Logo
Gene Cell Tissue

Image Credit:Gene Cell Tissue

Cell Toxicity Effect of the Extract of Medicinal Plants against Human Breast (MCF7 and KBR3) Cancer Cell Lines

Author(s):
Elham MojodiElham Mojodi1, Mohammad Reza DoostabadiMohammad Reza Doostabadi2, Seyed Kazem SabbaghSeyed Kazem SabbaghSeyed Kazem Sabbagh ORCID3,*, Monireh MohammadpanahMonireh Mohammadpanah1, Bibi Fatemeh HaghiralsadatBibi Fatemeh Haghiralsadat4, Behnam MalekiBehnam Maleki5
1Department of Biology, Faculty of Science, Yazd University, Yazd, Iran
2Department of Anatomy, Faculty of Medicine, Birjand University of Medical Sciences, Birjand, Iran
3Department of Biology, Campus of Science, Yazd University, Yazd, Iran
4Department of Advanced Medical Sciences and Technologies, School of Paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran
5Research and Clinical Center for Infertility, Yazd Reproductive Sciences Institute, Shahid Sadoughi University of Medical Sciences, Yazd, Iran

Gene, Cell and Tissue:Vol. 10, issue 1; e119837
Published online:Aug 17, 2022
Article type:Research Article
Received:Nov 23, 2021
Accepted:May 15, 2022
How to Cite:Mojodi E, Doostabadi M R, Sabbagh S K, Mohammadpanah M, Haghiralsadat B F, et al. Cell Toxicity Effect of the Extract of Medicinal Plants against Human Breast (MCF7 and KBR3) Cancer Cell Lines.Gene Cell Tissue.2022;10(1):e119837.https://doi.org/10.5812/gct-119837.

Abstract

Background:

Breast cancer is the most lethal cancer causing death among women, especially in developed countries. Using medicinal plants and natural resources to control and prevent different types of cancer in human has been the focus of attention.

Objectives:

The current study aimed to investigate the possible effects of hydroalcoholic extracts from some plant species such as Lavandula angustifolia, Ephedra major, and Scenedesmus obliquus on cell viability of two breast cancer MCF7 and SK-BR3 cell lines.

Methods:

MTT assay and gene expression analysis were performed adopting qRT-PCR method. Target cells were treated with different concentrations of plant extracts in a 24-hour period. Data were analyzed using Graphpad Prism version 8.3.0. Differences among means were determined using Student’s t-test or one-way ANOVA with Dunnett’s Multiple Comparison Test.

Results:

An indirect relationship was detected between extract concentration and cell viability. The result of the cell viability (IC-50) showed that the extract of S. obliquus had the maximum effect on both tested cells at concentrations above 100 µg/mL. A high cell death rate was observed in MCF-7 cell line compared to SK-BR3 cell line 24 h after the treatment. According to results from gene expression analysis, Caspase 3 gene increased in all treated cells, while the bcl-xl gene expression declined in the tested cells.

Conclusions:

It was concluded that the extracts from three plants had both positive and dose-related effects on MCF-7 and SK-BR3 cell line. However, it was recommended that future complementary studies should be conducted in order to evaluate the cell viability effect of these plants on human cancer.

1. Background

Breast cancer has had an increased incidence in developed countries due to the lifestyle factors associated with, for example, smoking, inadequate exercise, and unhealthy food programs (1). This cancerous disease has been detected in, approximately more than 10% of womankind in the north Americas (2). Presently, cancer treatment is administered using many chemo-therapeutic agents, surgical procedures, and chemotherapy approaches. However, taking chemotherapy drugs produces side effects. Therefore, developing new anti-cancer compounds based on medicinal plants and traditional medicine has attracted considerable interest, particularly due to their proven effectiveness in improving the treatment process (3). It has long been demonstrated that traditional medicinal plants play an important role in the treatment of various cancer diseases, and the application of medicinal plants is now one of the most basic methods to treat cancer (4).

Bioactive compounds, such as Taxol, Vinblastine, Vinflunine, Vinorelbine, Camptothecin, Vincristine, and Vindesine have therapeutically significant effect on the treatment of the various cancer diseases (5). Various medicinal plants belonging to different plant families have been used in nutrition, cosmetics, and medicine for centuries. The genus Lavandula Lamiaceae are annuals, shrubs, and herbaceous plants. The antioxidant, insecticidal, anti-inflammatory, sedative, and spasmodic properties of Lavandula plants have long been recognized (6). Potential anticancer and ant-proliferative activities of the lavender essential oil distilled from Lavandula angustifoli has also been demonstrated (7). Anticancer properties of this species, however, have not received sufficient research attention.

The present study, therefore, aimed to investigate and compare the effects of some plant extract on two MCF7 and KBR3 cell lines by performing cell viability assay and gene expression analysis. Using Ephedra foeminea infusion has been widely reported to treat their ailments by cancerous patients (8).

Using E. foeminea as the primary ingredient in supplementing treatment has been documented in 68% of breast cancer patients. Moreover, E. foeminea has only become one of the most common plants utilized by the Palestinian population recently (i.e., from 0.0% in 2011 to 55.2% in 2014) (4). Analyzing genes expressed in a given cell or tissue could serve as a novel bio-markers, and overexpression of caspase genes has been sufficient to induce apoptosis in mammalian cells (9).

2. Objectives

This study aimed to evaluate the effects of some plant species such as L. angustifolia, E. major, and Scenedesmus obliquus on cell viability of two MCF7 and SK-BR3 cancer cell lines. The gene expression levels of two Bcl-2 and Caspase 3 genes involved in breast cancer were analyzed.

3. Methods

Lavander and ephedra plants investigated in this study were harvested in Yazd province of Iran and then were identified as L. angustifolia and E. major species by expert botanist (Figure 1). Dried leaves and algae mass were powdered using an electric mill and were later immersed in 80% ethanol: distill water 1: 10 (w/v). Solutions were placed on a shaker for one day at room temperature. Then, the mixture was passed through filter paper (Blue Ribbon, Grade 589, and Germany). Vacuum evaporator (Heidolphe, Germany) was used to concentrate the extracts, and lyophilizing was performed to obtain hydrous extract using freeze dryer (10).

The images of three plant species: A, <i>Scenedesmus obliquus</i>; B, <i>Ephedra major</i>; and C, <i>Lavandula angustifolia</i>.
Figure 1.

The images of three plant species: A, Scenedesmus obliquus; B, Ephedra major; and C, Lavandula angustifolia.

3.1. Cell Culture and Cell Viability Assay

MCF-7 and SK-BR-3 cells created by human breast cancer were purchased from the National Cell Bank of Iran (Tehran, Iran). Gibco medium cell culture was used to culture the cells, and then fetal bovine serum (10%) was added to 96-well culture plates at 37°C in a 5%-CO2 incubator (Memert, Germany). Two penicillin and streptomycin antibiotics (Sigma Aldrich, Germany) from Passage 17 were used for performing all experiments under a humidified air atmosphere. MTT reagent was used to carry out the cell viability assay adopting the colorimetric method (11, 12). Cell treatment was performed for 24 hours using the obtained alcoholic extracts (25, 100, 500, 100 μg/μL). The cells were then subjected to MTT solution) and incubated for four hours. The formed purple formazan crystal was dissolved using 100 μL of DMSO (13). Measurement of cell viability was carried out using a plate reader at 570nm wavelength.

3.2. Molecular Manipulation

Treated and untreated cells were harvested by centrifugation, and then the cells were washed three times using PBS solution. Total RNA extraction kit (Parstos Biotechnology, Iran) was employed to perform RNA extraction. The quality and quantity of the extracted RNA were monitored using gel electrophoresis agarose and NanoDrop spectrophotometer, respectively (14). Then, 50 ng of purified RNA was applied for first-strand cDNA production using a superscript First-strand Synthesis system (Amplicon, USA).

3.3. Primers and qRT-PCR

The Primer was designed using Primer III software based on presented sequences in the bioinformatics database. All sequences of target and GAPDH as reference genes are summarized in Table 1. Real-time PCR was accomplished on a Curbet3000 Real-Time PCR System (Qiagene, Germany) employing qPCR Master Mix Green-High Rox. PCR reactions were performed on a final volume of 20 μL containing 4 μL of cDNA, 10 μL of Master Mix (2×), 2 μL of related primers (0.25 μM), and 4 μL of distilled water. The PCR program was adjusted according to the following conditions: initial denaturation step at 94°C for 5 minutes, 40 cycles of 94°C for 15 seconds, 58°C for 30 seconds, and extension at 72°C for 20 seconds.

Table 1.The Characteristics of Primers Used to Study Cell Toxicity Effect of Some Extract from Medicinal Plant on Human Breast (MCF7 and KBR3) Cancer Cell Lines
Gene NameForward Primer Sequence (5'-3')Reverse Primer Sequence (5'-3')Reference
Caspase3AAGCGAATCAATGGACTCTGGCTGTACCAGACCGAGATGTC(15)
Bcl-2CCTCTGACGTCCATCATCTCATCTTCTCGTGCCGTCGCTT(16)
GAPDHGCCACGGCTGCTTCCAGGGCGTACAGGTCTTTGC

The Characteristics of Primers Used to Study Cell Toxicity Effect of Some Extract from Medicinal Plant on Human Breast (MCF7 and KBR3) Cancer Cell Lines

3.4. Statistical Analysis

Statistical analysis of the obtained data was carried out using Graphpad Prism version 8.3.0 (Graphpad Software), and A 2-sided P < .05 was considered statistically significant. Obtained data were analysis adopting one-way ANOVA method, and Pearson correlation coefficient was performed where appropriate. Relative gene expressions analysis was conducted according to the ∆∆Ct method, using the following formula: 2-∆∆Ct (17).

4. Results

4.1. MCF7 Cell Viability Assay

The result of the cell viability (IC-50) showed that the extract of S. obliquus, among the tested plants, had the highest effect on both tested cells. These results also revealed that all plant extracts had significant cytotoxicity (P < 0.05) effect on MCF7 and SK-BR3 cell lines (Figures 2 and 3). The application of both extracts in the concentration of above 500 µg/mL significantly increased the death incidence. After 24 h treatment with plant extracts, MCF-7 cell line showed higher cell death compared to SK-BR3 cell line (Figure 2).

Cell viability of MCF-7 cell line treated with <i>Lavandula angustifolia</i> A, <i>Ephedra major</i>; B, and <i>Scenedesmus obliquus</i>; C, extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P &gt; 0.05; ** P &lt; 0.05, ***P &lt; 0.01)].
Figure 2.

Cell viability of MCF-7 cell line treated with Lavandula angustifolia A, Ephedra major; B, and Scenedesmus obliquus; C, extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P > 0.05; ** P < 0.05, ***P < 0.01)].

As shown in Figures 2 and 3, cell viability gradually decreased with an increase in plant extract concentration. Among plant extract concentrations, the concentration of 1000 µg/mL showed the most significant effect on cell viability. As for MCF7 cell line, the maximum effect of plant extract on SK-BR3 was also recorded at 1000 µg/mL concentrations of all three plant extracts. No significant effect of plant extract on cell viability was observed at the concentration of 25 - 100 µg/mL, while cell viability was decreased approximately to 50% with an increase of 500 µg/mL in plant extract concentration.

Cell viability of SK-BR3 cell line treated with A, <i>Lavandula angustifolia</i>; B, <i>Ephedra major</i>; and C, <i>Scenedesmus obliquus</i> extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P &gt; 0.05, ** P &lt; 0.05, ***P &lt; 0.01)].
Figure 3.

Cell viability of SK-BR3 cell line treated with A, Lavandula angustifolia; B, Ephedra major; and C, Scenedesmus obliquus extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P > 0.05, ** P < 0.05, ***P < 0.01)].

These results showed that an adequate concentration of plant extract was needed in order to decrease cell growing. The results from the MTT assay also demonstrated that the decrease in the viability of both MCF-7 and Sk-BR3 cancer cell lines was dose-dependent. The IC50 value corresponding to each extract are shown in Table 2.

Table 2.The IC50 Values (µg/mL) of Extract Lavandula angustifolia, Ephedra major, and Scenedesmus obliquus When Treated with MCF-7 and SK-BR-3 Cells After 24 h a
VariablesMCF-7 cellsSK-BR-3 cells
Lavandula angustifolia416.5 ± 2.58517.9 ± 2.34
Ephedra major644.9 ± 2.18784.9 ± 2.47
Scenedesmus obliquus402.8 ± 2.29465.5 ± 2.25

The IC50 Values (µg/mL) of Extract Lavandula angustifolia, Ephedra major, and Scenedesmus obliquus When Treated with MCF-7 and SK-BR-3 Cells After 24 h a

4.2. Gene Expression Assay

The expression levels of Caspase 3 gene were statistically different between non-treated and treated SK-BR3 and MCF7 cell lines. Caspase 3 gene expression was uniformly higher in MCF7 compared to SK-BR3. The expression of the Bcl-2 gene in MCF7 cells significantly decreased only in the group treated with the S. obliquus extract. In SK-BR3 cell lines, relative expression of Caspase 3 gene was only significant in the cells treated with S. obliquus extract, and the expression level of Bcl-2 gene gradually decreased in SK-BR3 cells in all three cells treated with extracts. This expression was significant in the groups treated with L. angustifolia and S. obliquus extracts after 24 hours (Figure 4).

Relative expression of two <i>Caspase 3</i> and <i>Bcl-2</i> genes in treatment MCF-7 and SK-BR3 cells lines with <i>Lavandula angustifolia</i>, <i>Ephedra major</i>, and <i>Scenedesmus obliquus</i> extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P &gt; 0.05, ** P &lt; 0.05, ***P &lt; 0.01)].
Figure 4.

Relative expression of two Caspase 3 and Bcl-2 genes in treatment MCF-7 and SK-BR3 cells lines with Lavandula angustifolia, Ephedra major, and Scenedesmus obliquus extracts during 24h [bars represent the mean and standard error of four independent experiments. Control: Untreated sample (*P > 0.05, ** P < 0.05, ***P < 0.01)].

5. Discussion

The application of aqueous extracts from L. angustifolia, S. obliquus, and E. major in dealing with MCF-7 and SK-BR-3 cells showed that some groups significantly declined the cell viability in dose-dependent manner compared to control cells.

Ephedrine alkaloid has shown anti-proliferative potential against lung cancer cell lines (18). Mendelovich et al. have shown that ethanolic extracts from leaves and fruit of E. foeminea species have significant effect on anti-proliferation and pro-apoptotic potential of MDA-MB-231 breast cancer cell line in women (19). The efficacy of the leaves and seeds of ephedra in improving the breast cancer proliferation has been the subject of many ethno-pharmacological studies (20), and the results have confirmed the fact that ephedra consummation is effective in treating the cancer. The application of Lavandula oil as therapeutic and aromatic agent has been also reported in traditional medicine literature (21). This plant genus is used in cosmetic industrial due to its flavor and fragrance properties. Lavender oil mainly consists of terpenoid compounds as mono- and sesquiterpenes (22). Our MTT results revealed that treating SK-BR3 and MCF7 cancer cell lines with L. angustifolia extract, compared to untreated cells, had significant effect on cell death after 24 hours due to a direct relation with extract concentration. According to the results obtained from the examination of cytotoxic effect of L. intermedia on human cancer cell lines, a dose- and time-dependent manners were observed at 1000 μg/mL (P < 0.05); while cell viability was only dose-dependent at lower concentrations of 800, 400, and 200 μg/mL (23), which was in agreement with these results. Investigating the cytotoxic effects of L. angustifolia on cervical carcinoma cell lines demonstrated that this species may have been considered as a potential chemo-preventive agent to prevent or delay cancer development (24). Exploring the effect of Lavander extract on cell viability of MCF-7 and HeLa cell lines showed that the extract had a strong effect on the tested cell lines (25), which was in line with our study results. Scenedesmus obliquus is one of the most common micro-algae genera with easy production, harvesting, and drying process. Therefore, it has become the most popular species in microalgal biotechnology due to its antimicrobial and anticancer activities (26). According to our study findings, green alga S. obliquus was significantly capable of diminishing MCF-7 and Sk-BR3 cell viability after undergoing treatment for 24 h.

The effect of S. obliquus extract on different human cancers such as breast cancer (MCF7), hepatic (HePG2), Colon (HCT116), and human cervical adenocarcinoma (HeLa ) cancer cell lines has been investigated (27, 28) and, as a result, the strong efficacy of this algae species in treating cancer has been confirmed, which may open the way to develop new drugs using it. Relative expressions of both genes were affected differently in the cells treated with three tested extracts compared to non-treated cells; however, the maximum efficacy was observed when S. obliquus extract was applied. Therefore, algae may have been used in cancer treatment and pharmaceutical industry. In our previous study, Ephedra major extract had been shown to influence cell viability and Caspase gene expression in treated MCF7 cell line (12). The activation and high expression of Caspase 3 gene have also been detected to influence the induction of apoptosis process in cancer cell (29, 30). According to our study findings, the relative expression of Caspase 3 gene was increase in almost all extract applications, which was in line with the results from similar studies (31, 32).

Caspase 3 gene plays a key role in both death receptor pathway, initiated by the Caspase 8 gene, and the mitochondrial pathway, involving Caspase 9 (33). Expression of Bcl-2 gene may lead to the survival of cells with damaged DNA and increase the mutations, which, in turn, may promote tumor development (34). Our study results suggested that the expression of the Bcl-2 gene associated with cell proliferation and differentiation in MCF7 cells was significantly decreased only in cell line treated with the green alga S. obliquus. The related expression of the Bcl-2 gene, however, was reduced in SK-BR3 cells treated with three tested extracts.

5.1. Conclusion

It was concluded that all three extracts had the potential to gradually affect cancer cell death in experimental conditions. Therefore, these materials may have been considered as a promising anticancer reagents. The integration of medicinal plants with conventional therapy of breast cancer was found extremely important when undergoing the treatment process. The perception of edible compounds by two cancer cell lines in some plants and algae was assayed, and it was found that the effect of plant and algae extracts greatly altered the viability of MCF7 and KBR3cells. These effects depended on both concentration and time periods profile; however, a cell-line dependent dose and time was also detected. This behavior may have been attributed to the type of cell (immortalized vs. cancerous). It was recommended that further studies should be conducted to confirm the clinical effects of these extracts on breast cancer. It was also suggested that the isolation of all compounds present in plant extracts, as well as the examination of their preventive effects on cancer cell proliferation should be the subjects of further investigations.

Footnotes

References

  • 1.
    Waks AG, Winer EP. Breast Cancer Treatment. Jama. 2019;321(3):316. [PubMed ID: 30667503]. https://doi.org/10.1001/jama.2018.20751.
  • 2.
    Rahmani J, Manzari N, Thompson J, Gudi SK, Chhabra M, Naik G, et al. The effect of metformin on biomarkers associated with breast cancer outcomes: a systematic review, meta-analysis, and dose-response of randomized clinical trials. Clin Transl Oncol. 2020;22(1):37-49. [PubMed ID: 31006835]. https://doi.org/10.1007/s12094-019-02108-9.
  • 3.
    Mohammadpanah M, Mojodi E, Ehsani R. [The Synthesis and Characterization of Liposomal Nano-Carriers Loading Lavandula angustifolia Essential Oil to Affect Breast Cancerous Cell-Lines]. Yafteh. 2020;22(1):84-95. Persian.
  • 4.
    Ali-Shtayeh MS, Jamous RM, Salameh NM, Jamous RM, Hamadeh AM. Complementary and alternative medicine use among cancer patients in Palestine with special reference to safety-related concerns. J Ethnopharmacol. 2016;187:104-22. [PubMed ID: 27125594]. https://doi.org/10.1016/j.jep.2016.04.038.
  • 5.
    Greenwell M, Rahman PK. Medicinal Plants: Their Use in Anticancer Treatment. Int J Pharm Sci Res. 2015;6(10):4103-12. [PubMed ID: 26594645]. [PubMed Central ID: PMC4650206]. https://doi.org/10.13040/ijpsr.0975-8232.6(10).4103-12.
  • 6.
    Newman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J Nat Prod. 2020;83(3):770-803. [PubMed ID: 32162523]. https://doi.org/10.1021/acs.jnatprod.9b01285.
  • 7.
    Gezici S. Promising anticancer activity of lavender (Lavandula angustifolia Mill.) essential oil through induction of both apoptosis and necrosis. Ann Phytomed. 2018;7(2):38-45. https://doi.org/10.21276/ap.2018.7.2.5.
  • 8.
    Ben-Arye E, Mahajna J, Aly R, Ali-Shtayeh MS, Bentur Y, Lev E, et al. Exploring an herbal "wonder cure" for cancer: a multidisciplinary approach. J Cancer Res Clin Oncol. 2016;142(7):1499-508. [PubMed ID: 27155666]. [PubMed Central ID: PMC5513733]. https://doi.org/10.1007/s00432-016-2175-7.
  • 9.
    Boice A, Bouchier-Hayes L. Targeting apoptotic caspases in cancer. Biochim Biophys Acta Mol Cell Res. 2020;1867(6):118688. [PubMed ID: 32087180]. [PubMed Central ID: PMC7155770]. https://doi.org/10.1016/j.bbamcr.2020.118688.
  • 10.
    Zumahi SMA, Arobi N, Taha H, Hossain MK, Kabir H, Matin R, et al. Extraction, optical properties, and aging studies of natural pigments of various flower plants. Heliyon. 2020;6(9). e05104. [PubMed ID: 33024874]. [PubMed Central ID: PMC7527660]. https://doi.org/10.1016/j.heliyon.2020.e05104.
  • 11.
    Baneshi M, Dadfarnia S, Shabani AMH, Sabbagh SK, Haghgoo S, Bardania H. A novel theranostic system of AS1411 aptamer-functionalized albumin nanoparticles loaded on iron oxide and gold nanoparticles for doxorubicin delivery. Int J Pharm. 2019;564:145-52. [PubMed ID: 30978484]. https://doi.org/10.1016/j.ijpharm.2019.04.025.
  • 12.
    Sabbagh SK, Ghodrati E, Hajibeiki A, Mazaheri M, Sarafraz Ardakani MR, Shaker Ardakani Z. Effect of Hydroalcoholic Extract of Ephedra major, Momordica charantia, and Resveratrol on Cytotoxicity and Caspase-3 Genes Expression Level in MCF-7 Breast Cancer Cell Line. Gene Cell Tissue. 2021;8(3). https://doi.org/10.5812/gct.110658.
  • 13.
    Ong THD, Yu N, Meenashisundaram GK, Schaller B, Gupta M. Insight into cytotoxicity of Mg nanocomposites using MTT assay technique. Mater Sci Eng C Mater Biol Appl. 2017;78:647-52. [PubMed ID: 28576033]. https://doi.org/10.1016/j.msec.2017.04.129.
  • 14.
    Fu D, Shi Y, Liu JB, Wu TM, Jia CY, Yang HQ, et al. Targeting Long Non-coding RNA to Therapeutically Regulate Gene Expression in Cancer. Mol Ther Nucleic Acids. 2020;21:712-24. [PubMed ID: 32771923]. [PubMed Central ID: PMC7412722]. https://doi.org/10.1016/j.omtn.2020.07.005.
  • 15.
    O’Donovan N, Crown J, Stunell H, Hill AD, McDermott E, O’Higgins N, et al. Caspase 3 in breast cancer. Clin Cancer Res. 2003;9(2):738-42.
  • 16.
    Wang W, Wang D, Li H. Initiation of premature senescence by Bcl-2 in hypoxic condition. Int J Clin Exp Pathol. 2014;7(5):2446-53. [PubMed ID: 24966955]. [PubMed Central ID: PMC4069934].
  • 17.
    Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9). e45. [PubMed ID: 11328886]. [PubMed Central ID: PMC55695]. https://doi.org/10.1093/nar/29.9.e45.
  • 18.
    Oshima N, Yamashita T, Hyuga S, Hyuga M, Kamakura H, Yoshimura M, et al. Efficiently prepared ephedrine alkaloids-free Ephedra Herb extract: a putative marker and antiproliferative effects. J Nat Med. 2016;70(3):554-62. [PubMed ID: 26976141]. [PubMed Central ID: PMC4935757]. https://doi.org/10.1007/s11418-016-0977-1.
  • 19.
    Maayan M, Monick S, Marcelo F, Moran M, Dvora N, Rameshprabu N, et al. Effect of Ephedra foeminea active compounds on cell viability and actin structures in cancer cell lines. J Med Plant Res. 2017;11(43):690-702. https://doi.org/10.5897/jmpr2017.6471.
  • 20.
    Danciu C, Muntean D, Alexa E, Farcas C, Oprean C, Zupko I, et al. Phytochemical Characterization and Evaluation of the Antimicrobial, Antiproliferative and Pro-Apoptotic Potential of Ephedra alata Decne. Hydroalcoholic Extract against the MCF-7 Breast Cancer Cell Line. Molecules. 2018;24(1). [PubMed ID: 30577537]. [PubMed Central ID: PMC6337526]. https://doi.org/10.3390/molecules24010013.
  • 21.
    Golfakhr Abadi F, Yousefbeyk F, Hassanzadeh A, Sadat Hamedi S. [Lavender in Iranian traditional medicine and new studies]. Journal of Islamic and Iranian Traditional Medicine. 2017;8(2):161-71. Persian.
  • 22.
    Vranová E, Coman D, Gruissem W. Structure and dynamics of the isoprenoid pathway network. Mol Plant. 2012;5(2):318-33. [PubMed ID: 22442388]. https://doi.org/10.1093/mp/sss015.
  • 23.
    Tabatabaei SM, Kianinodeh F, Nasiri M, Tightiz N, Asadipour M, Gohari M. In vitro inhibition of MCF-7 human breast cancer cells by essential oils of Rosmarinus officinalis, Thymus vulgaris L., and Lavender x intermedia. Arch Breast Cancer. 2018;5(2):81-9. https://doi.org/10.19187/abc.20185281-89.
  • 24.
    Amiri A, Tayarani-Najaran Z, Karimi G, Mousavi S, editors. Evaluation of Lavandula angustifolia cytotoxic and apoptotic effects on human cervical cancer cell line (Hela) in compare with normal cells. 13th Iranian Pharmaceutical Sciences Congress. 2012; Isfahan, Iran. Isfahan, Iran: Research in Pharmaceutical Sciences; 2012. 141 p.
  • 25.
    Tayarani-Najaran Z, Amiri A, Karimi G, Emami SA, Asili J, Mousavi SH. Comparative studies of cytotoxic and apoptotic properties of different extracts and the essential oil of Lavandula angustifolia on malignant and normal cells. Nutr Cancer. 2014;66(3):424-34. [PubMed ID: 24571090]. https://doi.org/10.1080/01635581.2013.878736.
  • 26.
    Qasem W, Mohamed E, Hamed A, El-Sayed AE, Salah El Din R. Antimicrobial and Anticancer Activity of Some Microalgae species. Egypt J Phycol. 2016;17(1):33-49. https://doi.org/10.21608/egyjs.2016.115978.
  • 27.
    Silambarasan T, Kumaran M, Kalaichelvan D, Dhandapani R. Antioxidant and antiproliferative activity of the extract from fresh water algae Scenedesmus obliquus RDS01. Int J Adv Sci Eng. 2014;1:37-40.
  • 28.
    Abd El Baky HH, El-Baroty GS, Ibrahem EA. Antiproliferation and antioxidant properties of lipid extracts of the microalgae Scenedesmus obliquus grown under stress conditions. Der Pharma Chemica. 2014;6(5):24-34.
  • 29.
    Yim NH, Kim A, Jung YP, Kim T, Ma CJ, Ma JY. Fermented So-Cheong-Ryong-Tang (FCY) induces apoptosis via the activation of caspases and the regulation of MAPK signaling pathways in cancer cells. BMC Complement Altern Med. 2015;15:336. [PubMed ID: 26403976]. [PubMed Central ID: PMC4582731]. https://doi.org/10.1186/s12906-015-0821-2.
  • 30.
    Zhou M, Liu X, Li Z, Huang Q, Li F, Li CY. Caspase-3 regulates the migration, invasion and metastasis of colon cancer cells. Int J Cancer. 2018;143(4):921-30. [PubMed ID: 29524226]. [PubMed Central ID: PMC6204286]. https://doi.org/10.1002/ijc.31374.
  • 31.
    Hasan TN, B LG, Shafi G, Al-Hazzani AA, Alshatwi AA. Anti-proliferative effects of organic extracts from root bark of Juglans Regia L. (RBJR) on MDA-MB-231 human breast cancer cells: role of Bcl-2/Bax, caspases and Tp53. Asian Pac J Cancer Prev. 2011;12(2):525-30. [PubMed ID: 21545224].
  • 32.
    Ullah I, Khalil AT, Ali M, Iqbal J, Ali W, Alarifi S, et al. Green-Synthesized Silver Nanoparticles Induced Apoptotic Cell Death in MCF-7 Breast Cancer Cells by Generating Reactive Oxygen Species and Activating Caspase 3 and 9 Enzyme Activities. Oxid Med Cell Longev. 2020;2020:1215395. [PubMed ID: 33082906]. [PubMed Central ID: PMC7559220]. https://doi.org/10.1155/2020/1215395.
  • 33.
    Keane MM, Ettenberg SA, Nau MM, Russell EK, Lipkowitz S. Chemotherapy augments TRAIL-induced apoptosis in breast cell lines. Cancer Res. 1999;59(3):734-41. [PubMed ID: 9973225].
  • 34.
    Mou S, Zhou Z, He Y, Liu F, Gong L. Curcumin inhibits cell proliferation and promotes apoptosis of laryngeal cancer cells through Bcl-2 and PI3K/Akt, and by upregulating miR-15a. Oncol Lett. 2017;14(4):4937-42. [PubMed ID: 29085504]. [PubMed Central ID: PMC5649612]. https://doi.org/10.3892/ol.2017.6739.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles