https://doi.org/10.5812/gct.84392

Evaluation of Additional ABCC12 Gene Expression Character in Breast Cancer Samples Using Formal Diagnostic Profile

authors:

avatar Maryam Esmaeili ORCID 1 , avatar Sina Mirzaahmadi ORCID 1 , * , avatar Golnaz Asaadi Tehrani 1

Department of Genetic, Islamic Azad University, Zanjan Branch, Zanjan, Iran
Gene, Cell and Tissue: Vol.5, issue 4; e84392
published online: January 13, 2019
article type: Research Article
received: September 18, 2018
revised: December 27, 2018
accepted: January 8, 2019

How To Cite Esmaeili M , Mirzaahmadi S , Asaadi Tehrani G . Evaluation of Additional ABCC12 Gene Expression Character in Breast Cancer Samples Using Formal Diagnostic Profile. Gene Cell Tissue. 2018;5(4):e84392. https://doi.org/10.5812/gct.84392.

Abstract

Background:

Breast cancer (BC) is one of the most common cancers among women and is the main cause of cancer-related mortalities in the female population. The main cause of BC is not fully understood yet; however, many genes have been identified as risk factors that increase susceptibility to this disease.

Objectives:

The aim of this study was to evaluate the expression of ABCC12 gene in patients with ductal breast carcinoma and its relationship with other biomarkers including estrogen receptor (ER), progesterone receptor (RP) and human epidermal growth factor receptor 2 (HER-2).

Methods:

This study included nine women diagnosed with ductal breast carcinoma as cases and five healthy women as controls. RNA extraction from breast tissue and cDNA synthesis were performed, and the expression of ABCC12 gene was evaluated using the real time polymerase chain reaction (PCR) method. After preparing formalin-fixed paraffin-embedded breast tissues, immunohistochemical evaluation of these samples and chromogenic in situ hybridization (CISH) of ER, PR and HER-2 were performed.

Results:

The obtained results showed that the expression of ABCC12 gene in all the breast cancer tissues was 3.74 times higher than in controls (P = 0.007). Also, the expression of ABCC12 gene increased by 3.94 times in luminal B (P = 0.002), 3.54 times in HER-2 (1+) (P = 0.0006), 3.86 times in ER (+) (P = 0.002) and 3.63 times in PR (+) (P = 0.0005).

Conclusions:

Our study showed that the evaluation of the ABCC12 gene expression as a one of multi-drug resistance protein members can be used as a prognostic factor to identify the stages of BC and its therapeutic approaches.

1. Background

Breast cancer (BC) is one of the most common cancers and is the main cause of mortality from cancer among women worldwide (1). BC constitutes about 33% of malignancies among women (2). This malignancy is a multifactorial disease in which several genetic and environmental factors are involved. The role of genetic and heritable factors in BC has been proven. For example, BC risk in women with a mother or sister suffering from BC is four times higher than in other women. So far, the effects of various genes on BC, which can be referred to as oncogenes, have been studied (3). The product of oncogenes controls cellular growth through various mechanisms and is involved in cell transformation or induction of cancer (4).

Today, BC prognosis and diagnosis are performed through various variables such as histology, tumor size, lymph node, estrogen receptor (ER), progesterone receptor and overexpression of HER-2 (5, 6). Estrogen and progesterone play an important role in the growth and normal functioning of breast glands. Disrupting the function of these hormones also causes the development of BC. These hormones act through connecting to their receptors, which are known as ER and PR. These receptors function as signaling triggers and ligand-activated transcription factors (7).

BC is classified as ER+/PR+ when ER and PR proteins are overexpressed. ER+/PR+ tumors are very different in comparison to ER+/PR- in responding to hormone therapy (8). About 55% - 60% and 8% of women with ER+ and ER-BC respond to hormone therapy, respectively. Also, BC tumors with better differentiation are mostly ER+/PR+ and have better prognosis (9).

The human epidermal growth factor receptor 2 (HER-2) is one of the most important biomarkers and is currently used for the diagnosis and differentiation of different types of BCs. The overexpression of HER-2 is observed in approximately 15% of BCs (10). Studies showed that the overexpression of HER-2 is associated with resistance to treatment with endocrine agents in BC patients (11). In BC patients with HER-2 overexpression (HER-2+), chemotherapy and treatment with trastuzumab improve survival (12). The multi-drug resistance associated with protein 9 (MRP9) is a member of the superfamily of ATP-binding cassette (ABC) transporters and is encoded by ABCC12 gene in humans. Studies showed that MRP9 gene in mice is expressed in various tissues such as the ovaries, brain, breasts, prostate and testes (13, 14). In a study by Bera et al. it was shown that ABCC12 gene is an unusual truncated member of the ABC transporter superfamily and is highly expressed in BC (15). So far, there is no other study on the physiological role and involvement of ABCC12 gene in BC or other cancers.

2. Objectives

Therefore, the aim of this study was to investigate the expression of ABCC12 gene in patients with ductal breast carcinoma and its association with other biomarkers such as ER, PR and HER-2.

3. Methods

3.1. Study Subjects

In this study 14 women were recruited from hospitals of Zanjan city, Iran, during October to December 2017. Nine women with breast invasive ductal carcinoma (age range: 29 - 61 years) and the mean age of 45 years, who had not received any treatments such as chemotherapy or radiotherapy, were evaluated. BC was diagnosed in the subjects by clinical examination and gross pathology. Also, five healthy women (age matched) were selected as healthy controls. These subjects had presented for routine physical examination. BC tissue from patients and normal breast tissue from healthy controls (0.01 - 0.005 g) were taken by a surgeon using the core needle biopsy (CNB) method. A portion of the obtained samples was blocked by paraffin and another portion was kept in a nitrogen tank. All the studied women signed a consent form in accordance with the ethical standards of the institutional and/or national research committee and the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. The sample collection procedure was approved by the Ethics Committee of Islamic Azad University, Zanjan Branch (IR.IAU.Z.REC.1396,72).

3.2. Immunohistochemical (IHC) Procedure

The paraffin sections were cut at 1 - 2 µm thickness and kept in an incubator for 24 hours at 37°C. In order to remove paraffin from the tissues, the slides were placed in an oven at 60°C for 60 minutes. The slides were placed in a jar containing xylene for 7 minutes. Subsequently, the slides were placed in absolute alcohol (5 minutes), 85% alcohol (5 minutes), 70% alcohol (5 minutes) and phosphate buffered saline (PBS; 5 minutes), respectively. The slides were placed inside a target retrieval solution and transferred to a steamer for 15 minutes. The slides were then placed in dihydrogen dioxide at a concentration of 3.5% - 5% for 7 - 10 minutes. After washing, the slides were placed in the PBS solution with 7.2 - 7.4 pH. The surrounding tissue was marked with Dako marker, so that after the addition of the primary antibodies, the solution remained in the target area. Primary antibodies of ER (flex monoclonal mouse anti human estrogen receptor α; Dako), PR (rabbit monoclonal antibody, Diagnostic biosystem) and HER-2 (rabbit anti C-erbB2 monoclonal, diagnostic biosystem) were added to each of the slides and placed in the incubator at 37°C for 1 hour. After washing with IHC washing buffer, the slides were placed in PBS solution for 5 minutes. Then, secondary antibodies (envision detection systems/peroxidase/DAB; rabbit-mouse; diagnostic biosystem) were added to each of the slides and placed in the incubator at 37°C for 30 minutes, and after washing with IHC washing buffer, they were placed in PBS for 5 minutes. 3,3’-Diaminobenzidine (DAB) solution was added to the slides and washed with distilled water after 5 - 7 minutes. The slides were placed in a jar containing hematoxylin for 20 - 30 minutes and washed with distilled water. The slides were placed in 70% alcohol (5 minutes), 80% alcohol (5 minutes), 100% alcohol (5 minutes) and xylene (5 minutes), and then they were dried at room temperature. Finally, mounting glue was poured onto the slides, the cover slip was put in place, and then examined after drying.

3.3. HER-2 Gene Amplification by Chromogenic In Situ Hybridization (CISH)

The paraffin sections were cut at 0.2-μm thickness and placed on the prepared slides with a silane adhesive, and then the slides were placed in oven at 60°C for 20 - 24 hours. In order to remove paraffin, the slides were placed in 100% alcohol (5 minutes), 80% alcohol (5 minutes), 70% alcohol (5 minutes) and distilled water (10 minutes), respectively. The slides were placed in PT EDTA solution (95°C for 20 minutes) and then washed with Tris-buffered saline (TBS) and then dried. The pepsin solution (100 λ) was added on the slides and incubated at 37°C for 7 minutes and then washed with TBS-Tween 20. In order for dewatering, the slides were placed in 70% alcohol (3 minutes), 80% alcohol (3 minutes) and 100% alcohol (3 minutes), respectively. The HER-2/CEN17 probes (10 λ) were added to the slides. The slides were placed at 80°C for 5 minutes for denaturation and then placed at 37°C for 16 hours for hybridization. In order to separate the cover slip from the tissue, the slides were placed in post-hybridization wash buffer at room temperature for 5 minutes and then washed with post-hybridization wash buffer (75°C) and subsequently placed in TBS solution. The peroxidase blocking solution (10 λ) was added on the slides and then washed with TBS-Tween 20. The mix of secondary Ab (100 λ) was added on the slides and then washed with TBS-Tween 20. Also, the mix of polymers (100 λ) was added on the slides and then washed with TBS-Tween 20. In the following, red chromogen (100 λ) was added on the slides and incubated at room temperature for 10 minutes. Then, green chromogen (100 λ) was added on the slides and incubated at room temperature for 10 minutes. After washing the slides with distilled water, the hematoxylin solution was added on the slides for 30 seconds and then washed with distilled water. Finally, after dewatering, the slides were placed in xylene for 30 seconds and the cover slip was placed on it.

3.4. ABCC12 Gene Expression by Real Time PCR

RNA extraction was performed using the RNX kit (Sinagene, Iran) according to the manufacturer’s instructions. The concentration of the extracted RNA was determined using a spectrophotometer. cDNA was synthesized using cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer’s instructions. The expression rates of ABCC12 and GAPDH (housekeeping genes) were evaluated using specifically-designed primers (Table 1). Real Time polymerase chain reaction (PCR) reaction was performed using SYBR Green (Ampliqon, Denmark) in triplicate. PCR was performed using rotor-gene Q PCR system at 95°C for 15 minutes and 40 cycles at 95°C for 15 seconds, 60°C for 30 seconds and 72°C for 30 seconds. Also, electrophoresis was performed on agarose gel to ensure the correct PCR reaction. The comparison of ABCC12 expression between the cases and controls was performed using Rest software. t-test was used for the assessment of difference between the groups. P value less than 0.05 was considered statistically significant. Also, the obtained threshold cycles (TCs) from the cases and controls were compared using the 2-ΔΔCt and the Pfaffl method.

Table 1.

The Characteristics and Sequences of the Used Primers

GeneSequenceMelting Temperature, °CProduction Size, bp
ABCC121049
GAGGTGCTCAATATACTGTCAAGTGA56.4
GAAACTCATTCATTGTCTGAACTCGC56.4
GAPDH257
AGAAGGCTGGGGCTCATTTG53.8
AGGGGCCATCCACAGTCTTC55.9

4. Results

The results of ER and PR antigen assessment were considered as - and + (Figure 1). The obtained results from immunohistochemistry (IHC) analysis are presented in Table 2. Also, the HER-2 antigen was considered as 0 to 3+ based on the intensity of cancer cells nucleus staining (Figure 2). According to chromogenic in situ hybridization (CISH) analysis, two patients showed positive amplification for HER-2 antigen (Table 2 and Figure 3).

Table 2.

Characteristics of Molecular Breast Cancer Subtypes According to Estrogen Receptor, Progesterone Receptor and Human Epidermal Growth Factor Receptor 2

Patient NumberHER-2 AntigenPR AntigenER AntigenHER-2 AmplificationSubtype
1----Triple negative
23+--+HER-2 enrich
3--+-Luminal B
41+++-Luminal B
51+++-Luminal B
61+++-Luminal B
73++++Luminal B
81+++-Luminal B
9-++-Luminal A
An example of a positive (A, ER and C, PR) and negative (B, ER and D, PR) result from the assessment of estrogen receptor using immunohistochemistry
An example of a positive (A, ER and C, PR) and negative (B, ER and D, PR) result from the assessment of estrogen receptor using immunohistochemistry
Figure 1.

An example of a positive (A, ER and C, PR) and negative (B, ER and D, PR) result from the assessment of estrogen receptor using immunohistochemistry

An example of immunohistochemistry staining of breast cancer cells. 0 (A); 1+ (B); 2+ (C); 3+ (D).
An example of immunohistochemistry staining of breast cancer cells. 0 (A); 1+ (B); 2+ (C); 3+ (D).
Figure 2.

An example of immunohistochemistry staining of breast cancer cells. 0 (A); 1+ (B); 2+ (C); 3+ (D).

An example of a chromogenic in situ hybridization of normal (A and C) and human epidermal growth factor receptor 2-positive breast cancer (B and D) cells
An example of a chromogenic in situ hybridization of normal (A and C) and human epidermal growth factor receptor 2-positive breast cancer (B and D) cells
Figure 3.

An example of a chromogenic in situ hybridization of normal (A and C) and human epidermal growth factor receptor 2-positive breast cancer (B and D) cells

The obtained results from real time PCR showed that the expression of ABCC12 gene significantly increased in tumor tissues. The mean expression of this gene in patients was 3.74 times higher than in healthy controls (P = 0.007). The expression of ABCC12 gene was evaluated in luminal B subtype (patient numbers are 3 to 8). The results showed that the mean expression of ABCC12 gene in luminal B subtype was 3.94 times higher than in healthy controls (P = 0.002). The average expression of ABCC12 gene in HER-2 (+1) subtype (patient numbers are 4, 5, 6 and 8) was 3.54 times higher than in healthy controls (P = 0.0006). Also, the mean expression rates of ABCC gene in ER (+) (patient numbers are 3 to 9) and PR (+) (patient numbers are 4 to 9) subtypes were 3.86 (P = 0.002) and 3.63 (P = 0.0005) times higher than in healthy controls, respectively.

In the present study, HER-2 gene amplification was evaluated in patients over and under 45 years old. Of six patients aged over 45 years old, one patient showed HER-2 gene amplification. Of the three patients aged under 45 years old, one patient showed HER-2 gene amplification. Also, there was no difference in the expression of HER-2 gene between patients aged over and under 45 years old. The statistical analyses showed no significant relationship between amplification and expression of HER-2 gene and age of the patients (P > 0.05). However, by decreasing patients’ age, ER expression was significantly increased (P < 0.05).

5. Discussion

BCs are heterogeneous at morphologic, immunohistochemical and molecular levels. This heterogeneity persists even within apparently homogeneous groups of ER+ and ER- tumors. In the past few years, ER+ tumors have been subjected to multigene prognostic/predictive assays to identify more aggressive types of ER+ tumors that are expected to benefit from additional chemotherapy and define the risk of recurrence in an individual patient (16, 17).

The evaluation of ER, PR and HER-2 genes is very important to determine BC subtype and guide the therapeutic strategy of patients with BC (18). ABC proteins are known as the carriers of lipids, carbohydrates, amino acids, steroids and chemical compounds such as chemotherapy drugs and products derived from metabolism (19). Considering that the failure of chemotherapy is associated with increased expression of ABC proteins (20), it is possible to use better treatment methods and drugs in treating patients with BC by examining these proteins. Therefore, in this study we evaluated the association of ABCC12 gene expression with ER, PR and HER-2 biomarkers in patients with breast ductal carcinoma.

Our results showed that ABCC12 gene expression significantly increased (3.74 times) in patients with breast ductal carcinoma compared to healthy controls. Therefore, maybe increasing the expression of this gene can disrupt the treatment of patients and performance of the used drugs. In agreement with our study, Hlavac et al. showed that ABCC12 gene expression significantly increased in post-treatment breast tumors (21).

Kubelka-Sabit et al. evaluated HER-2 status in BC patients using CISH and IHC methods and showed HER-2 gene amplification in all 3+ patients, whereas 1+ patients did not show HER-2 gene amplification (22). Our findings are in agreement with this result. In a similar study by Musa et al. it was reported that HER-2 gene was amplified in 36.5% of +2 patients (23), whereas in our study there were no +2 patients.

Madrid and Lo demonstrated that HER-2 was amplified in all +3 patients and 45% of +2 patients. Also, in patients under 50 years of age, the amplification rate of HER-2 gene was higher than in patients over 50 years of age (24). However, our study showed no significant association between HER-2 gene amplification and age of patients. In a study, Anders et al. evaluated the expression of PR, ER and HER-2 genes in patients with BC (under 45 years old and over 65 years old). Their results showed a significant increase in tumor size, tumor grade, lymph node metastasis and HER-2 expression in subjects under 45 years of age, whereas ER expression was decreased significantly in this group (25). However, our study showed that the expression of ER increased significantly in patients under 45 years of age, but the expression of HER-2 remained unchanged and no significant association was found between age of patients and expression of this gene. The difference in sample size could explain the difference in results. Brase et al. and Paik et al. also showed continuous expression of HER-2 RNA according to IHC/FISH categories. It is notable that although a major overlap exists between the groups, the HER-2 IHC 1+ category shows significantly higher RNA levels than the IHC 0 category, suggesting that some biologic meaning is associated with the separation of these IHC staining groups, rather than being merely a staining artifact (26, 27).

In another study, Collins et al. showed that luminal B subtype frequency (35%) was higher than other subtypes in BC patients under 40 years of age and ER and PR expression significantly increased in these patients (28). Also, our study showed that the frequency of luminal B subtype was higher than others in patients under 45 years old and expression of ER was significantly increased.

Considering that the expression of ABCC12 gene was significantly increased in patients with breast ductal carcinoma, it can be stated that this increase disrupts patient treatment and the performance of used drugs. The expression of ABCC12 gene can be a useful prognostic factor to identify the stages of BC and its therapeutic approaches. Evaluation of ABCC12 gene expression character in BC patients with other diagnostic profiles was performed for the first time in this study in Iranian women. Although this study added to our understanding of BC, sample size in our study was not large enough; thus, further studies using a larger cohort of patients are recommended.

References

  • 1.

    O'Connell JB, Maggard MA, Ko CY. Colon cancer survival rates with the new American Joint Committee on Cancer sixth edition staging. J Natl Cancer Inst. 2004;96(19):1420-5. [PubMed ID: 15467030]. https://doi.org/10.1093/jnci/djh275.

  • 2.

    Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: Globocan 2008. Int J Cancer. 2010;127(12):2893-917. [PubMed ID: 21351269]. https://doi.org/10.1002/ijc.25516.

  • 3.

    Soheilyfar S, Velashjerdi Z, Sayed Hajizadeh Y, Fathi Maroufi N, Amini Z, Khorrami A, et al. In vivo and in vitro impact of miR-31 and miR-143 on the suppression of metastasis and invasion in breast cancer. J BUON. 2018;23(5):1290-6. [PubMed ID: 30570849].

  • 4.

    Roskoski R Jr. The ErbB/HER family of protein-tyrosine kinases and cancer. Pharmacol Res. 2014;79:34-74. [PubMed ID: 24269963]. https://doi.org/10.1016/j.phrs.2013.11.002.

  • 5.

    Ahmadi M, Rasi H, Mostafazadeh M, Hajazimian S, Maroufi NF, Nahaei MR, et al. Analysis of cervical lesions for presence of HSV-2 and HPV-16 and HPV-18 in Iranian patients by PCR. Horm Mol Biol Clin Investig. 2017;31(3). [PubMed ID: 28609291]. https://doi.org/10.1515/hmbci-2017-0019.

  • 6.

    Sharif MA, Mamoon N, Mushtaq S, Khadim MT. Morphological profile and association of HER-2/neu with prognostic markers in breast carcinoma in Northern Pakistan. J Coll Physicians Surg Pak. 2009;19(2):99-103. [PubMed ID: 19208313].

  • 7.

    Hilton HN, Clarke CL, Graham JD. Estrogen and progesterone signalling in the normal breast and its implications for cancer development. Mol Cell Endocrinol. 2018;466:2-14. [PubMed ID: 28851667]. https://doi.org/10.1016/j.mce.2017.08.011.

  • 8.

    Lapidus RG, Nass SJ, Davidson NE. The loss of estrogen and progesterone receptor gene expression in human breast cancer. J Mammary Gland Biol Neoplasia. 1998;3(1):85-94. [PubMed ID: 10819507]. https://doi.org/10.1023/A:1018778403001.

  • 9.

    Lal P, Tan LK, Chen B. Correlation of HER-2 status with estrogen and progesterone receptors and histologic features in 3,655 invasive breast carcinomas. Am J Clin Pathol. 2005;123(4):541-6. [PubMed ID: 15743737]. https://doi.org/10.1309/YMJ3-A83T-B39M-RUT9.

  • 10.

    Press MF, Bernstein L, Thomas PA, Meisner LF, Zhou JY, Ma Y, et al. HER-2/neu gene amplification characterized by fluorescence in situ hybridization: Poor prognosis in node-negative breast carcinomas. J Clin Oncol. 1997;15(8):2894-904. [PubMed ID: 9256133]. https://doi.org/10.1200/JCO.1997.15.8.2894.

  • 11.

    Ellis MJ, Tao Y, Young O, White S, Proia AD, Murray J, et al. Estrogen-independent proliferation is present in estrogen-receptor HER2-positive primary breast cancer after neoadjuvant letrozole. J Clin Oncol. 2006;24(19):3019-25. [PubMed ID: 16754938]. https://doi.org/10.1200/JCO.2005.04.3034.

  • 12.

    Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. 2001;344(11):783-92. [PubMed ID: 11248153]. https://doi.org/10.1056/NEJM200103153441101.

  • 13.

    Maher JM, Slitt AL, Cherrington NJ, Cheng X, Klaassen CD. Tissue distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein (Mrp) family in mice. Drug Metab Dispos. 2005;33(7):947-55. [PubMed ID: 15802388]. https://doi.org/10.1124/dmd.105.003780.

  • 14.

    Augustine LM, Markelewicz RJ Jr, Boekelheide K, Cherrington NJ. Xenobiotic and endobiotic transporter mRNA expression in the blood-testis barrier. Drug Metab Dispos. 2005;33(1):182-9. [PubMed ID: 15494472]. https://doi.org/10.1124/dmd.104.001024.

  • 15.

    Bera TK, Iavarone C, Kumar V, Lee S, Lee B, Pastan I. MRP9, an unusual truncated member of the ABC transporter superfamily, is highly expressed in breast cancer. Proc Natl Acad Sci U S A. 2002;99(10):6997-7002. [PubMed ID: 12011458]. [PubMed Central ID: PMC124517]. https://doi.org/10.1073/pnas.102187299.

  • 16.

    Ma XJ, Salunga R, Dahiya S, Wang W, Carney E, Durbecq V, et al. A five-gene molecular grade index and HOXB13:IL17BR are complementary prognostic factors in early stage breast cancer. Clin Cancer Res. 2008;14(9):2601-8. [PubMed ID: 18451222]. https://doi.org/10.1158/1078-0432.CCR-07-5026.

  • 17.

    Parker JS, Mullins M, Cheang MC, Leung S, Voduc D, Vickery T, et al. Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin Oncol. 2009;27(8):1160-7. [PubMed ID: 19204204]. [PubMed Central ID: PMC2667820]. https://doi.org/10.1200/JCO.2008.18.1370.

  • 18.

    Perez EA, Cortes J, Gonzalez-Angulo AM, Bartlett JM. HER2 testing: Current status and future directions. Cancer Treat Rev. 2014;40(2):276-84. [PubMed ID: 24080154]. https://doi.org/10.1016/j.ctrv.2013.09.001.

  • 19.

    Dvorak P, Pesta M, Soucek P. ABC gene expression profiles have clinical importance and possibly form a new hallmark of cancer. Tumour Biol. 2017;39(5):1010428317699800. [PubMed ID: 28468577]. https://doi.org/10.1177/1010428317699800.

  • 20.

    El-Awady R, Saleh E, Hashim A, Soliman N, Dallah A, Elrasheed A, et al. The role of eukaryotic and prokaryotic ABC transporter family in failure of chemotherapy. Front Pharmacol. 2016;7:535. [PubMed ID: 28119610]. [PubMed Central ID: PMC5223437]. https://doi.org/10.3389/fphar.2016.00535.

  • 21.

    Hlavac V, Brynychova V, Vaclavikova R, Ehrlichova M, Vrana D, Pecha V, et al. The expression profile of ATP-binding cassette transporter genes in breast carcinoma. Pharmacogenomics. 2013;14(5):515-29. [PubMed ID: 23556449]. https://doi.org/10.2217/pgs.13.26.

  • 22.

    Kubelka-Sabit K, Filipovski V, Jasar D. Comparison of HER2 status in breast cancer patients using CISH and immunohistochemical protocols. Pathology. 2014;46. S55. https://doi.org/10.1097/01.pat.0000454287.62515.99.

  • 23.

    Musa ZA, Qasim BJ, Al Shaikhly AWA. Evaluation of immunohistochemistry-equivocal (2+) HER2 gene status in invasive breast cancer by silver DNA in situ hybridization (SISH) and its association with clinicopathological variables. Iran J Pathol. 2017;12(1):9-19. [PubMed ID: 29760748]. [PubMed Central ID: PMC5938719].

  • 24.

    Madrid MA, Lo RW. Chromogenic in situ hybridization (CISH): A novel alternative in screening archival breast cancer tissue samples for HER-2/neu status. Breast Cancer Res. 2004;6(5):R593-600. [PubMed ID: 15318940]. [PubMed Central ID: PMC549176]. https://doi.org/10.1186/bcr915.

  • 25.

    Anders CK, Hsu DS, Broadwater G, Acharya CR, Foekens JA, Zhang Y, et al. Young age at diagnosis correlates with worse prognosis and defines a subset of breast cancers with shared patterns of gene expression. J Clin Oncol. 2008;26(20):3324-30. [PubMed ID: 18612148]. https://doi.org/10.1200/JCO.2007.14.2471.

  • 26.

    Brase JC, Schmidt M, Fischbach T, Sultmann H, Bojar H, Koelbl H, et al. ERBB2 and TOP2A in breast cancer: A comprehensive analysis of gene amplification, RNA levels, and protein expression and their influence on prognosis and prediction. Clin Cancer Res. 2010;16(8):2391-401. [PubMed ID: 20371687]. https://doi.org/10.1158/1078-0432.CCR-09-2471.

  • 27.

    Paik S, Kim C, Wolmark N. HER2 status and benefit from adjuvant trastuzumab in breast cancer. N Engl J Med. 2008;358(13):1409-11. [PubMed ID: 18367751]. https://doi.org/10.1056/NEJMc0801440.

  • 28.

    Collins LC, Marotti JD, Gelber S, Cole K, Ruddy K, Kereakoglow S, et al. Pathologic features and molecular phenotype by patient age in a large cohort of young women with breast cancer. Breast Cancer Res Treat. 2012;131(3):1061-6. [PubMed ID: 22080245]. https://doi.org/10.1007/s10549-011-1872-9.