Gene Cell Tissue

Image Credit:Gene Cell Tissue

Molecular Characterization of Galactosemia: Identification of Six Novel GALT Gene Mutations

Author(s):
Mehrnoosh MoodyMehrnoosh Moody1, Mojgan HosseiniMojgan Hosseini2,*, Abdolkhalegh  DeezagiAbdolkhalegh Deezagi3, Parichehreh  YaghmaeiParichehreh Yaghmaei1, Massoud  HoushmandMassoud Houshmand4
1Department of Biology, Faculty of Science, Science and Research Branch, Islamic Azad University, Tehran, Iran
2Department of Science, Islamshahr Branch, Islamic Azad University, Islamshahr, Tehran, Iran
3Department of Molecular Medicine and Biochemistry, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran
4Medical Genetics Department, National Institute of Genetic Engineering & Biotechnology, Tehran, Iran
*Corresponding Author: Department of Science, Islamshahr Branch, Islamic Azad University, Islamshahr, Tehran, Iran. Email: [email protected]

Gene, Cell and Tissue:Vol. 9, issue 4; e116766
Published online:Apr 27, 2022
Article type:Research Article
Received:Jul 07, 2021
Accepted:Nov 21, 2021
How to Cite:Moody M, Hosseini M, Deezagi A, Yaghmaei P, Houshmand M. Molecular Characterization of Galactosemia: Identification of Six Novel GALT Gene Mutations. Gene Cell Tissue. 2022;9(4):e116766. doi: https://doi.org/10.5812/gct-116766

Abstract

Background:

Classic galactosemia (CG) is an inborn error of galactose metabolism caused by a deficiency of the enzyme galactose-1-phosphate uridyltransferase (GALT). This enzyme causes the conversion of uridine diphosphate- glucose (UDP)-glucose and galactose-1-phosphate (Gal-1-P) to glucose-1-phosphate and UDP-galactose. The absence of this enzyme results in the accumulation of the metabolites galactitol and Gal-1-P. The CG is heterogeneous at clinical and molecular levels.

Objectives:

This study provides some data for the investigation of the introduction of new mutations of the GALT gene that involved the cause of galactosemia in the Iranian population.

Methods:

In this cross-sectional study, 31 newborns diagnosed with galactosemia were investigated for the mutations of the GALT gene in Tehran province, Iran, from March 2014 to December 2019. The polymerase chain reaction sequencing method was used to analyze the GALT gene.

Results:

The sequence results showed 11 pathogenic mutations on the GALT gene, including five mutations in exon 10, two mutations in exon 9, two mutations in exon 5, one mutation in exon 6, and one mutation in exon 7. Moreover, six new mutations of the GALT gene were identified in the Iranian population, namely c.442C>T (R148W), c.881T>A (F294Y), c.997C>T (R333W), c.940A>G (N314D), c.1030C>A (Q344K), and c.1018G>A (E340K). Other mutations identified in this study were c.563A>G (Q188R), c.855G>T (K285N), c.626A>C (Y209S), c.404C>T (S135L), and c.958G>A (A320T). The most common mutations in this study were p.Q188R (51.6%), K285N (9.67%), E340K (9.67%), and R148W (6.45%).

Conclusions:

This study identified 11 different pathogenic mutations of the GALT gene in the Iranian population with galactosemia. The identification of the mutations involved in the development of CG in the Iranian population can play an important role in early diagnosis and intervention. The GALT gene mutations identified in this study can be used as screening markers to identify Iranian children with CG.

1. Background

Galactosemia is one of the metabolic disorders discovered in newborn screening (1). In other words, galactosemia is an inherited disorder of galactose metabolism due to deficiency in one of the three enzymes involved in the Leloir pathway (2). Galactose-1-phosphate uridyltransferase (GALT), galactokinase, and uridine diphosphate glucose (UDP)-galactose-4-epimerase are members of the Leloir pathway of galactose metabolism (3). The deficiency of any of the three enzymes causes galactose accumulation in plasma which causes galactosemia.
Classic galactosemia (CG) is caused by mutations in the GALT gene. In CG, The GALT enzyme, which is responsible for conversion of galactose-1-phosphate (Gal-1-P) and UDP-glucose into glucose-1-phosphate and UDP-galactose, loses its activity.
The GALT deficiency leads to the accumulation of Gal-1-P in various organs leading to the clinical presentations. The CG is an autosomal recessive disturbance of galactose metabolism (4, 5). The treatment of CG is diet limitations of lactose-containing foods (6-8). The CG occurs with a frequency of approximately 1.2 in 10,000 to 1 in 60,000 live births (9). The incidence rate of CG in southern of Iran is 1 in 28,000 live births (10). The GALT gene is located on chromosome 9p13 and contains 11 exons (11). The CG is heterogeneous at clinical and molecular levels; accordingly, 336 different mutations have been identified in recent years (12, 13).
Several common mutations are detected in the GALT gene. The most prevalent observed is the Q188R mutation, which has been reported to account for 54 - 70% of CG (13-15). The Q188R, L195P, and K285N mutations are common (16, 17) in Caucasians and whites; however, the S135L mutation in African populations has been reported as the common mutation (18-20). The N314D variant is a common change in Duarte galactosemia (21). The identification of mutations involved in the development of CG in theeach population can play an essential role in early diagnosis and intervention (22, 23).

2. Objectives

This study aimed to identify the profile of GALT gene mutations in Iranian patients with galactosemia. Furthermore, this study provides some data for the investigation of the introduction of new mutations of the GALT gene that involved the cause of galactosemia in the Iranian population.

3. Methods

This cross-sectional study was carried out on the newborns of Tehran province, Iran, whose samples were referred to the newborn laboratories of clinics and hospitals under the supervision of Tehran University of Medical Sciences, Iran, from March 2014 to December 2019. In this study, 31 patients diagnosed with galactosemia were investigated for the mutations of the GALT gene. The demographic and clinical data, such as age at diagnosis, gender, diarrhea, liver failure, hepatomegaly, jaundice, vomiting, cataracts, hemolytic anemia, sepsis status, and GALT activity (μmol/h per gHb), were collected using a questionnaire by asking the children’s parents (Table 1). The GALT enzyme activity in red blood cells was assessed by the Beutler test. The normal range was defined as 37 - 66 μmol/h per gHb.
Table 1.Demographic and Clinical Data of Patients with Galactosemia
PNGenderAge at Diagnosis (m)DiarrheaLiver FailureHepatomegalyJaundiceVomitingCataractsHemolytic AnemiaSepsisGALT Activity (IU)*
1F1++++++--13.0
2F2+-++----12.5
3MNS---+----9.5
4F2+++++---29.0
5FNS++++++++16.0
6M3++++----Undetectable
7F2--------13.2
8F3++++----17.1
9M2+----+--7.0
10FNS+++++-+-19.5
11MNS+-------6.2
12F5+++++---Undetectable
13F3++++--+-Undetectable
14F3+-------1.0
15M4--------12.0
16MNS++++++-+9.4
17F4++++----4.7
18MNS++-+----6.3
19F2-+------14.0
20M3++++---+11.0
21M2+-------Undetectable
22FNS+-------1.7
23F2++++++++Undetectable
24M3+-------Undetectable
25F2+-----+-23.3
26M2++++++--7.0
27F3++++---+9.7
28F2--------14.0
29M3+++++---2.3
30F4++++-+++Undetectable
31MNS++++----5.1

Abbreviations: PN, patient number; F, Female; M, Male; NS, newborn screening; m, months; y, years; IU, international unit for enzyme’s catalytic activity.

For the investigation of the variants of the GALT gene in patients with galactosemia, all patients were subjected to exons sequencing of the GALT gene; accordingly, the blood samples were collected from each patient in tube-containing ethylenediaminetetraacetic acid. Genomic deoxyribonucleic acid (DNA) was extracted from peripheral blood white cells via a genomic DNA extraction kit (Add Bio Inc., Korea) following the manufacturer’s procedure. Eight pairs of primers were designed for sequencing the GALT gene, covering all 11 exons of the gene (Table 2). The polymerase chain reaction (PCR) products were sequenced with the Sanger sequencing method in an automatic sequencing system ABI 7500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). The results were investigated using FinchTV software (version: 1.4.0; Geospiza, Seattle, WA, USA). The results of sequencing were compared to the reference sequence in the GenBank database. Finally, the type and frequency of GALT gene mutations were evaluated in Iranian patients with galactosemia.
Table 2.Primer Sequence
Primer NumberExon NumberSequence 5' - 3'PCR Product
1E1 and E2F: 5'- AAAGTGAAAGGTGAGGCACG -3'750 bp
R: 5'- TGACCCAGAAGGAGGTTCAC -3'
2E3 and E4F: 5'- GCCTGTCCAGTCTTTGAAGC -3'350 bp
R: 5'- GGTTTGAAAGTTGTAAGAGGGG -3'
3E5F: 5'- CACAGCCAAGCCCTACCTCTC -3'190 bp
R: 5'- ACCTCACAAACCTGCACCCAA -3'
4E6F: 5'- CTTTTGGCTAACAGAGCTCCG -3'200 bp
R: 5'- TTCCCATGTCCACAGTGCTGG -3'
5E7 and E8F: 5'- ACCTGCCTGTTCTTCTCTGC -3'700 bp
R: 5'- TACTGGGAGCAACCTCCATC -3'
6E9F: 5'- GCTGAGAGTCAGGCTCTGATTCC -3'155 bp
R: 5'- CCAGAAATGGTGTTGGGGCT -3'
7E10F: 5'- GGGTTTGGGAGTAGGTGCT -3'320 bp
R: 5'- GGGCAACAGAAGTATCAGGT -3'
8E11F: 5'- GAAGTCCATGCCACCATTCT -3'230 bp
R: 5'- TTCAAGGCCCTTTCTGCTTA -3'

Abbreviations: PCR, polymerase chain reaction.

4. Results

The average age of diagnosis in this study was 2 months, and 58% of patients were female. However, 42% of patients were male. The PCR sequencing analysis identified 11 different pathogenic mutations on the GALT gene in Iranian patients, including five mutations in exon 10, two mutations in exon 9, two mutations in exon 5, one mutation in exon 6, and one mutation in exon 7. Nevertheless, no mutations were detected in exons 1, 2, 3, 4, and 8. All detected mutations were homozygous and missense types. According to Figure 1, this study identified six new mutations of the GALT gene in the Iranian population, namely c.442C>T (R148W), c.881T>A (F294Y), c.997C>T (R333W), c.940A>G (N314D), c.1030C>A (Q344K), and c.1018G>A (E340K). Other mutations (Figure 2) identified in this study were c.855G>T (K285N), c.563A>G (Q188R), c.404C>T (S135L), c.626A>C (Y209S), and c.958G>A (A320T). The most common mutations in the current study were p.Q188R (51.6%), K285N (9.67%), E340K (9.67%), and R148W (6.45%). Table 3 shows a summary of GALT gene mutations. The patients who carried mutations in the GALT gene showed reduced GALT enzyme activity, compared to the normal range (Tables 1 and 3).
Electropherograms of new <i>GALT</i> mutations identified in Iranian population
Figure 1.

Electropherograms of new GALT mutations identified in Iranian population

Table 3.GALT Mutations in Iranian Patients with Galactosemia
PN Nucleotide ChangeMutation TypeAmino Acid ChangeRegionGALT GenotypeFrequency (%)Status of Mutation Report in Iranian Population
1 and 2c.442C>TMissenseR148W5R148W/ R148W6.45NM
3c.881T>AMissenseF294Y9F294Y/ F294Y3.22NM
4, 5, and 6c.855G>TMissenseK285N9K285N/ K285N9.67PR (26)
7c.997C>TMissenseR333W10R333W/ R333W3.22NM
8c.940A>GMissenseN314D10N314D/ N314D3.22NM
9c.1030C>AMissenseQ344K10Q344K/ Q344K3.22NM
10,11, and 12c.1018G>AMissenseE340K10E340K/ E340K9.67NM
13-28c.563A >GMissenseQ188R6Q188R/ Q188R51.6PR (26)
29c.404C>TMissenseS135L5S135L/ S135L3.22PR (26)
30c.626 A>CMissenseY209S7Y209S/ Y209S3.22PR (26)
31c.958 G>AMissenseA320T10A320T/ A320T3.22PR (26)

Abbreviations: PN, patient number; NM, new mutation; PR, previously.

Electropherograms of other <i>GALT</i> mutations identified in Iranian population
Figure 2.

Electropherograms of other GALT mutations identified in Iranian population

5. Discussion

Galactosemia is one of the metabolic disorders resulting from the deficiency of GALT activity (1, 3). This study identified 11 different pathogenic mutations of the GALT gene in Iranian patients. The R148W, F294Y, R333W, N314D, Q344K, and E340K mutations of the GALT gene were identified as new mutations in the Iranian population; no report of these mutations has been presented in previous studies. The other five K285N, Q188R, S135L, Y209S, and A320T mutations identified in this study were previously reported by Mirzajani et al. (24, 25) in the Iranian population.
The results of the current study showed that Q188R mutation had the highest frequency in the population of Iranian patients (51.6%). After the Q188R mutation, the most common mutations observed in this study were K285N and E340K. The aforementioned results are similar to the results Mirzajani et al. reported in 2006 among Iranian patients (25). The aforementioned results are also similar to the results of other studies. Seyrantepe et al. studied the genetic variations of GALT in patients with galactosemia in the Turkish population, and the results also showed that the most common mutations were Q188R and K285N (26).
In another study, Zekanowski et al. evaluated mutations in the GALT gene in 40 patients with galactosemia in Poland. The results showed that the two Q188R (51%) and K285N (33%) mutations were the most common mutations detected in the aforementioned population (27). Crespo et al. examined galactosemia-related mutations in the GALT gene in the patient population in Argentina and reported that the most common mutations were Q188R and K285N (28). In addition, a comprehensive study published by Tyfield et al. in 1999 showed that the most common GALT gene mutation in patients with galactosemia is Q188R, which is the most common mutation in numerous populations (17). Q188R is generally associated with a severe biochemical phenotype. In vitro expression analysis has confirmed that the mutation results in a substantial, if not complete, loss in GALT activity.
Another mutation observed in this study was c.442C>T, which converts the amino acid arginine to tryptophan. This mutation was never reported in Iranian patients and was classified as a new mutation in this study. In similar studies, Reichardt et al. reported this mutation in the United States, which results in the formation of an unstable polypeptide and an inefficient enzyme (29). The identification of R148W, F294Y, R333W, N314D, and Q344K mutations in Iranian patients was interesting since it has been previously reported that this mutation is very common among European and South American populations (11, 26, 28, 30). S135L mutation was identified in the current study and the study conducted by Mirzajani et al. (25) in the Iranian population. This mutation is also encountered in patients of African origin (4, 19, 20). Lai et al. reported that S135L mutation in the GALT gene is a prevalent cause of galactosemia among black patients, and GALT activity varies in different tissues of patients homozygous for S135L (18).
A320T and Y209S mutations were also detected with similar frequency (3.22%), which are likely to be family-specific. The aforementioned mutations were previously reported in the Iranian and European populations (25, 31). In the current study, the patients who carried mutations in the GALT gene showed reduced GALT enzyme activity, compared to the normal range; this finding is consistent with the results of a study conducted by Garcia et al. (6) related to GALT enzyme activity. Routine screening tests for galactosemia help diagnose the disease quickly, manage symptoms after a positive test, carry out a careful clinical assessment quickly, and perform genotyping to determine whether the patient will be kept on a galactose restriction diet.
One of the limitations of this study is the small number of the studied samples, which suggests that this test should be performed on a larger population. In addition, as previously mentioned in the background, there are other genes in the path of galactose metabolism that cause different types of galactosemia; therefore, it is recommended to check the sequence of these genes in patients.

5.1. Conclusion

Classic Galactosemia is an inherited metabolic disease with life-threatening symptoms in newborn. Nevertheless, early diagnosis can be managed the symptoms and mortality. The disease caused by a severe deficiency of the enzyme galactose-1-phosphate uridylyltransferase. Mutations in this gene can cause a defect in this enzyme. Identification of these mutations can play an important role in early diagnosis and disease management. It is necessary to perform galactosemia screening despite difficulties and complexities. This study identified 11 different pathogenic mutations on the GALT gene in the Iranian population with galactosemia. The identification of the mutations involved in the development of CG in the Iranian population can play an essential role in early diagnosis and intervention. The GALT gene mutations identified in this study can be used as screening markers to identify Iranian children with CG.

Footnotes

  • Authors' Contribution: Study concept and design, Mojgan Hosseini, Mehrnoosh Moody, and Massoud Houshm; Analysis and interpretation of data, Mojgan Hosseini and Mehrnoosh Moody; Drafting of the manuscript, Mehrnoosh Moody; Critical revision of the manuscript for important intellectual content, Abdolkhalegh Deezagi, Parichehreh Yaghmaei, and Mojgan Hosseini; Statistical analysis, Mojgan Hosseini and Mehrnoosh moody.

  • Conflict of Interests: There is no conflict of interest in the submission of this manuscript, and the manuscript was approved by the authors for publication.

  • Data Reproducibility: It was not declared by the authors.

  • Ethical Approval: IR.NIGEB.EC.1398.12.3.F

  • Funding/Support: This study did not receive any funding or grants.

References

  • 1.
    Pasquali M, Yu C, Coffee B. Laboratory diagnosis of galactosemia: a technical standard and guideline of the American College of Medical Genetics and Genomics (ACMG). Genet Med. 2018;20(1):3-11. [PubMed ID: 29261178]. https://doi.org/10.1038/gim.2017.172.
  • 2.
    Ficicioglu C, Thomas N, Yager C, Gallagher PR, Hussa C, Mattie A, et al. Duarte (DG) galactosemia: a pilot study of biochemical and neurodevelopmental assessment in children detected by newborn screening. Mol Genet Metab. 2008;95(4):206-12. [PubMed ID: 18976948]. https://doi.org/10.1016/j.ymgme.2008.09.005.
  • 3.
    Kotb MA, Mansour L, William Shaker Basanti C, El Garf W, Ali GIZ, Mostafa El Sorogy ST, et al. Pilot study of classic galactosemia: Neurodevelopmental impact and other complications urge neonatal screening in Egypt. J Adv Res. 2018;12:39-45. [PubMed ID: 30038819]. [PubMed Central ID: PMC6054589]. https://doi.org/10.1016/j.jare.2018.02.001.
  • 4.
    Kotb MA, Mansour L, Shamma RA. Screening for galactosemia: is there a place for it? Int J Gen Med. 2019;12:193-205. [PubMed ID: 31213878]. [PubMed Central ID: PMC6537461]. https://doi.org/10.2147/IJGM.S180706.
  • 5.
    Holden HM, Rayment I, Thoden JB. Structure and function of enzymes of the Leloir pathway for galactose metabolism. J Biol Chem. 2003;278(45):43885-8. [PubMed ID: 12923184]. https://doi.org/10.1074/jbc.R300025200.
  • 6.
    Garcia DF, Camelo JS, Molfetta GA, Turcato M, Souza CF, Porta G, et al. Clinical profile and molecular characterization of Galactosemia in Brazil: identification of seven novel mutations. BMC Med Genet. 2016;17(1):39. [PubMed ID: 27176039]. [PubMed Central ID: PMC4866286]. https://doi.org/10.1186/s12881-016-0300-8.
  • 7.
    Hatam N, Askarian M, Shirvani S, Siavashi E. Neonatal Screening: Cost-utility Analysis for Galactosemia. Iran J Public Health. 2017;46(1):112-9. [PubMed ID: 28451536]. [PubMed Central ID: PMC5401919].
  • 8.
    Coss KP, Doran PP, Owoeye C, Codd MB, Hamid N, Mayne PD, et al. Classical Galactosaemia in Ireland: incidence, complications and outcomes of treatment. J Inherit Metab Dis. 2013;36(1):21-7. [PubMed ID: 22870861]. https://doi.org/10.1007/s10545-012-9507-9.
  • 9.
    Pyhtila BM, Shaw KA, Neumann SE, Fridovich-Keil JL. Newborn screening for galactosemia in the United States: looking back, looking around, and looking ahead. JIMD Rep. 2015;15:79-93. [PubMed ID: 24718839]. [PubMed Central ID: PMC4413015]. https://doi.org/10.1007/8904_2014_302.
  • 10.
    Mirzaee A, Pishva N, Karamizadeh Z, Purarian S, Hemati F, Razavi M, et al. The Incidence and Clinical Presentations of Galactosemia in Fars province, South West of Iran. Galen Med J. 2014;3(1):39-45. https://doi.org/10.31661/gmj.v3i1.99.
  • 11.
    Bosch AM, Ijlst L, Oostheim W, Mulders J, Bakker HD, Wijburg FA, et al. Identification of novel mutations in classical galactosemia. Hum Mutat. 2005;25(5):502. [PubMed ID: 15841485]. https://doi.org/10.1002/humu.9330.
  • 12.
    Calderon FR, Phansalkar AR, Crockett DK, Miller M, Mao R. Mutation database for the galactose-1-phosphate uridyltransferase (GALT) gene. Hum Mutat. 2007;28(10):939-43. [PubMed ID: 17486650]. https://doi.org/10.1002/humu.20544.
  • 13.
    Dobrowolski SF, Banas RA, Suzow JG, Berkley M, Naylor EW. Analysis of common mutations in the galactose-1-phosphate uridyl transferase gene: new assays to increase the sensitivity and specificity of newborn screening for galactosemia. J Mol Diagn. 2003;5(1):42-7. [PubMed ID: 12552079]. [PubMed Central ID: PMC1907369]. https://doi.org/10.1016/S1525-1578(10)60450-3.
  • 14.
    Ashino J, Okano Y, Suyama I, Yamazaki T, Yoshino M, Furuyama J, et al. Molecular characterization of galactosemia (type 1) mutations in Japanese. Hum Mutat. 1995;6(1):36-43. [PubMed ID: 7550229]. https://doi.org/10.1002/humu.1380060108.
  • 15.
    Waisbren SE, Potter NL, Gordon CM, Green RC, Greenstein P, Gubbels CS, et al. The adult galactosemic phenotype. J Inherit Metab Dis. 2012;35(2):279-86. [PubMed ID: 21779791]. [PubMed Central ID: PMC3641771]. https://doi.org/10.1007/s10545-011-9372-y.
  • 16.
    Lukac-Bajalo J, Kuzelicki NK, Zitnik IP, Mencej S, Battelino T. Higher frequency of the galactose-1-phosphate uridyl transferase gene K285N mutation in the Slovenian population. Clin Biochem. 2007;40(5-6):414-5. [PubMed ID: 17303100]. https://doi.org/10.1016/j.clinbiochem.2006.11.004.
  • 17.
    Tyfield L, Reichardt J, Fridovich-Keil J, Croke DT, Elsas LJ, Strobl W, et al. Classical galactosemia and mutations at the galactose-1-phosphate uridyl transferase (GALT) gene. Hum Mutat. 1999;13(6):417-30. [PubMed ID: 10408771]. https://doi.org/10.1002/(SICI)1098-1004(1999)13:6<417::AID-HUMU1>3.0.CO;2-0.
  • 18.
    Lai K, Langley SD, Singh RH, Dembure PP, Hjelm LN, Elsas L2. A prevalent mutation for galactosemia among black Americans. J Pediatr. 1996;128(1):89-95. [PubMed ID: 8551426]. https://doi.org/10.1016/s0022-3476(96)70432-8.
  • 19.
    Henderson H, Leisegang F, Brown R, Eley B. The clinical and molecular spectrum of galactosemia in patients from the Cape Town region of South Africa. BMC Pediatr. 2002;2:7. [PubMed ID: 12350230]. [PubMed Central ID: PMC126267]. https://doi.org/10.1186/1471-2431-2-7.
  • 20.
    Yuzyuk T, Wilson AR, Mao R, Pasquali M. Galactose-1-Phosphate Uridyltransferase Activities in Different Genotypes: A Retrospective Analysis of 927 Samples. J Appl Lab Med. 2018;3(2):222-30. [PubMed ID: 33636947]. https://doi.org/10.1373/jalm.2017.025536.
  • 21.
    Coffee B, Hjelm LN, DeLorenzo A, Courtney EM, Yu C, Muralidharan K. Characterization of an unusual deletion of the galactose-1-phosphate uridyl transferase (GALT) gene. Genet Med. 2006;8(10):635-40. [PubMed ID: 17079880]. https://doi.org/10.1097/01.gim.0000237720.78475.fb.
  • 22.
    Teramoto Y, Tanaka N, Lee SH, Endo T. Pretreatment of eucalyptus wood chips for enzymatic saccharification using combined sulfuric acid-free ethanol cooking and ball milling. Biotechnol Bioeng. 2008;99(1):75-85. [PubMed ID: 17546689]. https://doi.org/10.1002/bit.21522.
  • 23.
    Therrell BL, Padilla CD, Loeber JG, Kneisser I, Saadallah A, Borrajo GJ, et al. Current status of newborn screening worldwide: 2015. Semin Perinatol. 2015;39(3):171-87. [PubMed ID: 25979780]. https://doi.org/10.1053/j.semperi.2015.03.002.
  • 24.
    Coelho AI, Berry GT, Rubio-Gozalbo ME. Galactose metabolism and health. Curr Opin Clin Nutr Metab Care. 2015;18(4):422-7. [PubMed ID: 26001656]. https://doi.org/10.1097/MCO.0000000000000189.
  • 25.
    Mirzajani F, Mirfakhraie R, Nabati F, Tabatabaei NN, Talachian E, Houshmand M. The first study of galactose-1-phosphate uridyl transferase mutations in Iranian galactosemia patients. Clin Biochem. 2006;39(7):697-9. [PubMed ID: 16765930]. https://doi.org/10.1016/j.clinbiochem.2006.04.020.
  • 26.
    Seyrantepe V, Ozguc M, Coskun T, Ozalp I, Reichardt JK. Identification of mutations in the galactose-1-phosphate uridyltransferase (GALT) gene in 16 Turkish patients with galactosemia, including a novel mutation of F294Y. Mutation in brief no. 235. Online. Hum Mutat. 1999;13(4):339. [PubMed ID: 10220154]. https://doi.org/10.1002/(SICI)1098-1004(1999)13:4<339::AID-HUMU18>3.0.CO;2-S.
  • 27.
    Zekanowski C, Radomyska B, Bal J. Molecular characterization of Polish patients with classical galactosaemia. J Inherit Metab Dis. 1999;22(5):679-82. [PubMed ID: 10399107]. https://doi.org/10.1023/a:1005511020607.
  • 28.
    Crespo C, Eiroa H, Otegui MI, Bonetto MC, Chertkoff L, Gravina LP. Molecular analysis of GALT gene in Argentinian population: Correlation with enzyme activity and characterization of a novel Duarte-like allele. Mol Genet Metab Rep. 2020;10(25):100695. [PubMed ID: 33335841]. [PubMed Central ID: PMC7733017]. https://doi.org/10.1016/j.ymgmr.2020.100695.
  • 29.
    Reichardt JK, Belmont JW, Levy HL, Woo SL. Characterization of two missense mutations in human galactose-1-phosphate uridyltransferase: different molecular mechanisms for galactosemia. Genomics. 1992;12(3):596-600. [PubMed ID: 1373122]. https://doi.org/10.1016/0888-7543(92)90453-y.
  • 30.
    Kozak L, Francova H, Fajkusova L, Pijackova A, Macku J, Stastna S, et al. Mutation analysis of the GALT gene in Czech and Slovak galactosemia populations: identification of six novel mutations, including a stop codon mutation (X380R). Hum Mutat. 2000;15(2):206. [PubMed ID: 10649501]. https://doi.org/10.1002/(SICI)1098-1004(200002)15:2<206::AID-HUMU13>3.0.CO;2-O.
  • 31.
    Maceratesi P, Daude N, Dallapiccola B, Novelli G, Allen R, Okano Y, et al. Human UDP-galactose 4' epimerase (GALE) gene and identification of five missense mutations in patients with epimerase-deficiency galactosemia. Mol Genet Metab. 1998;63(1):26-30. [PubMed ID: 9538513]. https://doi.org/10.1006/mgme.1997.2645.

Copyright

Copyright © 2022, Gene, Cell and Tissue. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

8
Aug
2021
Zahedan J Res Med Sci

Mutational Analysis of Mucopolysaccharidosis in Iranian Patients

Seyed Hoseinali Saberi,
Shahla Farshidi,
Behnam Kamalidehghan,
Roshanak Jazayeri,
Massoud Houshmand

Saberi SH, Farshidi S, Kamalidehghan B, Jazayeri R, Houshmand M. Mutational Analysis of Mucopolysaccharidosis in Iranian Patients. Zahedan J Res Med Sci. 2021;23(3):e104794. doi: https://doi.org/10.5812/zjrms.104794

1
Nov
2021
Iran J Pediatr

A Novel Missense Mutation in the EDAR Gene and One Missense Mutation in EDA Gene in the Study of HED Patients in Iran

Atefe Papi,
Saeedreza Khatami,
Hamid Galehdari,
Gholamreza Shariati

Papi A, Khatami S, Galehdari H, Shariati G. A Novel Missense Mutation in the EDAR Gene and One Missense Mutation in EDA Gene in the Study of HED Patients in Iran. Inn J Pediatr. 2021;31(5):e103570. doi: https://doi.org/10.5812/ijp.103570

28
Sep
2015

An overview on thalassemia: Genetics of beta thalassemia in Iran

Reza Shiri,
Nejat Mahdieh

Shiri R, Mahdieh N. An overview on thalassemia: Genetics of beta thalassemia in Iran. koomesh. 2015;17(1):e150761. doi:

30
Jun
2010

Wide Spectrum of Mutations in the Beta-Globin Gene Causing Beta-Thalassemia Major in Southwest Iran

Hamid Galehdari,
Mohammad Pedram,
Bahaoddin Salehi,
Behnaz Andashti

Galehdari H, Pedram M, Salehi B, Andashti B. Wide Spectrum of Mutations in the Beta-Globin Gene Causing Beta-Thalassemia Major in Southwest Iran. J Compr Ped. 2010;2(1):. doi:

15
Dec
2025
Zahedan J Res Med Sci

 Identification of Two Siblings with PMM2-Congenital Disorder of Glycosylation Using Exome Sequencing in South East of Iran: Clinical and Genetic Findings

Atefeh Mir,
Ali Khajeh,
Yongjun Song,
Hane Lee,
Mohammad Amin Tabatabaifar

Mir A, Khajeh A, Song Y, Lee H, Tabatabaifar MA.  Identification of Two Siblings with PMM2-Congenital Disorder of Glycosylation Using Exome Sequencing in South East of Iran: Clinical and Genetic Findings. Zahedan J Res Med Sci. 2026;28(2):e167519. doi: https://doi.org/10.5812/zjrms-167519

Download PDF873.40 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles