Gene Cell Tissue

Image Credit:Gene Cell Tissue

The Regulatory Effect of HOTAIR on the Protein and RNA Levels of ZEB1 and Its Potential Role in the EMT Process

Author(s):
Fatemeh BossaghzadehFatemeh BossaghzadehFatemeh Bossaghzadeh ORCID1, Mohammadreza HajjariMohammadreza HajjariMohammadreza Hajjari ORCID2,*, Abdolkarim SheikhiAbdolkarim SheikhiAbdolkarim Sheikhi ORCID3, Iman SalahshourifarIman SalahshourifarIman Salahshourifar ORCID1, Shiva IraniShiva IraniShiva Irani ORCID1
1Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran
2Department of Biology, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran
3Department of Immunology, Faculty of Medicine, Dezful University of Medical Sciences, Dezful, Iran
*Corresponding Author: Department of Biology, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran. Email: [email protected]

Gene, Cell and Tissue:Vol. 10, issue 1; e124166
Published online:Aug 01, 2022
Article type:Research Article
Received:May 04, 2022
Accepted:Jun 28, 2022
How to Cite:Bossaghzadeh F, Hajjari M, Sheikhi A, Salahshourifar I, Irani S. The Regulatory Effect of HOTAIR on the Protein and RNA Levels of ZEB1 and Its Potential Role in the EMT Process. Gene Cell Tissue. 2023;10(1):e124166. doi: https://doi.org/10.5812/gct-124166

Abstract

Background:

Invasion and metastasis in tumors are considered as two most important reasons for the reduction of treatment efficiency, as well as an increase in the mortality rate among the patients. According to the evidence, HOX transcript antisense RNA (HOTAIR) accounts for one of the main IncRNAs associated with the development and expansion of gastric cancer (GC).

Objectives:

This research investigates the impact of HOTAIR suppression on the expression and translation of the ZEB1 marker in GC.

Methods:

The knockdown HOTAIR was in the AGS cell line using small interfering RNA targeting against HOTAIR (si-HOTAIR). The impact of HOTAIR expression on the cell proliferation was previously evaluated by the MTT assay. The expression of the zinc finger E-box binding homeobox 1 (ZEB1) gene in transfected cell lines was quantified compared to the control samples using the quantitative real-time polymerase chain reaction (qRT-PCR). The enzyme-linked immunosorbent assay (ELISA) was also used to assess the HOTAIR suppression impact on the ZEB1 protein.

Results:

The findings revealed that a decrease in the HOTAIR expression could cause a reduction in the proliferation and growth of cancer cells (Fold changes = 0/28, P-value < 0.01). According to the impact of changes in the HOTAIR expression levels on the ZEB1 expression, the ZEB1 expression level was directly correlated with HOTAIR so that a decrease in the HOTAIR expression led to a significant decline in the ZEB1 expression level (P-value < 0.05). At the protein level, the effect of the knockdown of HOTAIR expression on the reduction of ZEB1 protein was also observed.

Conclusions:

Our findings showed a significant association between the HOTAIR and ZEB1 expression levels. Overall, the HOTAIR-ZEB1 axis plays a vital role in the epithelial-to-mesenchymal transition (EMT) process in human GC and represents a new therapeutic strategy for future GC treatment.

1. Background

The third leading cause of cancer death is gastric cancer (GC) (1). GC-related morbidity and mortality are higher in East Asia, particularly in Korea, Japan, Mongolia, and China, than in most Western countries (2, 3). Tumor metastasis is one of the leading causes of death related to cancer (4, 5).
Tumor metastasis is a complex procedure in which cancer cells proliferate from the original tumor location to other organs. To some extent, metastatic cancer cells retain epithelial properties while displaying mesenchymal properties, including distraction and invasion (6). This biological procedure is related to E-cadherin expression loss and the expression rise of zinc finger E-box binding homeobox 1 (ZEB1), besides up-regulation of Vimentin and N-cadherin (6).
ZEB1 belongs to the ZEB transcription factor family which deals with controlling crucial variables during the invasive front of carcinomas by inducing epithelial-to-mesenchymal transition (EMT), providing cancer cells with a pre-invasive and stem-like phenotype, and determination a much worse clinical prognosis in most human malignancies (7, 8). EMT phenotype and cellular plasticity are induced by ZEB1 (9). ZEB1 increases transcriptional regulation of genes implicated in cancer progression in breast, prostate cancer cells, and GC (10, 11).
Long non-coding RNA (LncRNA) is a kind of non-coding RNA with a length above 200 nucleotides (nt) that can influence target gene expression levels during the transcriptional and posttranscriptional stages (12). Some studies in GC have found that lncRNAs such as GIHCG, (13) ATB, (14) FEZF1 antisense RNA 1 (FEZF1-AS1) (15), SNHG15 (16), and CRNDE (17) are abnormally expressed and linked to cancer progression pathways. The human chromosome 12 gene HOX transcript antisense RNA (HOTAIR) has been shown to serve an oncogenic effect in cancer. HOTAIR dysregulation are linked to cancer progression, including ovarian cancer (18) and colon cancer (19). Nevertheless, there are limited reports on the biological mechanism of HOTAIR in GC (20).
HOTAIR has been identified as an overexpressed oncogene in solid tumors and hematologic cancers. HOTAIR expression was substantially linked with lymph node metastases, TNM stage, and invasion in GC was higher in the tumor than in the neighboring noncancerous tissues (21, 22). In patients with GC, a high HOTAIR expression was further employed to predict poor overall survival (23).
The involvement of HOTAIR in EMT process has been reported in several studies (24). In our previous study, we found that HOTAIR can induce EMT process through its effect on miR200 family members (25). In this study, we hypothesized that HOTAIR has a correlation with the ZEB1, as the target of this family.

2. Objectives

This study aimed to investigate the association between HOTAIR and ZEB1 in GC on the AGS cell line.

3. Methods

3.1. Cell lines and Culture Conditions

The Pasteur Institute of Iran provided the AGS human GC cell line (Tehran, Iran). Cells were full-grown in RPMI 1640 medium (Gibco, USA) complemented with 10% fetal bovine serum (FBS) (Invitrogen, USA) and 1% Pen-Strep (Invitrogen), and then incubated at 37°C, 5% CO2, and saturated humidity. When cells reached a proper confluence, they were passaged with trypsin. An inverted microscope was used to track cell growth. Here, cells were cultivated in the logarithmic growth phase (25).

3.2. Knockdown of HOTAIR in the AGS Cell Line

To silence the HOTAIR gene, AGS cells were transfected by 50 nM of siRNA targeted vs. HOTAIR (siHOTAIR), as well as a negative control siRNA (siNC) obtained from Sigma Company. The siRNAs comprised negative control (MISSION® siRNA Universal Negative Control #1, SIGMA/SIC001) & HOTAIR siRNA–SASI (Hs02_00380445). In 24-well plates, AGS cells were grown to 50% confluence and then transfected by Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. The experiment was carried out twice more. At the time of transfection, the plated cells were 70-90 percent confluent (AGS: 60 × 103 cells) and were harvested 48 h later. Finally, real-time polymerase chain reaction (RT-PCR) was used to test the knockdown of the HOTAIR gene, as detailed below (25).

3.3. Assay of Proliferation

An MTT kit (Atocell, England) was previously applied to perform a cell viability experiment based on the manufacturer's instructions. The cell line was seeded on a plate with 96 wells as part of replication research. AGS cells were then transfected with 50 nM of si-HOTAIR, a siNC, and MOCK 24 h after seeding. After 48 h, the Methyl Thiazol Tetrazolium (MTT) solution was added to each well and incubated for 4 h at 37°C in a humidified environment with 5% CO2. Using an Elisa-reader, the wells' absorbance was evaluated at 490 nm (Biorad, USA). Each group had three replicate wells, and experiments were performed three times (25).

3.4. RNA Extraction & cDNA Synthesis from Total RNAs

RNX (CinnaGen) was applied to extract total RNAs from full-grown cells based on the manufacturer's instructions. DNaseI (Sigma) was used to treat the extracted RNA, which was subsequently kept at -80°C. RNA purity was evaluated utilizing a Nanodrop spectrophotometer (Epoch, Biotek-USA) in addition to an A260/280 nm absorbance ratio. The RNA integrity was also tested utilizing electrophoresis on a 2% agarose gel with SafeStain (CinnaGen). Next, using a cDNA Synthesis Kit (TaKaRa, Japan), RNA was reverse transcribed into cDNA following the manufacturer's instructions.
The Oligo dt and random hexamer primers were used for protein-coding genes (ZEB1 and HPRT) and the long non-coding gene HOTAIR. The cDNA was synthesized by a commercial kit (Takara Company), and the final volume of the reaction was made to 10 µL. The reaction was sited for 15 min at 37°C and for 5 sec at 85°C later to stop cDNA synthesis (deactivating the RT enzyme).

3.5. Quantitative Real-time PCR

In the ABI 7100 RT-PCR system (Applied Biosystems, USA), RT-qPCR was done utilizing SYBR-Green PCR Mix (Takara, Japan). The overall volume equaled 20 μL with 1 μL of cDNA, 0.5 μL of the reverse and forward primers (10 μM), and 10 μL of 2x SYBR Green PCR super master mix. For PCR, the conditions were denaturation for 5 min at 95°C, 5-sec 40 cycles at 95°C, and extension/annealing for 30 sec at 60°C. The HPRT housekeeping gene was used as internal control. The Gen Runner & Primer BLAST was used to create primers based on the GenBank cDNA sequences. Table 1 displays the primer sequences. The correctness of the qRT-PCR results was checked by calculating melting curves for the genes plus primer dimer fragments. To finish, genes' expression was evaluated using the Fold change 2-∆Ct technique (Livak technique; [∆Ct: Ct gene of interest-Ct internal control]) in every analyzed sample. Standard curves constructed from raw data were used to measure primers' efficacy (LinRegPcr; Primer efficiency = 2 & Regression = 0.999).
Table 1.Primers Applied in the Research a
Target GenePrimer Sequence (5′→3′)Forward (F) & Reverse (R)
HPRTGGACTTTGCTTTCCTTGGTCAGF
HPRTGTCAAGGGCATATCCTACAACAR
HOTAIRGAAAGGTCCTGCTCCGCTTCF
HOTAIRTCCTCTCGCCGCCGTCTGR
ZEB1GCACCTGAAGAGGACCAGAGF
ZEB1GGGGTTCTGTATGCAAAGGTGR

aHOTAIR, HPRT1, and ZEB1 primers reference: Gen Runner & Primer BLAST

3.6. The Extraction of Total ZEB1 Protein from Cell Line

Protein extraction was performed as previously described (26). In brief, after removing the supernatant and adding some cold PBS, the solution was later centrifuged for 5 min at 1000 g. RIPA lysis buffer containing a suppressor was added to the cell pellet. Next, the suspension was incubated on the ice at 4°C for 30 min. Then specimens were centrifuged for 15 min at 4°C at 13000 g, and the supernatant was collected at -80°C. Protein concentrations were determined using the Bradford method.

3.7. The Evaluation of ZEB1 Protein by ELISA

To this aim, 100 µL of the extracted protein (10 µg/mL) and 100 µL of PBS were added to each of 96 wells and incubated overnight at 4°C. The wells were aspirated and later rinsed twice by a washing buffer, then blocked by adding 300 µL of the inhibitor buffer to each well, and incubated at 37°C for 60 min. Subsequently, after rinsing, 100 µL of ZEB1 antibody (Cusabio, catalog number: CSB-PA026424LA01HU) was added to each well (1 µg per well), and kept for 2 h at RT. The rinsing was repeated. Then, 100 µL of HRP-conjugated secondary anti-rabbit antibody (Sigma Aldrich, catalog number: A6154) was added to the wells at a dilution rate of 1: 10000 and kept at RT for 2 h. Next 100 µL of TMB solution (Sigma-Aldrich, catalog number: T0440) was added to wells and located for 30 min in the dark. After adding 100 µL of H2SO4 stop solution, an ELISA reader was used to read the OD at 450 nm.

3.8. Statistical Analysis

Using one-way analysis of variance (ANOVA) by Graphpad Prism 9 software, statistical analysis was carried out by 95% confidence interval (CI). Data were presented as mean ± SD. A P-value < 0.05 was considered as statistically significant. Analysis of the HOTAIR and ZEB1 expression was done three times for each specimen.

4. Results

4.1. The HOTAIR Expression Level in AGS Downregulated by si-HOTAIR

As anticipated, the HOTAIR knockdown resulted in a reduced number of cells in accordance with our previous report on the HOTAIR functional role in GC cell lines (25). A statistically significant decline was observed in developing si-HOTAIR transfected cells as compared with MOCK and siNC groups (approximately for the AGS cell line, Fold change = 0.28; P = 0.0038, **P < 0.01; Figure 1).
After treating the AGS cell line with siRNA targeting the HOTAIR, the HOTAIR expression level was assessed using quantitative RT-PCR. As illustrated in Figure 2, there was a reduction in the HOTAIR expression level in AGS (Fold change = 0.48; **P < 0.01; Figure 2)
MTT assay was conducted to assess cell proliferation in the si-<i>HOTAIR</i>-transfected AGS cell line. There was a statistically significant reduction in the si-<i>HOTAIR</i> transfected cells' growth as compared with the MOCK and siNC groups (**P &lt; 0.01 vs. NC). <i>HOTAIR</i>, Hox transcript antisense RNA.
Figure 1.

MTT assay was conducted to assess cell proliferation in the si-HOTAIR-transfected AGS cell line. There was a statistically significant reduction in the si-HOTAIR transfected cells' growth as compared with the MOCK and siNC groups (**P < 0.01 vs. NC). HOTAIR, Hox transcript antisense RNA.

RT-qPCR demonstrated that <i>HOTAIR</i> expression was down-regulated by si-<i>HOTAIR</i>. The <i>HOTAIR</i> expression level in si-<i>HOTAIR</i>-transfected AGS cells. Data were presented as mean ± SD, **P &lt; 0.01. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; <i>HOTAIR</i>, Hox transcript antisense RNA.
Figure 2.

RT-qPCR demonstrated that HOTAIR expression was down-regulated by si-HOTAIR. The HOTAIR expression level in si-HOTAIR-transfected AGS cells. Data were presented as mean ± SD, **P < 0.01. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; HOTAIR, Hox transcript antisense RNA.

4.2. The Impact of HOTAIR Knockdown on the ZEB1 Gene Expression

After treating the AGS cell line with siRNA targeting the HOTAIR, the ZEB1 expression level was assessed using quantitative RT-PCR. As observed in Figure 3, the expression of ZEB1 was significantly declined in samples transfected by siHOTAIR. The authenticity of the results was confirmed by one-way ANOVA (Fold change = 0.65; P = 0.0288, *P < 0.05; Figure 3)
The impact of <i>HOTAIR</i> knockdown on the <i>ZEB1</i> expression. Data were expressed as mean ± SD, *P &lt;0.05. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; HOX antisense intergenic RNA (<i>HOTAIR</i>); Zinc finger E-box binding homeobox 1 (<i>ZEB1</i>).
Figure 3.

The impact of HOTAIR knockdown on the ZEB1 expression. Data were expressed as mean ± SD, *P <0.05. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; HOX antisense intergenic RNA (HOTAIR); Zinc finger E-box binding homeobox 1 (ZEB1).

4.3. The Impact of HOTAIR Suppression on the Protein Expression of ZEB1 in AGS Cell Line

The results revealed that protein expression of ZEB1 was significantly reduced in siHOTAIR transfected samples. The suppression of HOTAIR expression was directly associated with the reduction of ZEB1 protein expression. The authenticity of the results was confirmed by one-way ANOVA (P = 0.350, *P < 0.05, Figure 4).
The impact of <i>HOTAIR</i> suppression on the <i>ZEB1</i> protein expression in AGS cell line. Data were expressed as mean ± SD, *P &lt; 0.05. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; HOX antisense intergenic RNA (<i>HOTAIR</i>); Zinc finger E-box binding homeobox 1 (<i>ZEB1</i>)
Figure 4.

The impact of HOTAIR suppression on the ZEB1 protein expression in AGS cell line. Data were expressed as mean ± SD, *P < 0.05. RT-qPCR, reverse-transcription quantitative polymerase chain reaction; HOX antisense intergenic RNA (HOTAIR); Zinc finger E-box binding homeobox 1 (ZEB1)

5. Discussion

Studies show that the expression of HOTAIR is significantly higher in tumors compared to normal tissues. On the other hand, many important processes in GC are influenced by this regulatory RNA. Identifying the mode of action of this RNA is effective in better understanding of pivotal molecular mechanisms in GC (27).
The results of this study showed that the HOTAIR gene may have a significant effect on the growth and proliferation of cancer cells. In fact, increased HOTAIR expression can be considered as an important sign in the proliferation and spread of cancerous mass. Regulating the growth and proliferation of cancer cells requires influencing cell cycle and its inhibitors. Considering the mechanism of HOTAIR action on cell cycles and the path of apoptosis can have a significant impact on better understanding the role of HOTAIR on the proliferation and development of malignant tumors. The molecular pathway of HATAIR in GC has also been investigated (28).
Xu et al. stated that the decrease of HOTAIR expression could be accompanied by the decrease of invasion potential and suppressing the EMT pathway. In this study, HOTAIR was shown to impact a wide range of markers and transcription factors involved in the EMT pathway, and the decrease of HOTAIR expression accounted for an important target in suppressing the invasion in GC (23). Zhang et al. also showed that HOTAIR could be regarded as an important factor in the EMT pathway and metastasis of GC (29).
Previous studies demonstrated that lncRNAs are abnormally expressed in cancer and act as oncogenes or tumor suppressors, revealing an important role in cancer prognosis (30). HOTAIR is a possible therapeutic target in treating GC, according to current research findings. HOTAIR has been shown in several investigations to induce EMT by inhibiting target genes (31, 32). We discovered a potential action mechanism for HOTAIR in the up-regulation of ZEB1, one of the most critical markers of EMT.
It was previously revealed that miR-200 acts as a tumor suppressor factor by inhibiting EMT and tumor growth in GC by targeting ZEB1 and ZEB2 (28).
Takei et al. showed that a lncRNA (HOTAIR) is expressed more vastly in 60As6 than HSC-60 cells. Expression of HOTAIR promotes EMT in 60As6 cells. They discovered that HOTAIR binds and targets miR-217, which binds to ZEB1. In the orthotopic tumor mouse model, the knocking down HOTAIR in 60As6 cells greatly declined invasion activity and peritoneal dispersion, and significantly extended longevity. The HOTAIR-miR-217-ZEB1 axis, linked to EMT, appears to prevent peritoneal spread. They concluded that EMT is accelerated in scirrhous gastric tumors by at least two distinct mechanisms: (i) HOTAIR overexpression (60As6 & 44As3 cell lines) and (ii) miR-200 family down-regulation (58As9 cell line). Both methods then work together to increase ZEB1 expression and give cells mesenchymal characteristics (33).
This study revealed that a drop in HOTAIR expression was linked to reducing cancer cell proliferation and growth. The decrease of HOTAIR expression and the ZEB1 gene transcription could happen alongside each other. According to our results, assessing the effect of suppressing HOTAIR expression in the AGS cell line at the level of protein by the ELISA technique showed that suppressing HOTAIR expression could decrease the expression of ZEB1 protein. Considering the key role of the ZEB1 gene as an important marker in progressing the EMT pathway and invasion, it can be concluded that HOTAIR can be a pivotal regulator in the occurrence of metastasis and invasion in GC tumors.
Our results suggested a new mechanism mediated by HOTAIR and ZEB1 that mediates the transitions between EMT and MET programs. As a result of their common molecular properties in the EMT process, ZEB1 and HOTAIR were studied. However, more investigations are needed to define the precise regulation mechanism of HOTAIR on the ZEB1. Further studies are needed to investigate this axis by overexpressing HOTAIR and analyzing interactions between HOTAIR and regulatory elements, evaluation of HOTAIR expression changes on other markers and transcription factors in the EMT pathway, as well as on cell cycle inhibitors and apoptosis for better understanding the effects on cell proliferation and inhibition of apoptosis. Finally, it is recommended to evaluate the effect of HOTAIR knockdown on the expression and translation levels of ZEB1 markers in other cancer cell lines. However, further studies on animal models are necessary.

5.1. Conclusions

The HOTAIR-ZEB1 axis appears to play a key role in human GC, making it a possible therapeutic target for the future. As far as the researchers investigated, this is the first research on the effect of HOTAIR-ZEB1 axis in GC. Nevertheless, more research on the specific mechanism is needed.

Acknowledgments

Footnotes

  • Authors' Contribution: Study concept and design: M. H.; Analysis and interpretation of data: M. H.; Drafting of the manuscript: F. B.; Critical revision of the manuscript for important intellectual content: M. H., and F. B.; Statistical analysis: M. H..

  • Conflict of Interests: The authors did not receive any financial or research support in the last five years, personal financial interests, stocks or shares of companies, and consulting fees. We do not have any personal or professional relations with organizations and individuals (parents and children, spouses, family relations, etc.) and unpaid membership in a governmental or non-governmental organization. Also, none of the authors were editorial board members of the journal.

  • Data Reproducibility: The data presented in this study is openly available to readers upon request.

  • Funding/Support: This study was financially supported by the Iranian Council of Stem Cell Technology, Shahid Chamran university of Ahvaz, and Islamic Azad University.

References

  • 1.
    Sadegh Z, Pishkar L, Chaleshi V. Evaluation of AK023391 lncRNA and FOXO3a Genes’ Expression in Tissues from Iranian Gastric Cancer Patients Compared with Healthy Tissues and Their Relationship with Clinicopathological Features. Gene Cell Tissue. 2021;In Press(In Press). https://doi.org/10.5812/gct.117415.
  • 2.
    Thrift AP, El-Serag HB. Burden of Gastric Cancer. Clin Gastroenterol Hepatol. 2020;18(3):534-42. [PubMed ID: 31362118]. [PubMed Central ID: PMC8859863]. https://doi.org/10.1016/j.cgh.2019.07.045.
  • 3.
    Chen W, Zheng R, Zeng H, Zhang S, He J. Annual report on status of cancer in China, 2011. Chin J Cancer Res. 2015;27(1):2-12. [PubMed ID: 25717220]. [PubMed Central ID: PMC4329176]. https://doi.org/10.3978/j.issn.1000-9604.2015.01.06.
  • 4.
    Cervantes A, Roda D, Tarazona N, Rosello S, Perez-Fidalgo JA. Current questions for the treatment of advanced gastric cancer. Cancer Treat Rev. 2013;39(1):60-7. [PubMed ID: 23102520]. https://doi.org/10.1016/j.ctrv.2012.09.007.
  • 5.
    Shah MA. Gastrointestinal cancer: targeted therapies in gastric cancer-the dawn of a new era. Nat Rev Clin Oncol. 2014;11(1):10-1. [PubMed ID: 24300880]. https://doi.org/10.1038/nrclinonc.2013.231.
  • 6.
    Putzke AP, Ventura AP, Bailey AM, Akture C, Opoku-Ansah J, Celiktas M, et al. Metastatic progression of prostate cancer and e-cadherin regulation by zeb1 and SRC family kinases. Am J Pathol. 2011;179(1):400-10. [PubMed ID: 21703419]. [PubMed Central ID: PMC3123858]. https://doi.org/10.1016/j.ajpath.2011.03.028.
  • 7.
    Yun EJ, Baek ST, Xie D, Tseng SF, Dobin T, Hernandez E, et al. DAB2IP regulates cancer stem cell phenotypes through modulating stem cell factor receptor and ZEB1. Oncogene. 2015;34(21):2741-52. [PubMed ID: 25043300]. https://doi.org/10.1038/onc.2014.215.
  • 8.
    Zhang P, Sun Y, Ma L. ZEB1: at the crossroads of epithelial-mesenchymal transition, metastasis and therapy resistance. Cell Cycle. 2015;14(4):481-7. [PubMed ID: 25607528]. [PubMed Central ID: PMC4614883]. https://doi.org/10.1080/15384101.2015.1006048.
  • 9.
    Kondo M, Ogino H, Ogawa H, Afroj T, Toyoda Y, Sakaguchi S, et al. A case of pulmonary pleomorphic carcinoma with malignant phenotypes induced by ZEB1-associated epithelial-mesenchymal transition. Respir Med Case Rep. 2018;25:119-21. [PubMed ID: 30112272]. [PubMed Central ID: PMC6092312]. https://doi.org/10.1016/j.rmcr.2018.07.008.
  • 10.
    Orellana-Serradell O, Herrera D, Castellon EA, Contreras HR. The transcription factor ZEB1 promotes an aggressive phenotype in prostate cancer cell lines. Asian J Androl. 2018;20(3):294-9. [PubMed ID: 29271397]. [PubMed Central ID: PMC5952486]. https://doi.org/10.4103/aja.aja_61_17.
  • 11.
    Maturi V, Enroth S, Heldin CH, Moustakas A. Genome-wide binding of transcription factor ZEB1 in triple-negative breast cancer cells. J Cell Physiol. 2018;233(10):7113-27. [PubMed ID: 29744893]. [PubMed Central ID: PMC6055758]. https://doi.org/10.1002/jcp.26634.
  • 12.
    Fatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014;15(1):7-21. [PubMed ID: 24296535]. https://doi.org/10.1038/nrg3606.
  • 13.
    Li Z, Ma YY, Wang J, Zeng XF, Li R, Kang W, et al. Exosomal microRNA-141 is upregulated in the serum of prostate cancer patients. Onco Targets Ther. 2016;9:139-48. [PubMed ID: 26770063]. [PubMed Central ID: PMC4706124]. https://doi.org/10.2147/OTT.S95565.
  • 14.
    Sohn W, Kim J, Kang SH, Yang SR, Cho JY, Cho HC, et al. Serum exosomal microRNAs as novel biomarkers for hepatocellular carcinoma. Exp Mol Med. 2015;47. e184. [PubMed ID: 26380927]. [PubMed Central ID: PMC4650928]. https://doi.org/10.1038/emm.2015.68.
  • 15.
    Shi C, Sun L, Song Y. FEZF1-AS1: a novel vital oncogenic lncRNA in multiple human malignancies. Biosci Rep. 2019;39(6). [PubMed ID: 31175144]. [PubMed Central ID: PMC6591563]. https://doi.org/10.1042/BSR20191202.
  • 16.
    Mokhtar A, Kong C, Zhang Z, Du Y. Down-regulation LncRNA-SNHG15 contributes to proliferation and invasion of bladder cancer cells. BMC Urol. 2021;21(1):83. [PubMed ID: 34016097]. [PubMed Central ID: PMC8139049]. https://doi.org/10.1186/s12894-021-00852-1.
  • 17.
    Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of transcription in human cells. Nature. 2012;489(7414):101-8. [PubMed ID: 22955620]. [PubMed Central ID: PMC3684276]. https://doi.org/10.1038/nature11233.
  • 18.
