tetA and tetB Genes in Klebsiella Pneumoniae Isolated From Clinical Samples

Authors

Mohammad BokaeianMohammad Bokaeian ORCID1,**, Saeide SaeidiSaeide Saeidi ORCID2,**, Zahra Shahi2, Vahideh Kadaei3
1Department of Laboratory Sciences, Infectious Disease and Tropical Medicine Research Center, Zahedan University of Medical Sciences, Zahedan, IR Iran
2Department of Biology, Faculty of Sciences, Science and Research Branch, Islamic Azad University, Kerman, IR Iran
3Department of Biology, Zabol University of Medical Sciences, Zabol, IR Iran
Corresponding Authors:
**Corresponding authors: Mohammad Bokaeian, Department of Laboratory Sciences, Infectious Diseases and Tropical Medicine Research Center, Zahedan University of Medical Sciences, Khalij Fars Boulevard, Postal Code: 9816743463, Zahedan, IR Iran. Tel: +98-5413425723, Fax: +98-5413425732, E-mail: [email protected]
**Saeide Saeidi, Department of Biology, Faculty of Sciences, Science and Research Branch, Islamic Azad University, Kerman, IR Iran. Tel: +98-9153495398, Fax: +98-5422240696, E-mail: [email protected]

Gene, Cell and Tissue:Vol. 1, issue 2; e18152
Published online:May 22, 2014
Article type:Research Article
Received:Feb 10, 2014
Accepted:May 05, 2014
How to Cite:Bokaeian M, Saeidi S, Shahi Z, Kadaei V. tetA and tetB Genes in Klebsiella Pneumoniae Isolated From Clinical Samples. Gene Cell Tissue. 2014;1(2):e18152. doi: https://doi.org/10.17795/gct-18152

Abstract

Background:

The emergence of antibiotic resistance among clinical and nonclinical bacteria is a global public health problem. Klebsiella Pneumoniae is one of the most pathogens that contains a variety of gens and shows resistance to many antibiotics. Perpetual monitoring of the resistant bacteria is an important in order to limit the development of resistance among these pathogens.

Objectives:

The current study aimed to monitor the prevalence of tetA and tetB resistance genes in Klebsiella Pneumoniae species isolated from the patients with urinary tract infection who hospitalized in Mir Hospital of Zabol, Iran from 2011 to 2012.

Materials and Methods:

In the present cross-sectional study, a total of 30 strains of K. pneumoniae were isolated from urine cultures of hospitalized patients in Mir Hospital (Zabol, south-east of Iran) who had urinary tract infections from 2011 to 2012. Antibiotic susceptibility of isolates was evaluated for four antibiotics including ceftazidime, cefixime, tetracycline and erythromycin using standard Kirby-Bauer disk diffusion method. The K. pneumoniae genome was extracted by simple boiling method, and polymerase chain reaction (PCR) method also was used to detect tetA and tetB genes by specific pair of primers.

Results:

The K. pneumonia isolates were resistant to erythromycin (70%), cefixime (53.3%), tetracycline (50%) and ceftazidime (36.6%). The amplification of tetA and tetB genes of K. pneumonia revealed that all of the isolates harbored these genes.

Conclusions:

Resistance to tetracycline and other antibiotics, and the presence of various resistance genes in K. pneumonia strains are alarming signs in Zabol area. The current study strongly recommends limiting the consumption of antibiotics including tetracycline. Further studies should be conducted in order to find out the extent of the problem in other areas.

Highlights

1. Background

The emergence of antibiotic resistance is a global public health problem. Gram-negative bacterial resistance is of particular importance, since there is a dearth of novel antibiotics directed against these organisms. The clinical utility of carbapenems and the agents of the last resort against multi-drug resistant Enterobacteriaceae are threatened with the growing incidence of pan resistant isolates (1, 2). Different species of Klebsiella genus are responsible for a wide variety of diseases in humans. Klebsiella pneumoniae has been associated with various ailments such as urinary tract infections, septicemia, diarrhea, and other diseases (3). In addition to being the primary cause of respiratory tract infections, K. pneumonia is commonly involved in acute pyelonephritis in pregnant women with urinary tract abnormalities such as urolithiasis, hydronephrosis or congenital deformities. Several reports, especially from the Asia Pacific region and the United States, have also shown that this pathogen has become the predominant cause of liver abscess (4, 5). Tetracycline and other antibiotics have been frequently used to treat diseases, but unfortunately repeated use of these compounds has resulted in the development of resistant strains. Tetracycline resistance in bacteria is mediated by four mechanisms: efflux, ribosomal protection, enzymatic inactivation, and target modification (6). At present, 23 genes encoding efflux pumps and 11 genes encoding ribosomal protection proteins, not including the recently described mosaic tetracycline resistance genes have been reported (7). In prior clinical surveys, tetB gene was identified as the most prevalent tetracycline resistance determinant with a wide host range due to the fact that it resides on highly mobile genetic elements that readily transfer between different bacterial genera (8). The gene tetA is located on conjugative plasmids of different incompatibility groups.

2. Objectives

The current study aimed to detect tetA and tetB genes in Klebsiella Pneumoniae isolated from clinical samples.

3. Materials and Methods

In the present cross-sectional study, a total of 30 K. pneumoniae strains were isolated from urine cultures of hospitalized patients in Mir Hospital (Zabol, south east of Iran) who had urinary tract infections from 2011to 2012. All samples were collected aseptically from the patients and plated right after the collection. Identification of all causative microorganisms was performed by standard microbiologic methods (9).

3.1. Agar Disk Diffusion Assay

The susceptibility of all applied antibiotics was carried out using disc diffusion method on Mueller-Hinton agar as recommended by Clinical and Laboratory Standards Institute (CLSI) (10). Briefly, K. pneumoniae isolates were grown overnight on blood agar, and colony suspension was prepared equal to the turbidity of a 0.5 McFarland standard. The suspension (100 μL) was spread over a Mueller-Hinton agar plate and discs of the selected antibiotics were placed aseptically on the surface of inoculated media. Antibiotics concentrations were as follow: cefixime (30 μg), tetracycline (30 μg), erythromycin (15 μg) and ceftazidime (30 μg).

3.2. Amplification of Genes

The colonies of K. pneumoniae were suspended in TE (Tris + EDTA) buffer and their DNA was extracted by simple boiling method (11). The polymerase chain reaction (PCR) method was performed to detect tetA and tetB genes as described previously with minor modifications, using specific pair of primers (Table 1).
Table 1.
The PCR Primers Applied to Detect tetA and tetB Genesa
PrimerSequenceAnnealing Temperature
tetA--
FGTGAAACCCAACATACCCC58
RGAAGGCAAGCAGGATGTAG60
tetB--
FCCTTATCATGCCAGTCTTGC60
RACTGCCGTTTTTTCGCC52
aAbbreviations: F, forward; R, reverse
The PCR mixture consisted of 10 pmol of each primers, 10 ng DNA sample, 1.5 mM MgCl2, 0.2 mM each dNTP, and 5 U Taq DNA polymerase (Cinagen, Iran) in a total volume of 50 μL of PCR reaction.

4. Results

Overall, K. pneumoniae isolates were resistant to the agents including erythromycin (70%), cefixime (53.3%), tetracyclin (50%) and ceftazidime (36.6%) (Table 2). The amplification of tetA and tetB of K. pneumoniae revealed that all of the isolates harbored these genes (Figure 1).
Table 2.
Antimicrobial Susceptibility of Klebsiella Pneumonia Isolatesa
CeftazidimeCefiximeErythromycinTetracycline
Sensitive16 (53.3)10 (33.3)2 (6.6)13 (43.3)
Intermediate1 (3.3)2 (6.6)5 (16.6)1 (3.3)
Resistant11 (36.6)16 (53.3)21 (70)15 (50)
aData are presented as No. (%)
Lanes 1-8 show the fragment of <i>tetA </i>, and demonstrate the 888 base pare DNA size marker, lanes 9-16 show the fragment of <i>tetB</i> gene with 774 bp size marker.
Figure 1.
Lanes 1-8 show the fragment of tetA , and demonstrate the 888 base pare DNA size marker, lanes 9-16 show the fragment of tetB gene with 774 bp size marker.

5. Discussion

The K. pneumoniae isolates in the study were resistant to erythromycin (70%), cefixime (53.3%), tetracyclin (50%) and ceftazidime (36.6%). In the study conducted by Derakhsan et al. more than half (17/31) of K. pneumoniae isolates showed high resistance to different antibiotics including amoxicillin-clavulanic acid, cefotaxime, ceftriaxone, aztreonam, and ceftazidime (12). All of the isolates in the current study harbored tetA and tetB genes. In the study by Tuckman et al. a total of 452 tetracycline-resistant and nonduplicate isolates were positive by PCR for at least one of the six examined tetracycline resistant determinants (13). In the latter study, 32% and 26% of isolates were positive for tetB and tetA respectively, whereas tetC, tetD, tetE, and tetM, were collectively found in 4% of isolates (13). The tetracycline resistance is a common and developing aspect of resistance among the other bacteria. In the study by Skockova et al. for example, 102 Escherichia coli isolates were examined and about half (49.0%) of these isolates showed resistance to tetracycline. Antibiotic resistance and the corresponding gene(s) show time and geographical dependency. The most common gene detected in tetracycline-resistant isolates from 2010 to 2011 was tetA (81.3%), while tetB was most often (86.5%) found in isolates from 2005 to 2006 (14). The tetracycline resistance genes (including tetA and tetB) have been detected from clinical and non-clinical samples. Koo and Woo have identified tetA (52.4%) followed by tetB (41.3%) as the most frequent genes in tetracycline-resistant E. coli isolates from meat and meat products (15). In the study by Menggen et al. antimicrobial resistance genes, carried by 30 Salmonella isolates, were detected and common genes included tetC (60%, 18/30), cat1 (43.3%, 13/30) and tetA (40%, 12/30) (16). These studies provide a picture of the tetracycline resistance genes burden among clinical and nonclinical K. pneumoniae isolates, as well as the utility of the novel broad-spectrum agent, and tigecycline against these pathogens. Moreover, these results support the general approach of reengineering the existing antimicrobial agents with acceptable safety profiles to evade the resistance mechanisms posed by bacterial pathogens.
In conclusion, resistance to tetracycline and other antibiotics and the presence of various resistance determinants in K. pneumonia strains is an alarming sign in Zabol area. Wide and inappropriate use of antibiotics may play an important role in resistance development. The current study strongly recommends limiting the consumption of antibiotics including tetracycline. Further studies should be conducted in order to find out the extent of the problem in other areas.

Acknowledgments

Footnotes

  • Implication for health policy makers/ practice/ research/ medical education:In order to reduce the prevalence of bacterial resistance, more investigations on resistance monitoring is highly recommended.

  • Authors’ Contributions:Mohammad Bokaeian, data analysis and final approval of the manuscript; Saeide Saeidi, study design, data analysis and manuscript preparation; Zahra Shahi, data collection and final approval of the manuscript; Vahideh Kadaei, experimental studies and final approval of the manuscript.

  • Funding/Support:This study was funded and supported by Institute of Plant Biotechnology, University of Zabol.

References

  • 1.
    Overturf GD. Carbapenemases: a brief review for pediatric infectious disease specialists. Pediatr Infect Dis J. 2010;29(1):68-70. [PubMed ID: 20035208]. https://doi.org/10.1097/INF.0b013e3181c9c118.
  • 2.
    Aubron C, Poirel L, Ash RJ, Nordmann P. Carbapenemase-producing Enterobacteriaceae, U.S. rivers. Emerg Infect Dis. 2005;11(2):260-4. [PubMed ID: 15752444]. https://doi.org/10.3201/eid1102.030684.
  • 3.
    Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev. 1998;11(4):589-603. [PubMed ID: 9767057].
  • 4.
    Chung DR, Lee SS, Lee HR, Kim HB, Choi HJ, Eom JS, et al. Emerging invasive liver abscess caused by K1 serotype Klebsiella pneumoniae in Korea. J Infect. 2007;54(6):578-83. [PubMed ID: 17175028]. https://doi.org/10.1016/j.jinf.2006.11.008.
  • 5.
    Ohmori S. Septic endophthalmitis and meningitis associated with Klebsiella pneumoniae liver abscess. Hepatology Research. 2002;22(4):307-12. https://doi.org/10.1016/s1386-6346(01)00153-x.
  • 6.
    Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;65(2):232-60. second page, table of contents. [PubMed ID: 11381101]. https://doi.org/10.1128/MMBR.65.2.232-260.2001.
  • 7.
    Patterson AJ, Rincon MT, Flint HJ, Scott KP. Mosaic tetracycline resistance genes are widespread in human and animal fecal samples. Antimicrob Agents Chemother. 2007;51(3):1115-8. [PubMed ID: 17178791]. https://doi.org/10.1128/AAC.00725-06.
  • 8.
    Ross JI, Eady EA, Cove JH, Cunliffe WJ. 16S rRNA mutation associated with tetracycline resistance in a gram-positive bacterium. Antimicrob Agents Chemother. 1998;42(7):1702-5. [PubMed ID: 9661007].
  • 9.
    Ganesan S, Taylor R, Rabheru K, Forbes I, Dumontet J, Procyshyn RM. Antipsychotic polypharmacy does not increase the risk for side effects. Schizophr Res. 2008;98(1-3):323-4. [PubMed ID: 17950576]. https://doi.org/10.1016/j.schres.2007.09.002.
  • 10.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility testing. USA: Wayne, Pa; 2007.
  • 11.
    Varaiya AY, Dogra JD, Kulkarni MH, Bhalekar PN. Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in diabetic foot infections. Indian J Pathol Microbiol. 2008;51(3):370-2. [PubMed ID: 18723960].
  • 12.
    Derakhshan S, Najar Peerayeh S, Fallah F, Bakhshi B, Rahbar M, Ashrafi A. Detection of Class 1, 2, and 3 Integrons Among Klebsiella pneumoniae Isolated from Children in Tehran Hospitals. Archives of Pediatric Infectious Diseases. 2013;1(4):164-8. https://doi.org/10.5812/pedinfect.11845.
  • 13.
    Tuckman M, Petersen PJ, Howe AY, Orlowski M, Mullen S, Chan K, et al. Occurrence of tetracycline resistance genes among Escherichia coli isolates from the phase 3 clinical trials for tigecycline. Antimicrob Agents Chemother. 2007;51(9):3205-11. [PubMed ID: 17620376]. https://doi.org/10.1128/AAC.00625-07.
  • 14.
    Skočková, A, Cupáková, S, Karpíšková, R, Janštová, B. Detection of tetracyclin resistance genes in Escherichia coli from cows milk. Journal of Microbiology, Biotechnology and Food Sciences. 2012;1:777-84.
  • 15.
    Koo HJ, Woo GJ. Distribution and transferability of tetracycline resistance determinants in Escherichia coli isolated from meat and meat products. Int J Food Microbiol. 2011;145(2-3):407-13. [PubMed ID: 21324543]. https://doi.org/10.1016/j.ijfoodmicro.2011.01.003.
  • 16.
    Menggen M, Wang H, Yu Y, Zhang D, Liu S. Detection of Antimicrobial Resistance Genes of Pathogenic Salmonella from Swine with DNA Microarray. Journal of Veterinary Diagnostic Investigation. 2007;19(2):161-7. https://doi.org/10.1177/104063870701900204.

Copyright

Copyright © 2014, Zahedan University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

10
Nov
2019
Antibiotic Resistance Among Klebsiella pneumoniae, Molecular Detection and Expression Level of blaKPC and blaGES Genes by Real-Time PCR

Antibiotic Resistance Among Klebsiella pneumoniae, Molecular Detection and Expression Level of blaKPC and blaGES Genes by Real-Time PCR

Narjes Mohammadi Bandari,
Mohsen Zargar,
Hossein Keyvani,
Malihe Talebi,
Mohammad Reza Zolfaghari

Mohammadi Bandari N, Zargar M, Keyvani H, Talebi M, Zolfaghari MR. Antibiotic Resistance Among Klebsiella pneumoniae, Molecular Detection and Expression Level of blaKPC and blaGES Genes by Real-Time PCR. Jundishapur J Microbiol. 2019;12(10):e93070. doi: https://doi.org/10.5812/jjm.93070

6
Aug
2016

Prevalence of Quinolone Resistance Genes in Klebsiella pneumoniae Strains Isolated from Hospitalized Patients During 2013 - 2014

Mohsen Heidary,
Hossein Goudarzi,
Ali Hashemi,
Gita Eslami,
Mehdi Goudarzi,
Alireza Salimi Chirani
,et al.

Heidary M, Goudarzi H, Hashemi A, Eslami G, Goudarzi M, et al. Prevalence of Quinolone Resistance Genes in Klebsiella pneumoniae Strains Isolated from Hospitalized Patients During 2013 - 2014. Arch Pediatr Infect Dis. 2017;5(4):e38343. doi: https://doi.org/10.5812/pedinfect.38343

21
Sep
2020
Frequency of qnr and aac(6’)Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran

Frequency of qnr and aac(6’)Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran

Siavash Vaziri,
Mandana Afsharian,
Feizollah Mansouri,
Mohsen Azizi,
Fatemeh Nouri,
Nahid Madadi-Goli
,et al.

Vaziri S, Afsharian M, Mansouri F, Azizi M, Nouri F, et al. Frequency of qnr and aac(6’)Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran. Jundishapur J Microbiol. 2020;13(7):e100348. doi: https://doi.org/10.5812/jjm.100348

20
Apr
2018
Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae

Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae

Hesam Alizade,
Maziar Jajarmi,
Mohammad Reza Aflatoonian,
Davood Kalantar-Neyestanaki,
Saeed Shoja,
Reza Ghanbarpour

Alizade H, Jajarmi M, Aflatoonian MR, Kalantar-Neyestanaki D, Shoja S, et al. Comparative Prevalence of blaCTX-M-15 Gene with Virulence Genes and Serotypes in Klebsiella pneumoniae. Jundishapur J Microbiol. 2018;11(4):e61285. doi: https://doi.org/10.5812/jjm.61285

16
Sep
2019

High Frequency of qnr Genes in Urinary Isolates of Extended-Spectrum β-Lactamase (ESBL)-producing Klebsiella pneumoniae in Tehran, Iran

Reza Abossedgh,
Maryam Ghane,
Laleh Babaeekhou

Abossedgh R, Ghane M, Babaeekhou L. High Frequency of qnr Genes in Urinary Isolates of Extended-Spectrum β-Lactamase (ESBL)-producing Klebsiella pneumoniae in Tehran, Iran. Shiraz E-Med J. 2019;21(3):e92032. doi: https://doi.org/10.5812/semj.92032

More by these authors

Mohammad BokaeianPubMedScholar
Saeide SaeidiPubMedScholar
Zahra ShahiPubMedScholar
Vahideh KadaeiPubMedScholar
Share
Cited by
Metrics