogen because of the increasing frequency of pan drug-resistant (PDR), extensively-drug resistant (XDR), and multidrug-resistant (MDR) strains (25, 26). In some studies, maximum resistance was seen against cefotaxime, cefepime, ciprofloxacin, piperacillin-tazobactam, ceftazidime, imipenem and meropenem, which was similar to other studies (27-30).
Efflux pump inhibitors (EPIs) are agents that can increase resistance to common drugs by preventing energy source of efflux pumps and preventing the interactions of various parts (31). Ciprofloxacin could not be expelled from the cell by action of CCCP in MDR isolates and increases its concentration. The contributor of CCCP in quinolone resistance was further illustrated with observing the reduction of the MIC for ciprofloxacin in all MDR isolates after adding CCCP, which is consistent with other results (32). In the isolates of the current study, 88% of isolates displayed response to CCCP and 12% of the isolates displayed negligible response to CCCP, which illustrated the up-regulation of transporting systems and demonstrated that additional resistance pathways compensate the loss of transporting systems activity, therefore, the susceptibility of isolates to ciprofloxacin was still low. The current study also showed that the MIC for 62% was reduced significantly by two to four folds when the EPI was added. It was illustrated that CCCP decreased the MIC by two to four folds in A. baumannii strains (6, 12, 33). In one study, CCCP partially restored susceptibility in tigecycline resistant A. baumannii isolates (31). The differences in the reported values between the present study and those reported previously may be due to differences in antibiotic selections.
It was indicated that in the A. baumannii isolated from humans, the adeF, adeG and adeH drug efflux pumps genes were very prevalent (34). Approximately 90% of the A. baumannii isolates had the adeFGH operon (22), which was similar to the current study.
Resistance to several antimicrobial agents may be partially associated with the adeFGH operon. Resistance to fluoroquinolones and tigecycline probably mediated up-regulation of AdeFGH in A. baumannii (22). The current researchers found that there was a correlation between overexpression of AdeG and increased ciprofloxacin resistance. Fernando et al. found that the prevalence of RNA transcript of RND efflux pump gene among clinical isolates of Acinetobacter species was as follows: adeG, adeJ, and adeB. (9). Emergence and development of multiple antibiotic resistance can be mediated with up-regulation of efflux pumps. It is likely that topoisomerase mutations and efflux phenotype were the result of ciprofloxacin pressure (16). Deng et al. detected that adeG expression was not associated with tigecycline resistance in A. baumannii isolates (31).
Among 50 resistant isolates collected in this study, 77.27% showed increased expression of the adeG. It was shown that 57.14% of 14 MDR clinical isolates of A. baumannii had increases in adeG expression. It was reported that overexpression of adeG was associated with pathogenicity of A. baumannii (7). All of the Acinetobacter isolates overexpressed the adeG (9). In one study, 77.77% of fluoroquinolone A. baumannii strains showed overexpression of adeF (3). It seems that the expression rate of adeF gene compared with the adeA and adeI genes was very lower in all XDR A. baumannii isolates and no isolate overexpressed the adeF gene (34). Rumbo et al. isolated four-hundred and forty-four strains of A. baumannii and found that expression of adeG was not increased (4).
Increases of 357 folds in adeG expression in isolates was observed. Increases of more than 250 folds in adeFGH expression in mutants was observed (22). The control strain had higher level of expression in the adeFGH gene than XDR A. baumannii isolates (34). Yoon et al. showed that 57.14% of MDR clinical isolates of A. baumannii showed four- to 15-fold greater expression of the adeG gene (7). The dissimilarity between the current results and other studies may be because of the dissimilarity of drug regiment in various countries, different figures of the isolates, different antibiotics used for screening, and different detection of genes in efflux pumps used in these studies.
Overexpression of efflux pumps may be associated with increased ciprofloxacin resistance. Therefore, determining the genes that have a role in drug resistance in clinical settings is necessary to inhibit the outbreak of nosocomial infections caused by MDR A. baumannii.