    Kung JT, Colognori D, Lee JT. Long noncoding RNAs: past, present, and future. Genetics. 2013;193(3):651-69. [PubMed ID: 23463798]. [PubMed Central ID: PMC3583990]. https://doi.org/10.1534/genetics.112.146704.
  • 19.
    Guan D, Zhang W, Zhang W, Liu GH, Belmonte JC. Switching cell fate, ncRNAs coming to play. Cell Death Dis. 2013;4. e464. [PubMed ID: 23328671]. [PubMed Central ID: PMC3563984]. https://doi.org/10.1038/cddis.2012.196.
  • 20.
    Tang Q, Hann SS. HOTAIR: An Oncogenic Long Non-Coding RNA in Human Cancer. Cell Physiol Biochem. 2018;47(3):893-913. [PubMed ID: 29843138]. https://doi.org/10.1159/000490131.
  • 21.
    Yu X, Li Z. Long non-coding RNA HOTAIR: A novel oncogene (Review). Mol Med Rep. 2015;12(4):5611-8. [PubMed ID: 26238267]. https://doi.org/10.3892/mmr.2015.4161.
  • 22.
    Wu ZH, Wang XL, Tang HM, Jiang T, Chen J, Lu S, et al. Long non-coding RNA HOTAIR is a powerful predictor of metastasis and poor prognosis and is associated with epithelial-mesenchymal transition in colon cancer. Oncol Rep. 2014;32(1):395-402. [PubMed ID: 24840737]. https://doi.org/10.3892/or.2014.3186.
  • 23.
    Xu ZY, Yu QM, Du YA, Yang LT, Dong RZ, Huang L, et al. Knockdown of long non-coding RNA HOTAIR suppresses tumor invasion and reverses epithelial-mesenchymal transition in gastric cancer. Int J Biol Sci. 2013;9(6):587-97. [PubMed ID: 23847441]. [PubMed Central ID: PMC3708039]. https://doi.org/10.7150/ijbs.6339.
  • 24.
    Cantile M, Di Bonito M, Cerrone M, Collina F, De Laurentiis M, Botti G. Long Non-Coding RNA HOTAIR in Breast Cancer Therapy. Cancers (Basel). 2020;12(5). [PubMed ID: 32397382]. [PubMed Central ID: PMC7281113]. https://doi.org/10.3390/cancers12051197.
  • 25.
    Bossaghzadeh F, Hajjari M, Sheikhi A, Salahshourifar I, Irani S. HOTAIR Induces the Downregulation of miR-200 Family Members in Gastric Cancer Cell Lines. Iran Biomed J. 2022;26(1):77-84. [PubMed ID: 34923813]. [PubMed Central ID: PMC8784900]. https://doi.org/10.52547/ibj.26.1.77.
  • 26.
    Kamazani FM, Sotoodehnejad Nematalahi F, Siadat SD, Pornour M, Sheikhpour M. A success targeted nano delivery to lung cancer cells with multi-walled carbon nanotubes conjugated to bromocriptine. Sci Rep. 2021;11(1):24419. [PubMed ID: 34952904]. [PubMed Central ID: PMC8709863]. https://doi.org/10.1038/s41598-021-03031-2.
  • 27.
    Brzozowa M, Mielanczyk L, Michalski M, Malinowski L, Kowalczyk-Ziomek G, Helewski K, et al. Role of Notch signaling pathway in gastric cancer pathogenesis. Contemp Oncol (Pozn). 2013;17(1):1-5. [PubMed ID: 23788953]. [PubMed Central ID: PMC3685346]. https://doi.org/10.5114/wo.2013.33765.
  • 28.
    Lee NK, Lee JH, Park CH, Yu D, Lee YC, Cheong JH, et al. Long non-coding RNA HOTAIR promotes carcinogenesis and invasion of gastric adenocarcinoma. Biochem Biophys Res Commun. 2014;451(2):171-8. [PubMed ID: 25063030]. https://doi.org/10.1016/j.bbrc.2014.07.067.
  • 29.
    Zhang JP, Zeng C, Xu L, Gong J, Fang JH, Zhuang SM. MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signaling. Oncogene. 2014;33(31):4069-76. [PubMed ID: 24013226]. https://doi.org/10.1038/onc.2013.369.
  • 30.
    Guo L, Gu J, Hou S, Liu D, Zhou M, Hua T, et al. Long non-coding RNA DANCR promotes the progression of non-small-cell lung cancer by inhibiting p21 expression. Onco Targets Ther. 2019;12:135-46. [PubMed ID: 30613152]. [PubMed Central ID: PMC6306065]. https://doi.org/10.2147/OTT.S186607.
  • 31.
    Song Y, Wang R, Li LW, Liu X, Wang YF, Wang QX, et al. Long non-coding RNA HOTAIR mediates the switching of histone H3 lysine 27 acetylation to methylation to promote epithelial-to-mesenchymal transition in gastric cancer. Int J Oncol. 2019;54(1):77-86. [PubMed ID: 30431069]. [PubMed Central ID: PMC6254860]. https://doi.org/10.3892/ijo.2018.4625.
  • 32.
    Cong N, Du P, Zhang A, Shen F, Su J, Pu P, et al. Downregulated microRNA-200a promotes EMT and tumor growth through the wnt/beta-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastric adenocarcinoma. Oncol Rep. 2013;29(4):1579-87. [PubMed ID: 23381389]. https://doi.org/10.3892/or.2013.2267.
  • 33.
    Takei Y, Hara T, Suzuki A, Mihara K, Yanagihara K. Long Noncoding RNA HOTAIR Promotes Epithelial-Mesenchymal Transition and Is a Suitable Target to Inhibit Peritoneal Dissemination in Human Scirrhous Gastric Cancers. Pathobiology. 2020;87(5):277-90. [PubMed ID: 32937635]. https://doi.org/10.1159/000508350.

Copyright

Copyright © 2022, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

21
Sep
2021
 Jentashapir J Cell Mol Biol

Silencing of Long Non-coding RNA HOTAIR Suppresses Reverses Epithelial-Mesenchymal Transition in AGS Gastric Cancer Cell Line by Downregulation of Fibronectin 1 and Claudin-4

Pegah Babapour,
Maryam Tahmasebi-Birgani,
Mehrdad Hashemi,
Mohammad-Reza Hajjari

Babapour P, Tahmasebi-Birgani M, Hashemi M, Hajjari M. Silencing of Long Non-coding RNA HOTAIR Suppresses Reverses Epithelial-Mesenchymal Transition in AGS Gastric Cancer Cell Line by Downregulation of Fibronectin 1 and Claudin-4. Jentashapir J Cell Mol Biol. 2021;12(3):e116396. doi: https://doi.org/10.5812/jjcmb.116396

3
Dec
2022
Jentashapir J Cell Mol Biol

Silencing the Long Non-coding RNA HOTAIR Inhibits Epithelial-Mesenchymal Transition in MKN45 Gastric Cancer Cell Line by Downregulation of Fibronectin-1 and Claudin-4

Sara Alemohammad,
Maryam Tahmasebi Birgani,
Hossein Fahimi,
Mohammad Reza Hajjari

Alemohammad S, Tahmasebi Birgani M, Fahimi H, Hajjari MR. Silencing the Long Non-coding RNA HOTAIR Inhibits Epithelial-Mesenchymal Transition in MKN45 Gastric Cancer Cell Line by Downregulation of Fibronectin-1 and Claudin-4. Jentashapir J Cell Mol Biol. 2022;13(4):e131286. doi: https://doi.org/10.5812/jjcmb-131286

28
Feb
2024
Gene Cell Tissue

Overexpression and Downregulation of HOTAIR Influence the Stemness Markers in Gastric Cancer Cell Lines

Morteza Ghanadpour,
Fatemeh Bossaghzadeh,
Hamid Galehdari,
Seyed Reza Kazemi Nezhad,
Maryam Tahmasebi-Birgani,
Mohammadreza Hajjari

Ghanadpour M, Bossaghzadeh F, Galehdari H, Kazemi Nezhad SR, Tahmasebi-Birgani M, et al. Overexpression and Downregulation of HOTAIR Influence the Stemness Markers in Gastric Cancer Cell Lines. Gene Cell Tissue. 2024;11(2):e144068. doi: https://doi.org/10.5812/gct-144068

30
Nov
2021
Jentashapir J Cell Mol Biol

Silencing of HOTAIR Induced Apoptosis in Human Colorectal Cancer Cells through Up-regulation of Bax and Down-regulation of Bcl2

Reza Dashtbozorgi,
Maryam Tahmasebi-Birgani,
Mohammad-Reza Hajjari,
Amirnader Emami Razavi

Dashtbozorgi R, Tahmasebi-Birgani M, Hajjari M, Emami Razavi A. Silencing of HOTAIR Induced Apoptosis in Human Colorectal Cancer Cells through Up-regulation of Bax and Down-regulation of Bcl2. Jentashapir J Cell Mol Biol. 2021;12(4):e116108. doi: https://doi.org/10.5812/jjcmb.116108

17
Nov
2025
Iran J Pharm Res

Quercetin Inhibits Gastric Cancer Progression via Suppression of HOTAIR/mir-217/GPC5 Axis

Zhuqing Qiu,
Chonglei Qu,
Xiaoying Wu

Qiu Z, Qu C, Wu X. Quercetin Inhibits Gastric Cancer Progression via Suppression of HOTAIR/mir-217/GPC5 Axis. Iran J Pharm Res. 2025;24(1):e165480. doi: https://doi.org/10.5812/ijpr-165480

Download PDF411.41 KB

Crossmark

Crossmark

Checking

Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles