Logo
Gene, Cell and Tissue

Image Credit:Gene, Cell and Tissue

The Relationship Between Promoter Methylation of RASSF1A Gene and Prognosis of Patients Affected with Breast Cancer in Khuzestan Province

Author(s):
Javad Mohammadi AslJavad Mohammadi Asl1,*, Farideh Ghanbari MardasiFarideh Ghanbari Mardasi2, Ghasem SakiGhasem SakiGhasem Saki ORCID1, Fakher RahimFakher RahimFakher Rahim ORCID3, Iran RashidiIran Rashidi4, Nastaran RanjbariNastaran Ranjbari4, Parvin KheradmandParvin Kheradmand4, Mohammad AbromandMohammad Abromand5, Jasem ghavabeshJasem ghavabesh6, Kolsoum FazeliKolsoum Fazeli6
1Cellular and Molecular Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2Department of Midwifery, Shoushtar Faculty of Medicine Science, Shoushtar, Iran
3Research Center of Thalassemia and Hemoglobinopathy, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
4Department of Pathology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
5Department of Biochemistry, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
6Genetic Counseling Center, Welfare Organization of Ahvaz, Ahvaz, Iran

Gene, Cell and Tissue:Vol. 7, issue 1; e96452
Published online:Dec 23, 2019
Article type:Research Article
Received:Jul 18, 2019
Accepted:Oct 15, 2019
How to Cite:Mohammadi Asl J, Ghanbari Mardasi F, Saki G, Rahim F, Rashidi I, et al. The Relationship Between Promoter Methylation of RASSF1A Gene and Prognosis of Patients Affected with Breast Cancer in Khuzestan Province.Gene Cell Tissue.2019;7(1):e96452.https://doi.org/10.5812/gct.96452.

Abstract

Background:

DNA methylation is one of the most frequent molecular changes that are associated with human cancers. Tumor suppressor genes are the important targets of hypermethylation in breast cancer and thus may result in cancer by deregulation of cell growth and division.

Objectives:

The purpose of this research was to compare the methylation pattern of the RASSF1A gene in cancerous and normal tissues.

Methods:

Twenty breast cancer patients with known clinicopathologic characteristics and 20 healthy women as control were studied for analysis of the methylation status of the RASSF1A gene promoter by methylation-specific polymerase chain reaction (MS-PCR) technique.

Results:

The findings showed that the frequency of RASSF1A promoter methylation was in 15% of tumor tissues and 5% of normal tissues. These results indicate that there is no statistically significant relationship between the RASSF1A promoter methylation status of tumor tissues and normal tissues (P > 0.05).

Conclusions:

Until now, the evidence for powerful methylation biomarkers is still incomplete and the recognized biomarkers require further validation.

1. Background

Breast cancer is the most frequent cancer and the leading cause of cancer death globally among women (1). Also in Iran, breast cancer is one of the most common cancers in women and 24.4% of all diagnosed cancers in women are breast cancer, which causes more than 1063 deaths annually (2). Because of a lack of definitive treatment to deal with this cancer, early and accurate diagnosis of the disease is critically important because it has a beneficial effect on reducing mortality in patients.

Epigenetic modification refers to both heritable changes in gene activity and expression and chromatin structure that occur without an alteration in the DNA sequence (3). DNA methylation is an epigenetic modification that directly affects DNA, which is the result of transfer of a methyl group from S-adenosyl-methionine (also known as SAM) to the cytosine. CpG islands (The CG island are regions with a high frequency of CpG sites and ‘p’ simply shows that ‘C’ and ‘G’ are connected by a phosphodiester bond) are considered to be a hallmark of the promoter regions of the genes. Extensive genomic analysis has shown that approximately 56% of the human promoters are associated with CpG islands. DNA methylation regulates gene expression with the effect on the upstream region of the gene (4). Changes in the pattern of methylation can lead to tumorigenesis (5).

The RASSF1A (Ras-associated domain family 1) tumor suppressor gene is located on 3 p21.3, the short arm of chromosome 3, which acts as an inhibitor of the cycline D1 protein. Also, it plays a key role as an interactor with the proteins of the retinoblastoma family and negative regulator of cell proliferation through the G1/S inhibitor and mitotic checkpoint (6-10). Loss of expression of this gene occurs more frequently by hypermethylation that is capable of causing the development of human cancers (10).

2. Objectives

The aim of this study was to compare the DNA methylation pattern in the promoter region of the RASSF1A gene between cancerous tissues in the patients affected by breast cancer and normal tissues in the control group in Khuzestan province.

3. Methods

3.1. Study Subjects

In the present study, 20 women were recruited from the Shafa and the Imam Khomeini hospitals in Ahvaz. Written informed consent was obtained from all participants for their tissues to be utilized for this study. Furthermore, twenty ages matched healthy women that had no history of cancer and autoimmune diseases were selected as the controls group. In the control group, the tissue of people who had come for cosmetic surgery was used. The sample collection procedure was approved by the University’s Ethics Committee (Ahvaz Jundishapour University of Medical Sciences). The sample size was calculated using GPower V. 2.9.1.3 software. The most important inclusion criteria for study participants were female patient with primary tumor site on breast, no history of benign breast disease, no chronic inflammatory disorders, and the accessibility of the tissue along with clinicopathologic data of all patients. Female patients previously treated with SAM-interfering drugs, pregnancy, breastfeeding, as well as those missing clinicopathologic data were excluded from the study.

3.2. DNA Extraction and Sodium Bisulfite Treatment of DNA

The DNA was extracted by the phenol-chloroform method and the extraction process was carried out according to the previous study (11). After extraction, the DNA-containing microtube was stored at -20°C.

Afterward, DNA was exposed to sodium bisulfate according to the method previously described (12). In brief, NaOH solution (2 M) was added to 1 - 2 µg of genomic DNA. Denaturation of DNA started efficiently after incubating the mixture for 20 minutes at 37°C.

Then about 30 μL of 10 mM hydroquinone and 520 μL of sodium bisulfite 3 M (PH = 5) were added to the denatured DNA and the surface was coated with a few drops of heavy mineral oil. Next, the solution was incubated at 50°C for 16 hours. Following the incubation, the methylated modified DNA was purified by the DNA purification kit of Roche. Subsequently, 5.5 μL of 3 M sodium hydroxide (NaOH) was added to the modified DNA and incubated at room temperature for 5 minutes. The solution was neutralized by the addition of 100 μL of 5 M ammonium acetate (NH4OAC). Finally, the DNA was precipitated in ethanol.

3.3. Methylation-Specific Polymerase Chain Reaction (MSP-PCR)

The methylation status of RASSF1A gene was investigated by using methylation-specific polymerase chain reaction (MS-PCR) technique. Two pairs of primers for methylated DNA (M pair) and for unmethylated DNA (U pair) were used that were previously described by Motevalizadeh Ardekani et al. (13), as shown in Table 1. The PCR temperature cycling conditions were as follows: initial denaturation at 95°C for 5 minutes, 40 cycles of 95°C for 30 seconds, annealing at 64°C for 25 seconds, 72°C for 25 seconds, and the final cycle was followed by extension at 72°C for 10 minutes. The PCR products were determined on 1% agarose gel. An image, presenting diverse methylation patterns, was captured (Figure 1).

Table 1.The Sequence of Primers and Product Size
PrimerSequence (5'→3')Product Size (bp)
RASSF1A-MF: GGGTTTTGCGAGAGCGCG169
R: GCTAACAAACGCGAACCG
RASSF1A-UF: GGTTTTGTGAGAGTGTGTTTAG169
R: CACTAACAAACACAAACCAAAC

The Sequence of Primers and Product Size

3.4. Statistical Analysis

Statistical analysis was performed with SPSS (version 25). P values were estimated using Fisher’s exact test and P < 0.05 was considered statistically significant.

4. Results

4.1. Methylation Analysis of a CpG Island in the Promoter Region of RASSF1A

The methylation status of the RASSF1A promoter was investigated on the DNA samples of 20 sporadic breast cancer tumors (with mean age 48 ± 6.7 years) and 20 adjacent noncancerous tissues of the control groups (with mean age 47 ± 7.6 years). As presented in Table 2, the RASSF1A promoter methylation was not associated with the increased risk or prognosis of breast cancer (P = 0.6).

Table 2.Promoter Methylation Frequency of RASSF1A Gene in Breast Tumors and Normal Tissuesa
RASSF1A Methylation StatusBreast TumorsNormal TissuesP Value
MM3 (15)1 (5)0.6
UM4 (20)5 (25)1
UU13 (65)14 (70)1
Total2020

Promoter Methylation Frequency of RASSF1A Gene in Breast Tumors and Normal Tissuesa

The methylated phenotype (MM) was more frequent in breast tumors (3/20 or 15%) compared to the healthy tissues (5/20 or 5%). Also, the semi-methylated phenotype (MU) was detected slightly more commonly in healthy tissues compared to the tumor tissues (25% vs. 20%), but no significant difference was detected between the two groups.

4.2. Association of RASSF1A Methylation with Clinicopathologic Parameters of Breast Cancer Patients

The analysis of the clinicopathologic data of the patients indicated no correlation between RASSF1A promoter methylation and the histopathological grade, familial history of breast cancer, familial history of other cancers, histology. Correlation of ER, PR, and HER2 markers with methylation was observed and RASSF1A methylation was correlated with ER in this locus but had no significant relationship with PR and HER2 (Table 3).

Table 3.Clinicopathologic Parameters of Breast Cancer Patientsa
ParametersRASSF1A Methylation StatusP Value
Non-Methylation (N = 17)Methylation (N = 3)
Estrogen receptor0.04
Negative1 (5)2 (66)
Positive16 (95)1 (34)
Progesterone receptor1
Negative4 (24)1 (34)
Positive13 (76)2 (66)
Her21
Negative10 (59)2 (66)
Positive7 (41)1 (34)
Histopathological grade0.7
I2 (12)-
II7 (41)1 (33.3)
III6 (35)1 (33.3)
IV2 (12)1 (33.3)
Familial history of breast cancer0.5
Negative14 (82)2 (66)
Positive3 (18)1 (34)
Familial history of other cancers1
Negative5 (30)1 (34)
Positive12 (70)2 (66)
Histology0.4
Ductal15 (88)2 (66)
Non-ductal2 (12)1 (34)

Clinicopathologic Parameters of Breast Cancer Patientsa

MS-PCR product of RASSF1A gene. L, marker; M, samples amplified with the primers for the methylated states; U, samples amplified with the primers for the non-methylated states; N, normal tissue samples; T, tumor tissue samples.
Figure 1.

MS-PCR product of RASSF1A gene. L, marker; M, samples amplified with the primers for the methylated states; U, samples amplified with the primers for the non-methylated states; N, normal tissue samples; T, tumor tissue samples.

5. Discussion

One of the most common mechanisms for silencing cancer-related genes is the aberrant methylation of the promoter region, which resulted in downregulation of gene expression. It has been established that the loss of gene expression of important tumor suppressor and growth-regulatory genes that led to cancer can occur via CpG island methylation (14).

While many investigations have shown that CpG island methylation plays a key function in the development of breast cancer, the results were quite variable. The diverse outcomes may be correlated with the use of diverse DNA methylation markers and techniques of analysis. The aim of this study was to compare the DNA methylation pattern in the promoter region of the RASSF1A gene in cancerous and normal tissues. Also, we aimed to verify whether the methylation of RASSF1A gene involved in development of breast cancer correlated with particular clinicopathologic features and hormone receptor expression in patients affected by breast cancer in Khuzestan province.

Epigenetic inactivation of RASSF1A by methylation is identified to be common in carcinomas of lung, ovary, gastric, bladder, nasopharyngeal, and breast (7, 15-18). Based on previous studies, hypermethylation in the promoter region of this gene does not occur in the healthy breast tissue, so the promoter methylation of RASSF1A is a specific tumor phenomenon (6, 19).

The RASSF1A methylation frequency in tumoral and normal tissues was 15% and 5%, respectively (Figure 1), which was lower as compared to previous studies (19-24). Accordingly, our results were higher than the studies by Motevalizadeh Ardekani et al. (13) and Cho et al. (25) showed that the methylation level of RASSF1A was 9.5% and 4%, respectively. Interestingly, no significant difference was revealed in the methylation level of RASSF1A between the cases with breast cancer and the healthy control group.

The association of RASSF1A methylation in patients with breast cancer and healthy controls has been analyzed in several studies (24-33). Burbee et al. (19), Park et al. (24), and Kim et al. (30) detected significantly high frequency of RASSF1A methylation in breast carcinoma than control subjects. In contrast, Cao et al. (26) and Zmetakova et al. (32) revealed no significant difference in methylation frequencies of RASSF1A gene between breast cancer patients and normal controls, which was in line with our results. Furthermore, another study by Brooks et al. demonstrated no significant difference in frequencies of RASSF1A promoter methylation between breast cancer cases and healthy control groups (33). Actually, it is not easy to compare the results between the published data and the present study, where different methods have been used for methylation analysis and diverse CpG sites have been investigated. The exact number of methylated CpG sites as the potential biomarker for breast cancer risk still remains unclear.

We next investigated the correlation between RASSF1A promoter methylation and relevant clinicopathologic parameters including histopathological grade, familial history of breast cancer, familial history of other cancers, estrogen-receptor, progesterone-receptor, Her2 and histology. Our findings revealed that the frequency of RASSF1A methylation was not statistically different at low-grade and high-grade tumors that were in the same line with previous studies (18, 19, 21).

In contrast, we identified a significant correlation between RASSF1A promoter methylation and ER-negative, demonstrating that ER status can have an effect on epigenetic modifications of certain genes. The association of RASSF1A promoter methylation and ER negativity was detected in previous studies (19, 34), while some previous studies were inconsistent with our findings and they found a correlation between ER positivity and RASSF1A promoter methylation (23, 35-38). Also, we demonstrated no significant correlation between RASSF1A promoter methylation in tissue, PR and Her2 markers in our study that is in line with previous studies (20, 37).

Various results in previous studies and the present study can be due to technical problems in the MSP-PCR and DNA extraction from tumor cells, using different methods for evaluation of promoter methylation, different stages of tumor cells and heterozygosity of the alleles of this gene. Also, another limitation of our findings was the small sample size, which included 20 patients and 20 healthy controls. Therefore, large-scale multicenter prospective survey cohorts are required to confirm these findings.

In summary, the status of promoter methylation of the RASSF1A gene in tissue included in our survey was unable to discriminate between breast cancer patients and healthy control groups. More prospective studies should be conducted to assess whether RASSF1A promoter methylation can be an appropriate biomarker for breast cancer early detection.

Acknowledgments

Footnotes

References

  • 1.
    Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87-108. [PubMed ID: 25651787]. https://doi.org/10.3322/caac.21262.
  • 2.
    Mousavi SM, Montazeri A, Mohagheghi MA, Jarrahi AM, Harirchi I, Najafi M, et al. Breast cancer in Iran: An epidemiological review. Breast J. 2007;13(4):383-91. [PubMed ID: 17593043]. https://doi.org/10.1111/j.1524-4741.2007.00446.x.
  • 3.
    Fraga MF, Esteller M. Epigenetics and aging: The targets and the marks. Trends Genet. 2007;23(8):413-8. [PubMed ID: 17559965]. https://doi.org/10.1016/j.tig.2007.05.008.
  • 4.
    Jang HS, Shin WJ, Lee JE, Do JT. CpG and Non-CpG methylation in epigenetic gene regulation and brain function. Genes (Basel). 2017;8(6):148. [PubMed ID: 28545252]. [PubMed Central ID: PMC5485512]. https://doi.org/10.3390/genes8060148.
  • 5.
    Daniel FI, Cherubini K, Yurgel LS, de Figueiredo MA, Salum FG. The role of epigenetic transcription repression and DNA methyltransferases in cancer. Cancer. 2011;117(4):677-87. [PubMed ID: 20945317]. https://doi.org/10.1002/cncr.25482.
  • 6.
    Hesson LB, Cooper WN, Latif F. The role of RASSF1A methylation in cancer. Dis Markers. 2007;23(1-2):73-87. [PubMed ID: 17325427]. [PubMed Central ID: PMC3850810]. https://doi.org/10.1155/2007/291538.
  • 7.
    Jiang Y, Cui L, Chen WD, Shen SH, Ding LD. The prognostic role of RASSF1A promoter methylation in breast cancer: A meta-analysis of published data. PLoS One. 2012;7(5). e36780. [PubMed ID: 22615811]. [PubMed Central ID: PMC3355150]. https://doi.org/10.1371/journal.pone.0036780.
  • 8.
    Hu J, Li H, Shi T, Ma X, Wang B, Xu H, et al. Relationship between the expression of RASSF1A protein and promoter hypermethylation of RASSF1A gene in bladder tumor. J Huazhong Univ Sci Technolog Med Sci. 2008;28(2):182-4. [PubMed ID: 18480993]. https://doi.org/10.1007/s11596-008-0217-3.
  • 9.
    Fahraeus R, Olivares-Illana V. MDM2's social network. Oncogene. 2014;33(35):4365-76. [PubMed ID: 24096477]. https://doi.org/10.1038/onc.2013.410.
  • 10.
    Agathanggelou A, Cooper WN, Latif F. Role of the Ras-association domain family 1 tumor suppressor gene in human cancers. Cancer Res. 2005;65(9):3497-508. [PubMed ID: 15867337]. https://doi.org/10.1158/0008-5472.CAN-04-4088.
  • 11.
    Strauss WM. Preparation of genomic DNA from mammalian tissue. Curr Protoc Mol Biol. 2001;Chapter 2:Unit2 2. [PubMed ID: 18265182]. https://doi.org/10.1002/0471142727.mb0202s42.
  • 12.
    Eskandari-Nasab E, Hashemi M, Rafighdoost F. Promoter methylation and mRNA expression of response gene to complement 32 in breast carcinoma. J Cancer Epidemiol. 2016;2016:7680523. [PubMed ID: 27118972]. [PubMed Central ID: PMC4828546]. https://doi.org/10.1155/2016/7680523.
  • 13.
    Motevalizadeh Ardekani A, Shirani M, Hashemi A, Basiri Z, Rahmati Y, Nikbakhsh N, et al. Methylation status of NANOG1, RASSF1A, SFN, CASP8, WIF1,CTSL2 genes in Iranian breast cancer patients. Iran South Med J. 2017;19(6):940-50. https://doi.org/10.18869/acadpub.ismj.19.6.940.
  • 14.
    Baylin SB, Ohm JE. Epigenetic gene silencing in cancer - a mechanism for early oncogenic pathway addiction? Nat Rev Cancer. 2006;6(2):107-16. [PubMed ID: 16491070]. https://doi.org/10.1038/nrc1799.
  • 15.
    Esteller M. Epigenetics in cancer. N Engl J Med. 2008;358(11):1148-59. [PubMed ID: 18337604]. https://doi.org/10.1056/NEJMra072067.
  • 16.
    Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128(4):683-92. [PubMed ID: 17320506]. [PubMed Central ID: PMC3894624]. https://doi.org/10.1016/j.cell.2007.01.029.
  • 17.
    Sakai T, Toguchida J, Ohtani N, Yandell DW, Rapaport JM, Dryja TP. Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am J Hum Genet. 1991;48(5):880-8. [PubMed ID: 1673287]. [PubMed Central ID: PMC1683063].
  • 18.
    Widschwendter M, Jones PA. The potential prognostic, predictive, and therapeutic values of DNA methylation in cancer. Commentary re: J. Kwong et al., Promoter hypermethylation of multiple genes in nasopharyngeal carcinoma. Clin. Cancer Res., 8: 131-137, 2002, and H-Z. Zou et al., Detection of aberrant p16 methylation in the serum of colorectal cancer patients. Clin. Cancer Res., 8: 188-191, 2002. Clin Cancer Res. 2002;8(1):17-21. [PubMed ID: 11801535].
  • 19.
    Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L, Fong K, Gao B, et al. Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst. 2001;93(9):691-9. [PubMed ID: 11333291]. [PubMed Central ID: PMC4374741]. https://doi.org/10.1093/jnci/93.9.691.
  • 20.
    Karray-Chouayekh S, Trifa F, Khabir A, Boujelbane N, Sellami-Boudawara T, Daoud J, et al. Aberrant methylation of RASSF1A is associated with poor survival in Tunisian breast cancer patients. J Cancer Res Clin Oncol. 2010;136(2):203-10. [PubMed ID: 19657672]. https://doi.org/10.1007/s00432-009-0649-6.
  • 21.
    Hagrass HA, Pasha HF, Shaheen MA, Abdel Bary EH, Kassem R. Methylation status and protein expression of RASSF1A in breast cancer patients. Mol Biol Rep. 2014;41(1):57-65. [PubMed ID: 24253900]. https://doi.org/10.1007/s11033-013-2837-3.
  • 22.
    Dulaimi E, Hillinck J, Ibanez de Caceres I, Al-Saleem T, Cairns P. Tumor suppressor gene promoter hypermethylation in serum of breast cancer patients. Clin Cancer Res. 2004;10(18 Pt 1):6189-93. [PubMed ID: 15448006]. https://doi.org/10.1158/1078-0432.CCR-04-0597.
  • 23.
    Alvarez C, Tapia T, Cornejo V, Fernandez W, Munoz A, Camus M, et al. Silencing of tumor suppressor genes RASSF1A, SLIT2, and WIF1 by promoter hypermethylation in hereditary breast cancer. Mol Carcinog. 2013;52(6):475-87. [PubMed ID: 22315090]. https://doi.org/10.1002/mc.21881.
  • 24.
    Park SY, Kwon HJ, Lee HE, Ryu HS, Kim SW, Kim JH, et al. Promoter CpG island hypermethylation during breast cancer progression. Virchows Arch. 2011;458(1):73-84. [PubMed ID: 21120523]. https://doi.org/10.1007/s00428-010-1013-6.
  • 25.
    Cho YH, Yazici H, Wu HC, Terry MB, Gonzalez K, Qu M, et al. Aberrant promoter hypermethylation and genomic hypomethylation in tumor, adjacent normal tissues and blood from breast cancer patients. Anticancer Res. 2010;30(7):2489-96. [PubMed ID: 20682973]. [PubMed Central ID: PMC3568974].
  • 26.
    Cao X, Tang Q, Holland-Letz T, Gundert M, Cuk K, Schott S, et al. Evaluation of promoter methylation of RASSF1A and ATM in peripheral blood of breast cancer patients and healthy control individuals. Int J Mol Sci. 2018;19(3):900. [PubMed ID: 29562656]. [PubMed Central ID: PMC5877761]. https://doi.org/10.3390/ijms19030900.
  • 27.
    Ahmed IA, Pusch CM, Hamed T, Rashad H, Idris A, El-Fadle AA, et al. Epigenetic alterations by methylation of RASSF1A and DAPK1 promoter sequences in mammary carcinoma detected in extracellular tumor DNA. Cancer Genet Cytogenet. 2010;199(2):96-100. [PubMed ID: 20471512]. https://doi.org/10.1016/j.cancergencyto.2010.02.007.
  • 28.
    Yazici H, Terry MB, Cho YH, Senie RT, Liao Y, Andrulis I, et al. Aberrant methylation of RASSF1A in plasma DNA before breast cancer diagnosis in the Breast Cancer Family Registry. Cancer Epidemiol Biomarkers Prev. 2009;18(10):2723-5. [PubMed ID: 19755643]. [PubMed Central ID: PMC3791602]. https://doi.org/10.1158/1055-9965.EPI-08-1237.
  • 29.
    Van der Auwera I, Elst HJ, Van Laere SJ, Maes H, Huget P, van Dam P, et al. The presence of circulating total DNA and methylated genes is associated with circulating tumour cells in blood from breast cancer patients. Br J Cancer. 2009;100(8):1277-86. [PubMed ID: 19367284]. [PubMed Central ID: PMC2676551]. https://doi.org/10.1038/sj.bjc.6605013.
  • 30.
    Kim JH, Shin MH, Kweon SS, Park MH, Yoon JH, Lee JS, et al. Evaluation of promoter hypermethylation detection in serum as a diagnostic tool for breast carcinoma in Korean women. Gynecol Oncol. 2010;118(2):176-81. [PubMed ID: 20466412]. https://doi.org/10.1016/j.ygyno.2010.04.016.
  • 31.
    Kloten V, Becker B, Winner K, Schrauder MG, Fasching PA, Anzeneder T, et al. Promoter hypermethylation of the tumor-suppressor genes ITIH5, DKK3, and RASSF1A as novel biomarkers for blood-based breast cancer screening. Breast Cancer Res. 2013;15(1):R4. [PubMed ID: 23320751]. [PubMed Central ID: PMC3672828]. https://doi.org/10.1186/bcr3375.
  • 32.
    Zmetakova I, Danihel L, Smolkova B, Mego M, Kajabova V, Krivulcik T, et al. Evaluation of protein expression and DNA methylation profiles detected by pyrosequencing in invasive breast cancer. Neoplasma. 2013;60(6):635-46. [PubMed ID: 23906298]. https://doi.org/10.4149/neo_2013_082.
  • 33.
    Brooks JD, Cairns P, Shore RE, Klein CB, Wirgin I, Afanasyeva Y, et al. DNA methylation in pre-diagnostic serum samples of breast cancer cases: Results of a nested case-control study. Cancer Epidemiol. 2010;34(6):717-23. [PubMed ID: 20627767]. [PubMed Central ID: PMC2956002]. https://doi.org/10.1016/j.canep.2010.05.006.
  • 34.
    Sunami E, Shinozaki M, Sim MS, Nguyen SL, Vu AT, Giuliano AE, et al. Estrogen receptor and HER2/neu status affect epigenetic differences of tumor-related genes in primary breast tumors. Breast Cancer Res. 2008;10(3):R46. [PubMed ID: 18485221]. [PubMed Central ID: PMC2481494]. https://doi.org/10.1186/bcr2098.
  • 35.
    Cho YH, Shen J, Gammon MD, Zhang YJ, Wang Q, Gonzalez K, et al. Prognostic significance of gene-specific promoter hypermethylation in breast cancer patients. Breast Cancer Res Treat. 2012;131(1):197-205. [PubMed ID: 21837480]. [PubMed Central ID: PMC3576848]. https://doi.org/10.1007/s10549-011-1712-y.
  • 36.
    Li Y, Wei Q, Cao F, Cao X. Expression and promoter methylation of the RASSF1A gene in sporadic breast cancers in Chinese women. Oncology Reports. 2008;19(5):1149-53. https://doi.org/10.3892/or.19.5.1149.
  • 37.
    Feng W, Orlandi R, Zhao N, Carcangiu ML, Tagliabue E, Xu J, et al. Tumor suppressor genes are frequently methylated in lymph node metastases of breast cancers. BMC Cancer. 2010;10:378. [PubMed ID: 20642860]. [PubMed Central ID: PMC2914707]. https://doi.org/10.1186/1471-2407-10-378.
  • 38.
    Van der Auwera I, Bovie C, Svensson C, Trinh XB, Limame R, van Dam P, et al. Quantitative methylation profiling in tumor and matched morphologically normal tissues from breast cancer patients. BMC Cancer. 2010;10:97. [PubMed ID: 20226036]. [PubMed Central ID: PMC2845117]. https://doi.org/10.1186/1471-2407-10-97.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles