Abstract
Background:
Breast cancer is the most frequent cause of death in cancer for woman. Numerous SNPs linked to breast cancer have been identified in genome-wide association studies (GWAS). They have revealed novel genetic markers for breast cancer susceptibility. There has not been any work on molecular events and breast cancer risk factors in Iran. Large-scale association studies have identified that rs2363956 from ANKLE1 (ankyrin repeat and LEM domain containing 1 gene) and rs3803662 of CASC16 (cancer susceptibility 16) genes associated with the risk of breast cancer are found to be the main markers in breast cancer. We would like to explore the association of 2 SNPs rs2363956 and rs3803662 regarding the risk of breast cancer in Iranian women.Methods:
First, we evaluated 126 breast cancer and 160 control women with peripheral blood for the DNA extracted using the genotyping Tetra-Primer ARMS –PCR technique also Immunohistochemical test of HER2- , HER2+, ER-, ER+, PR- , and PR+ upon breast tumor tissue patients.Results:
In the current study, ANKLE1 (rs2363956) GG polymorphisms were found to have been significantly associated with breast cancer (26.190, frequency, Odd Ratio; 0.313, CI; 0.166-0.593, P value; 0.00025***).Conclusions:
However, it has been shown that there exists significant association between the low allele in ANKLE1 (rs2363956) GT to ER and PR negative tumor by the Immunohistochemi- pathology method.Keywords
ANKLE1 (rs2363956) CASC16 (rs3803662) Triple Marker Tumor Breast Cancer
1. Background
Breast Cancer is a multifactorial disease; it is a complex combination of genetics with intrinsic factors (host genetic) and extrinsic factors (environmental factors).
For breast cancer, the list of environmental risk factors includes an individual’s development, exposure to microbes, therapeutic involvement, toxicants, body fat, smoking and alcohol intake, and occupational exposures, including shift work as well as metabolic and physiologic processes, that may modify the body’s internal environment.
The most intrinsic cases of breast cancer are associated with 2 abnormal genes, BRCA1 and BRCA2.
Genome-wide association studies (GWAS) have identified many loci associated with breast cancer risk as rs2363956 and rs3803662 are associated with ER-positive breast cancer
GWAS identified genome-wide association with breast cancer risks in European, (1, 2) African, (3, 4), and American populations (5-7).
Recently, genome-wide association studies (GWAS) have come to know that more than 80 loci are associated with breast cancer. Individually, these variants define only 16% of breast cancer heritability (7).
This is important that they find a ratio of the genetic risk factors in GWAS, including limitations of genotype variation.
In the past, breast cancer rapidly increased around the world and indicated that genetic factors are responsible for 27% of the total breast cancer risk (8).
The international agency for research on cancer (IARC) published, in 2012, that there were 1.68 million breast cancer patients (9).
Therefore, it is interesting to note that SNPs are the main factor in the development of cancers (10, 11).
Breast cancer is associated with low penetrant risk, quite similar to FGFR2, MAP3K1, LSP1… (12), however, only 5% of mutations induce cancer (13).
Therefore, it seems important to evaluate the association between low penetrant and breast cancer risk.
We studied the association between polymorphism and breast cancer while assaying 3 markers, namely estrogen receptor, progesterone receptor, and human epidermal growth factor receptor-2.
2. Methods
2.1. Patients and Controls
The study population consisted of 160 controls and 126 women patients with histologically diagnosed Grade-4 carcinoma breast cancer.
They were enrolled in the study from the Khas medical center, Hazrat Rasoul medical complex, Tehran, Iran was considered for our study that included women aged 30 - 55 years.
Histochemopathological were carried out by experiences Lab. The patients and healthy females were from different areas in Iran. This study was ethically approved by the local ethical committee of Islamic Azad University from the point of view of patients’ and also control group samples’ rights.
2.2. Genotyping
Genomic DNA was obtained from peripheral blood leucocytes by salting out method or using the FelxiGene DNA extraction kit (Qiagen, Germany).
DNA samples were genotyped for the 2 SNPs: rs2363956 from 19p13.1 locus, gene ANKLE1 (ankyrin repeat and LEM domain containing 1), and rs3803662 of CASC16 (cancer susceptibility 16) (Table 1). SNPs were selected based on the highest association in GWAS studies (14, 15).
Internal Primers and External by Tetra-Primer ARMS –PCR Technique
| Primers | Size, bp | ||
|---|---|---|---|
| CASC16 (rs3803662) | |||
| F- inner | CCTTAATGCCTCTATAGCTGGCT | T | 184 |
| R- inner | CACAGTTTTATTCTTCGCTACGG | C | 126 |
| F- outer | AACTATGAGAGATATCTATGTGCAATGGT | 264 | |
| R- outer | GTTTATACAGGAGTGAAAATCAGGAAGT | ||
| ANKLE1 (rs2363956) | |||
| F- inner | TGCAGAGGTGACAACAGGGACATTGGTTT | T | 247 |
| R- inner | GGGGGTCCTGGGTCAGCCTTCC | G | 167 |
| F- outer | TCATCGCTGTCTCATCCCTCCTCCTCTC | 364 | |
| R- outer | CATGGACAACATGCAGAAGTCCCTGCCT |
Genotyping of the SNPs, primer sequences, and cycling conditions [rs2363956: 94°C, 30 seconds; 37°C, and for rs3803662: 35°C, 30 seconds; 72°C, 60 seconds [35 cycles] for analyses were performed by PCR, followed by appropriate Tetra-Primer ARMS –PCR digestion according to the Primer3, Gene runner (Table 2).
Gene Genotype Frequencies for Cases and Controla
| SNP/Genotype | Cases, (n = 126) | Controls (n = 160) |
|---|---|---|
| CASC16 (rs3803662) | ||
| CC | 48 (38.09) | 48 (30.00) |
| TC | 54 (42.85) | 60 (37.5) |
| TT | 24 (19.04) | 52 (32.5) |
| ANKLE1 (rs2363956) | ||
| TT | 33 (26.19) | 24 (15.00) |
| GT | 60 (47.61) | 116 (72.5) |
| GG | 33 (26.190) | 20 (12.5) |
2.3. Statistical Analysis
The Hardy-Weinberg equilibrium (HWE) was evaluated by Chi-squared (χ2) statistics. The data was tested for association with breast cancer.
The distinction in the allele and genotype frequencies between cancer patients and healthy persons is determined using standard χ2. The odds ratio (OR) and the associated 95% confidence intervals (95%CI) were also calculated.
The SNPs were assessed under recessive and dominant inheritance models.
3. Results
The present study explores the association of CASC16 (rs3803662) and ANKLE1 (rs2363956) with breast cancer risk, due to the fact that it was for first time of our population.
We considered these genotypes and 3 hormone markers relating to the risk factors of breast cancer (Tables 3 and 4 and Figure 1).
Comparison Between Genotypes, Odds Ratio and P Value
Test Histochemical Upon Triple HER2- , HER2+, ER-, ER+, PR- and PR+ Tumor
| ER+ | ER- | PR+ | PR- | HER2+ | HER2- | |
|---|---|---|---|---|---|---|
| CASC16 (rs3803662) | ||||||
| CC | 16 | 2 | 16 | 2 | 10 | 10 |
| TC | 25 | 5 | 25 | 5 | 10 | 20 |
| TT | 5 | 3 | 5 | 3 | 3 | 5 |
| ANKLE1 (rs2363956) | ||||||
| TT | 24 | 3 | 24 | 3 | 8 | 19 |
| GT | 8 | 8 | 8 | 8 | 8 | 8 |
| GG | 19 | 0 | 19 | 0 | 7 | 12 |
Column Chart genotypes frequencies [n (%)] for cases and control: Analyses of 126 affected women and 160 controls.
![Column Chart genotypes frequencies [n (%)] for cases and control: Analyses of 126 affected women and 160 controls.](http://services.brieflands.com/cdn/serve/3144d/bc65f651414c57d172cd28c0be57197524e21d00/gct-In_Press-In_Press-63407-i001-preview.png "Column Chart genotypes frequencies [n (%)] for cases and control: Analyses of 126 affected women and 160 controls.")
In the current study, ANKLE1 (rs2363956) GG and then TT polymorphisms were significantly associated with breast cancer (26.190, frequency, odd ratio; 0.313, CI; 0.166 - 0.593, P value; 0.00025***) and; ( 26.19, frequency, odd ratio; 0.376, CI; 0.204 - 0.693, P value; 0.00143***) respectively and compared to CASC16 (rs3803662) TC; Frequency; 42.85; OR; 0.462, CL; 0.246 - 0.865, Chi2; 5.91, P value; 0.01502**.
On the other hand, it has been shown that there is a significant association between low allele in ANKLE1 (rs2363956) GT and CASC16 (rs3803662) TT with ER- and PR- negative tumors through immunohistochemistry pathology (Table 4 and Figure 2)
Column Chart Test Immunohistochemically Tumor; genotypes were highest positive in, HER2+, ER+ and PR+ tumor.
That of course, in the strongest level of PR, ER were equal in every group. The 2nd strongest in 3 groups, include ANKLE1 (rs2363956) TT and CASC16 (rs3803662) TC, level of Her2 negative were increased to compare Her2 positive.
It may be significant polymorphisms of SNPs variants to low risk. (Table 4 and Figure 2)
In addition, we observed strongly, ANKLE1 (rs2363956) TT and GG association with ER-positive, even equally to PR-positive tumors. It means that amount of number ER Positive = PR positive in all genotype that include; ANKLE1 (rs2363956) GG, GT, and TT similarity CASC16 (rs3803662), CC, TC, and TT.
Next, we show an increase in Her2-negative compared to Her2-positive in rs2363956 TT, rs2363956 GG, and rs3803662 TC SNPs.
We also observed an equal number in all negative- and positive-marker tumors in ANKLE1 (rs2363956) GG (it means of, ER+ =ER- =PR+ = PR- = Her2+ = Her2-).
4. Discussion
Recent GWAS have cleared several of SNPs in novel independent loci to markers of breast cancer (1, 16).
The present study aims to discover whether 2 SNPs could be associated with tumor subtypes or not. We hypothesized that genetics vary differently in each ethnic population. Recent studies have identified the association of rs3803662 with the risk of breast cancer in Swedish, Russian, Chilean, Chinese Han, and Caucasian populations including data: 3.76 (95%CI 1.02 - 13.84, P = 0.046) (10), (95% CI, 1.52 (1.30 - 1.77) (17), 3.76 (95%CI 1.02 - 13.84, P = 0.046) (18). 1.25 (95% CI, 1.00 - 2.51) (19), 2.04 (95 % CI, 1.14 - 3.66, P = 0.017) (20), 1.53 (95% CI ,1.08, 2.15, P = 0.004) (21), 0.83, (95% CI ,0.75 - 0.92, P = 0.0003) (22). An association between rs2363956 and breast and ovarian cancer was found by Antoniou, in 2010, with estrogen receptor-negative breast cancer 0.83, 95% CI 0.75 - 0.92, P = 0.0003) and an association with estrogen receptor-positive (1.07, 95% CI 1.01 - 1.14, P = 0.016) (15, 23).
Importantly, the numbers of triple, double, and mono negative basal patients may increase, and there may be an association between ER-negative, ER-positive, and triple-negative (23), 1.17 (95% CI, 1.09 - 1.26; P = 3.66 × 10-5 (24), as well as rs3803662 to positive estrogen receptor tumors disease (25).
Yang XR and Millikan RC, upon the United States, African-American, and Latina stated that triple-negative breast cancer woman are younger, have an early age menarche, higher body mass, and lose breast feeding.
In the current study, ANKLE1 (rs2363956) GG and then TT polymorphisms were significantly associated with breast cancer (26.190, frequency, Odd Ratio; 0.313, CI; 0.166 - 0.593, P value; 0.00025***).
In addition, it has been shown that a significant association in low allele in ANKLE1 (rs2363956) GT and then CASC16 (rs3803662) TT to ER and PR negative tumor by Immunohistochemi- pathology.
That of course, in strong level of PR, ER was equal in every group. The 2nd strongest in the 3 groups include ANKLE1 TT and CASC16 TC, level of Her2 negative were increased to compared Her2 positive.
In conclusion, the genetic and functional mechanism of negative marker breast cancer in some SNPs will be studied.
Now, we report that there is no association between this SNPS and the triple negative marker, however, there is some significant association between positive estrogen and progesterone tumor markers.
Acknowledgements
References
-
1.
Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, et al. Genome-wide association study identifies novel breast cancer susceptibility loci. Nature. 2007;447(7148):1087-93. [PubMed ID: 17529967]. https://doi.org/10.1038/nature05887.
-
2.
Stacey SN, Manolescu A, Sulem P, Thorlacius S, Gudjonsson SA, Jonsson GF, et al. Common variants on chromosome 5p12 confer susceptibility to estrogen receptor-positive breast cancer. Nat Genet. 2008;40(6):703-6. [PubMed ID: 18438407]. https://doi.org/10.1038/ng.131.
-
3.
Silva Idos S, De Stavola B, McCormack V, Collaborative Group on Pre-Natal Risk F, Subsequent Risk of Breast C. Birth size and breast cancer risk: re-analysis of individual participant data from 32 studies. PLoS Med. 2008;5(9). e193. [PubMed ID: 18828667]. https://doi.org/10.1371/journal.pmed.0050193.
-
4.
Pabalan N, Jarjanazi H, Sung L, Li H, Ozcelik H. Menopausal status modifies breast cancer risk associated with the myeloperoxidase (MPO) G463A polymorphism in Caucasian women: a meta-analysis. PLoS One. 2012;7(3). e32389. [PubMed ID: 22427832]. https://doi.org/10.1371/journal.pone.0032389.
-
5.
Hunter DJ, Kraft P, Jacobs KB, Cox DG, Yeager M, Hankinson SE, et al. A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nat Genet. 2007;39(7):870-4. [PubMed ID: 17529973]. https://doi.org/10.1038/ng2075.
-
6.
Haiman CA, Patterson N, Freedman ML, Myers SR, Pike MC, Waliszewska A, et al. Multiple regions within 8q24 independently affect risk for prostate cancer. Nat Genet. 2007;39(5):638-44. [PubMed ID: 17401364]. https://doi.org/10.1038/ng2015.
-
7.
Tamimi RM, Lagiou P, Czene K, Liu J, Ekbom A, Hsieh CC, et al. Birth weight, breast cancer susceptibility loci, and breast cancer risk. Cancer Causes Control. 2010;21(5):689-96. [PubMed ID: 20054709]. https://doi.org/10.1007/s10552-009-9496-7.
-
8.
Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M, et al. Environmental and heritable factors in the causation of cancer--analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med. 2000;343(2):78-85. [PubMed ID: 10891514]. https://doi.org/10.1056/NEJM200007133430201.
-
9.
Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136(5):E359-86. [PubMed ID: 25220842]. https://doi.org/10.1002/ijc.29210.
-
10.
Han W, Woo JH, Yu JH, Lee MJ, Moon HG, Kang D, et al. Common genetic variants associated with breast cancer in Korean women and differential susceptibility according to intrinsic subtype. Cancer Epidemiol Biomarkers Prev. 2011;20(5):793-8. [PubMed ID: 21415360]. https://doi.org/10.1158/1055-9965.EPI-10-1282.
-
11.
Xiang Z, Xu M, Liao M, Jiang Y, Jiang Q, Feng R, et al. Integrating Genome-Wide Association Study and Brain Expression Data Highlights Cell Adhesion Molecules and Purine Metabolism in Alzheimer's Disease. Mol Neurobiol. 2015;52(1):514-21. [PubMed ID: 25204495]. https://doi.org/10.1007/s12035-014-8884-5.
-
12.
Harlid S, Ivarsson MI, Butt S, Grzybowska E, Eyfjord JE, Lenner P, et al. Combined effect of low-penetrant SNPs on breast cancer risk. Br J Cancer. 2012;106(2):389-96. [PubMed ID: 22045194]. https://doi.org/10.1038/bjc.2011.461.
-
13.
Chen YC, Hunter DJ. Molecular epidemiology of cancer. CA Cancer J Clin. 2005;55(1):45-54. quiz 57. [PubMed ID: 15661686].
-
14.
Song H, Ramus SJ, Tyrer J, Bolton KL, Gentry-Maharaj A, Wozniak E, et al. A genome-wide association study identifies a new ovarian cancer susceptibility locus on 9p22.2. Nat Genet. 2009;41(9):996-1000. [PubMed ID: 19648919]. https://doi.org/10.1038/ng.424.
-
15.
Bolton KL, Tyrer J, Song H, Ramus SJ, Notaridou M, Jones C, et al. Common variants at 19p13 are associated with susceptibility to ovarian cancer. Nat Genet. 2010;42(10):880-4. [PubMed ID: 20852633]. https://doi.org/10.1038/ng.666.
-
16.
Liang J, Chen P, Hu Z, Shen H, Wang F, Chen L, et al. Genetic variants in trinucleotide repeat-containing 9 (TNRC9) are associated with risk of estrogen receptor positive breast cancer in a Chinese population. Breast Cancer Res Treat. 2010;124(1):237-41. [PubMed ID: 20213080]. https://doi.org/10.1007/s10549-010-0809-z.
-
17.
Mizoo T, Taira N, Nishiyama K, Nogami T, Iwamoto T, Motoki T, et al. Effects of lifestyle and single nucleotide polymorphisms on breast cancer risk: a case-control study in Japanese women. BMC Cancer. 2013;13:565. [PubMed ID: 24289300]. https://doi.org/10.1186/1471-2407-13-565.
-
18.
Elematore I, Gonzalez-Hormazabal P, Reyes JM, Blanco R, Bravo T, Peralta O, et al. Association of genetic variants at TOX3, 2q35 and 8q24 with the risk of familial and early-onset breast cancer in a South-American population. Mol Biol Rep. 2014;41(6):3715-22. [PubMed ID: 24532140]. https://doi.org/10.1007/s11033-014-3236-0.
-
19.
Gorodnova TV, Kuligina E, Yanus GA, Katanugina AS, Abysheva SN, Togo AV, et al. Distribution of FGFR2, TNRC9, MAP3K1, LSP1, and 8q24 alleles in genetically enriched breast cancer patients versus elderly tumor-free women. Cancer Genet Cytogenet. 2010;199(1):69-72. [PubMed ID: 20417875]. https://doi.org/10.1016/j.cancergencyto.2010.01.020.
-
20.
Mellemkjaer L, Olsen ML, Sorensen HT, Thulstrup AM, Olsen J, Olsen JH. Birth weight and risk of early-onset breast cancer (Denmark). Cancer Causes Control. 2003;14(1):61-4. [PubMed ID: 12708726].
-
21.
He Y. Relationship between five GWAS-identified single nucleotide polymorphisms and female breast cancer in the Chinese Han population. Tumor Biol. 2016;37(7):9739-44.
-
22.
Slattery ML, Baumgartner KB, Giuliano AR, Byers T, Herrick JS, Wolff RK. Replication of five GWAS-identified loci and breast cancer risk among Hispanic and non-Hispanic white women living in the Southwestern United States. Breast Cancer Res Treat. 2011;129(2):531-9. [PubMed ID: 21475998]. https://doi.org/10.1007/s10549-011-1498-y.
-
23.
Antoniou AC, Wang X, Fredericksen ZS, McGuffog L, Tarrell R, Sinilnikova OM, et al. A locus on 19p13 modifies risk of breast cancer in BRCA1 mutation carriers and is associated with hormone receptor-negative breast cancer in the general population. Nat Genet. 2010;42(10):885-92. [PubMed ID: 20852631]. https://doi.org/10.1038/ng.669.
-
24.
Stevens KN, Vachon CM, Lee AM, Slager S, Lesnick T, Olswold C, et al. Common breast cancer susceptibility loci are associated with triple-negative breast cancer. Cancer Res. 2011;71(19):6240-9. [PubMed ID: 21844186]. https://doi.org/10.1158/0008-5472.CAN-11-1266.
-
25.
Stacey SN, Manolescu A, Sulem P, Rafnar T, Gudmundsson J, Gudjonsson SA, et al. Common variants on chromosomes 2q35 and 16q12 confer susceptibility to estrogen receptor-positive breast cancer. Nat Genet. 2007;39(7):865-9. [PubMed ID: 17529974]. https://doi.org/10.1038/ng2064.