Logo

Analysis of CTLA-4 (+49A/G) Gene Polymorphism and the Risk of Tuberculosis in Southeast of Iran

Author(s):
Edris PaadEdris Paad1, Mohammad Kordi TamendaniMohammad Kordi TamendaniMohammad Kordi Tamendani ORCID1,*, Mohammad Hosain SangtarashMohammad Hosain Sangtarash1, Mansoor DehvariMansoor Dehvari1
1Department of Biology, University of Sistan and Baluchestan, Zahedan, IR Iran


Gene, Cell and Tissue:Vol. 1, issue 3; e23996
Published online:Oct 18, 2014
Article type:Research Article
Received:Aug 29, 2014
Accepted:Oct 09, 2014
How to Cite:Edris PaadMohammad Kordi TamendaniMohammad Hosain SangtarashMansoor DehvariAnalysis of CTLA-4 (+49A/G) Gene Polymorphism and the Risk of Tuberculosis in Southeast of Iran.Gene Cell Tissue.2014;1(3):e23996.https://doi.org/10.17795/gct-23996.

Abstract

Background:

Tuberculosis (TB) is an acute or chronic bacterial infection caused by Mycobacterium tuberculosis. It primarily affects the lungs, but may spread to other organs (extra-pulmonary TB).

Objectives:

Studies have shown that genetic predisposition can decrease the persistence and growth of M. tuberculosis. The current study highlights the effect of CTLA-4 (+49A/G) gene polymorphism on the risk of TB.

Patients and Methods:

This case-controlled study used tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) to analyze theCTLA-4 (+49A/G) gene polymorphism in 100 patients with TB and 91 healthy individuals.

Results:

Data analysis indicated that the frequencies of AA, AG and GG genotypes were 42%, 38%, and 20% in patients with TB and 43%, 47%, 1% in the control subjects, respectively. The GG genotype of CTLA-4 (+49A/G) showed a significantly increased risk of disease (OR = 20.48; 2.63-159.60)

Conclusions:

The results revealed a significant relationship between the GG genotype of CTLA-4 and the increased risk of TB.

1. Background

Nearly one-third of the world’s population (two billion people) is infected with Mycobacterium tuberculosis and is at risk of developing tuberculosis (TB). Every year, about nine million people get infected with active TB and approximately 1.5 million people die of this disease (1). More than 90% of the infections and deaths arising from TB occur in developing countries and 75% occur in the most economically-active age group (15-54 years old). In such regions, an adult infected with TB misses an average of 3-4 months of work each year, which accounts for a 20-30% loss of annual revenue (2).It is clear that TB, besides economic loss, has indirect negative effects on the quality of life of patients and their families. These include infected women being shunned by their families or expulsion from or dropping out of school of a patient's children. Concurrent infection by HIV and environmental factors can decrease the activity of immune T cells significantly and increase the risk of infection by TB. Countries with a high incidence of HIV, especially in southern Africa, have experienced a dramatic increase in the number of TB patients. The rates of reported patients with TB raised two to three folds over those recorded in the 1990's (2, 3). Genetic variation contributes to the risk of TB and polymorphism of different genes can increase the risk of infection by active TB (4). Macrophages are the primary host cells for proliferation of intracellular mycobacteria. They are responsible for killing internalized bacilli by reacting with nitrogen and oxygen intermediates (ROI, RNI) and lysosomal destructive enzymes (5). The entry of M. tuberculosis into the body induces activation of cellular immune mechanisms which play important roles in the mechanism of T cells. TH1 cells induce macrophage activation and phagocytosis reactions. These cells mediate the acquired immune response against live phagocytic microbes in phagosomes of macrophages. They recognize microbial antigens and activate phagocytes to destroy the ingested microbes. Activated macrophages kill the microbes that exist inside the vesicle most effectively. Microbes that directly enter the cytoplasm (e.g. viruses) or are released from phagosomes into the cytoplasm, however, are relatively resistant. Eradication of these pathogens requires secondary administrative cellular immune mechanisms such as cytolytic T lymphocytes (CTL) (6).CTL-associated antigen 4 (CTLA-4) is a CD28 receptor that inhibits T cell proliferation through combination with B7 molecules (7). The human CTLA-4 gene is located on chromosome 2q33 and the single-nucleotide polymorphism (SNP) +49A/G (rs231775) is located in the first exon of CTLA-4. A +49A/G base substitution can cause a change from threonine to alanine amino acid in the coding region of CTLA-4 (8). The CTLA-4 +6230 (rs3087243) and CTLA4 +49 SNPs have shown strong linkage disequilibrium, which have resulted in excellent combinations for haplotype analysis (9, 10). Previous studies have demonstrated that the +49 SNP of CTLA-4 played a role in the development of Graves’ disease (11), systemic lupus erythematous (12) and other autoimmune diseases. CTLA-4 +6230 SNP is associated with susceptibility to hepatitis B (13) and inflammatory bowel disease (14). Thye et al. (15) found that the CTLA-4 +6230G allele contributed to the pathology of TB in the African population. Reif et al. found an association between genetic changes and extra-pulmonary TB (16).

2. Objectives

The present study investigated a possible correlation between CTLA-4 gene polymorphism and the risk of TB in a sample of the Iranian population.

3. Patients and Methods

3.1. Sample Collection

Subjects diagnosed with TB and healthy controls were selected from Chabahar Health Center, Iran. After the subjects signed written informed consent forms, 5 mL of blood was taken from each individual in an EDTA K2 tube. The subjects with TB were selected from those who had had a confirmed diagnosis by a healthcare professional and who presented clinical symptoms, radiological evidence and positive sputum acid-fast bacillus (AFB) smears. The control subjects had no previous history of TB, autoimmune disease, diabetes, or any inflammatory or respiratory disorder. A total of 191 blood samples were collected (106 subjects with TB and 95 healthy controls). DNA extraction was accomplished using an IQ2000 kit according to the manufacturer’s instructions. After estimation of the quality of DNA by spectrophotometer, the tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method was used to analyze the genotyping of CTLA4 (+49A/G) with the primers given in Table 1. The PCR conditions for the amplification of CTLA-4 were as follows: initial phase comprised 10 minutes at 95°C; next 40 cycles (30 seconds at 94°C, 30 seconds at 62°C, and 30 seconds at 72°C); then, seven minutes at 72°C. The samples were stored at 4°C until electrophoresis.

Table 1.Tetra-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction Primer Sequences
PrimersPrimer Sequence(5→3)Length, bp
Outer primer
ForwardGTGGGTTCAAACACATTTCAAAGCTTCAGG229
ReverseTCCATCTTCATGCTCCAAAAGTCTCACTC229
Inner primer
Forward, A alleleACAGGAGAGTGCAGGGCCAGGTCCTAGT162
Reverse, G alleleGCACAAGGCTCAGCTGAACCTGGATG120

Tetra-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction Primer Sequences

3.2. Statistical Analysis

SPSS version 19.0 (SPSS, Chicago) was used for all the statistical analyses. These included categorical data (Pearson’s χ2), adjustment of P values with variables using the binary logistic regression test for estimation of thee odds ratios (OR), 95% confidence intervals, and the relationship between CTLA-4 gene polymorphism and the risk of TB. The significance level was set at P ≤ 0.05 for all the tests.

4. Results

From a total of 100 patients with TB, 68 (35.6%) had positive smears and 15 (7.9%) had negative smears for pulmonary TB. An additional 9 (4.7%) had extra-pulmonary TB and 8 (4.2%) showed recurrent disease after the treatment. The AA genotype +49A/G was found in 42 (42%) subjects with TB as well as in 43 (47.3%) controls subjects. The AG genotype was observed in 38 (38%) subjects with TB and 47 (51.6%) control subjects. The GG genotype was observed in 20 (20%) patients with TB and 1 (1.1%) control subject.

The A allele frequency was 122 (61.4%) in subjects with TB and 133 (73.08%) in control subjects. Allele frequency for the G allele was 78 (38.6%) in subjects with TB and 49 (26.92%) in control subjects (Table 2).

Table 2. Genotypes and Alleles Frequency of CTLA4 Gene +49A/G Polymorphism in Patients With TB and the Control Group a, b
GenotypeCasesControlsOR (95%CI)P Value
AA42 (42)43 (47.3)1.00-
AG38 (38)47 (51.6)0.83 (0.45-1.51)0.645
GG20 (20)1 (1.1)20.48 (2.63-159.60)0.0001
AG + GG58 (58)48 (52.7)1.24 (0.69-2.19)0.471
Allele
C122 (61)133 (73.1)1.00-
G78 (39)49 (26.9)1.74 (1.13-2.68)0.013

Genotypes and Alleles Frequency of CTLA4 Gene +49A/G Polymorphism in Patients With TB and the Control Group a, b

5. Discussion

World Health Organization statistics has emphasized that in many parts of the world, females are more frequently diagnosed with TB than males and more frequently die from the disease. This disease is a major cause of death by causing infectious diseases in females and primarily affects females in their economically-active reproductive ages (17).The polymorphism in the promoter region of the CTLA-4 gene may play a role in expression of the CTLA-4 receptor in T cells. It can activate this receptor as a regulatory key to suppress the immune response induced, to inhibit transmission to T cells and interaction of these cells with antigen-acceptor cells. The result is the inability of the immune system to form an appropriate response to the pathogen to facilitate the disease progression. Zuh et al. demonstrated a significant association between theCTLA-4 gene polymorphism and the risk of chronic bronchitis (18). Motsinger et al. found a significant correlation between theCTLA-4 gene polymorphism and Graves’ disease. Studies have reported a significant link between theCTLA-4 gene polymorphism and inflammatory bowel disease, ulcerative colitis and Crohn's disease (16). The sparseness of data on the CTLA-4 gene variation and TB allowed only limited comparison of the data with that from previous studies. The data showed a significant link between the GG genotype of CTLA-4 and the increased risk of TB in this sample of the Iranian population.

Sample 1,229 bp; 2,162 bp; 4, 120 bp.
Figure 1.

Sample 1,229 bp; 2,162 bp; 4, 120 bp.

Acknowledgments

Footnotes

References

  • 1.
    Sandhu GK. Tuberculosis: current situation, challenges and overview of its control programs in India. J Glob Infect Dis. 2011;3(2):143-50. [PubMed ID: 21731301]. https://doi.org/10.4103/0974-777X.81691.
  • 2.
    Joshi JM. Tuberculosis chemotherapy in the 21 century: Back to the basics. Lung India. 2011;28(3):193-200. [PubMed ID: 21886955]. https://doi.org/10.4103/0970-2113.83977.
  • 3.
    Mihret A. The role of dendritic cells in Mycobacterium tuberculosis infection. Virulence. 2012;3(7):654-9. [PubMed ID: 23154283]. https://doi.org/10.4161/viru.22586.
  • 4.
    Bellamy R. Susceptibility to mycobacterial infections: the importance of host genetics. Genes Immun. 2003;4(1):4-11. [PubMed ID: 12595896]. https://doi.org/10.1038/sj.gene.6363915.
  • 5.
    Schaible UE, Collins HL, Kaufmann SH. Confrontation between intracellular bacteria and the immune system. Adv Immunol. 1999;71:267-377. [PubMed ID: 9917916].
  • 6.
    Abbas AK, Lichtman AH. Basic Immunology: Functions and Disorders of the Immune System. Saunders; 2004.
  • 7.
    Anderson DE, Sharpe AH, Hafler DA. The B7-CD28/CTLA-4 costimulatory pathways in autoimmune disease of the central nervous system. Curr Opin Immunol. 1999;11(6):677-83. [PubMed ID: 10631554].
  • 8.
    Harper K, Balzano C, Rouvier E, Mattei MG, Luciani MF, Golstein P. CTLA-4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location. J Immunol. 1991;147(3):1037-44. [PubMed ID: 1713603].
  • 9.
    Munthe-Kaas MC, Carlsen KH, Helms PJ, Gerritsen J, Whyte M, Feijen M, et al. CTLA-4 polymorphisms in allergy and asthma and the TH1/ TH2 paradigm. J Allergy Clin Immunol. 2004;114(2):280-7. [PubMed ID: 15316504]. https://doi.org/10.1016/j.jaci.2004.03.050.
  • 10.
    Amundsen SS, Naluai AT, Ascher H, Ek J, Gudjonsdottir AH, Wahlstrom J, et al. Genetic analysis of the CD28/CTLA4/ICOS (CELIAC3) region in coeliac disease. Tissue Antigens. 2004;64(5):593-9. [PubMed ID: 15496203]. https://doi.org/10.1111/j.1399-0039.2004.00312.x.
  • 11.
    Kouki T, Sawai Y, Gardine CA, Fisfalen ME, Alegre ML, DeGroot LJ. CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves' disease. J Immunol. 2000;165(11):6606-11. [PubMed ID: 11086105].
  • 12.
    Ulker M, Yazisiz V, Sallakci N, Avci AB, Sanlioglu S, Yegin O, et al. CTLA-4 gene polymorphism of exon 1(+49 A/G) in Turkish systemic lupus erythematosus patients. Int J Immunogenet. 2009;36(4):245-50. [PubMed ID: 19602000]. https://doi.org/10.1111/j.1744-313X.2009.00856.x.
  • 13.
    Thio CL, Mosbruger TL, Kaslow RA, Karp CL, Strathdee SA, Vlahov D, et al. Cytotoxic T-lymphocyte antigen 4 gene and recovery from hepatitis B virus infection. J Virol. 2004;78(20):11258-62. [PubMed ID: 15452244]. https://doi.org/10.1128/JVI.78.20.11258-11262.2004.
  • 14.
    Repnik K, Potocnik U. CTLA4 CT60 single-nucleotide polymorphism is associated with Slovenian inflammatory bowel disease patients and regulates expression of CTLA4 isoforms. DNA Cell Biol. 2010;29(10):603-10. [PubMed ID: 20491567]. https://doi.org/10.1089/dna.2010.1021.
  • 15.
    Thye T, Scarisbrick G, Browne EN, Chinbuah MA, Gyapong J, Osei I, et al. CTLA4 autoimmunity-associated genotype contributes to severe pulmonary tuberculosis in an African population. PLoS One. 2009;4(7). ee6307. [PubMed ID: 19609446]. https://doi.org/10.1371/journal.pone.0006307.
  • 16.
    Motsinger-Reif AA, Antas PR, Oki NO, Levy S, Holland SM, Sterling TR. Polymorphisms in IL-1beta, vitamin D receptor Fok1, and Toll-like receptor 2 are associated with extrapulmonary tuberculosis. BMC Med Genet. 2010;11:37. [PubMed ID: 20196868]. https://doi.org/10.1186/1471-2350-11-37.
  • 17.
    Global Tuberculosis Control: Surveillance, Planning, Financin WHO Report 2008. 2008.
  • 18.
    Zhu G, Agusti A, Gulsvik A, Bakke P, Coxson H, Lomas DA, et al. CTLA4 gene polymorphisms are associated with chronic bronchitis. Eur Respir J. 2009;34(3):598-604. [PubMed ID: 19386687]. https://doi.org/10.1183/09031936.00141808.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles