Logo

Association Between Betaine Homocysteine S-Methyl Transferase (BHMT) rs3797546 Gene Polymorphisms and the Risk of Nonsyndromic Cleft Lip and/or Cleft Palate in South-East Population of Iran

Author(s):
Hooshang RafighdoostHooshang Rafighdoost1, 2, Zahra RafighdoostZahra Rafighdoost2, Mohsen TaheriMohsen TaheriMohsen Taheri ORCID3,*
1Cellular and Molecular Research Center, Zahedan University of Medical Sciences, Zahedan, IR Iran
2Department of Anatomy, School of Medicine, Zahedan University of Medical Sciences, Zahedan, IR Iran
3Genetics of Non Communicable Disease Research Center, Zahedan University of Medical Science, Zahedan, IR Iran

Health Scope:Vol. 1, issue 3; 144-6
Published online:Nov 20, 2012
Article type:Research Article
Received:Sep 30, 2012
Accepted:Oct 04, 2012
How to Cite:Rafighdoost H, Rafighdoost Z, Taheri M, Association Between Betaine Homocysteine S-Methyl Transferase (BHMT) rs3797546 Gene Polymorphisms and the Risk of Nonsyndromic Cleft Lip and/or Cleft Palate in South-East Population of Iran.Health Scope.2012;1(3):144-6.https://doi.org/10.5812/jhs.8381.

Abstract

Background:

Nonsyndromic cleft lip with or without cleft palate (NS-CL/P) is one of the most common congenital anomalies and has a multifactorial etiology that involves both genetic and environmental factors.

Objectives:

The present study was aimed to evaluate the possible association between BHMT rs3797546 gene polymorphisms and NS-CL/P in a sample of Iranian population.

Materials and Methods:

This case-control study was performed on 100 NS-CL/P cases and 100 healthy controls. Tetra amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR) was used to detect the polymorphism. Analysis of data was done using χ2 test for categorical data, the associations between genotypes and NS-CL/P were estimated by computing the odds ratio (OR) and 95% confidence intervals (95% CI) from logistic regression analyses.

Results:

No significant difference was found between the groups regarding BMHT rs3797546 gene polymorphism. The C allele was not associated with NS-CL/P (OR = 1.27, 95% CI = 0.85-2.79, P = 0.690).

Conclusions:

Our data suggested that BMHT rs3797546 gene polymorphism was not associated with risk/ protection for NS-CL/P in a sample of Iranian population. Larger studies are required to validate our findings.

1. Background

Nonsyndromic cleft lip with or without cleft palate (NCL/P) is one the most common congenitally developmental disorder anomalies and the most frequent nonsyndromic orofacial cleft (1). The prevalence of CL/P varies widely by geographical origin, racial background, ethnic background, and socioeconomic status (2). The incidence of cleft lip and palate in Iran is approximately 1/1000 which is lower than other countries (3). CL/P is a complex defect determined by interaction between multiple genetic and environmental risk factors (4). Betaine-homocysteine s-methyl transferase (BHMT) gene encodes a cytosolic enzyme that catalyzes the conversion of betaine and homocysteine to dimethyl glycine and methionine, respectively. There is little and controversial information concerning the role of BHMT polymorphisms in susceptibility to CL/P (5-8).

2. Objectives

Considering the crucial role played by this enzyme in methionine pathway, the current study was carried out to determine the impact of BHMT rs3797546 gene polymorphism on the risk of nonsyndromic cleft lip and/or cleft palate in a sample of Iranian population.

3. Materials and Methods

The study group consisted of 100 CL/P (61 males and 39 females) with an average age of 12.12 years (minimum 1 year, maximum 54 years) and 100 normal subjects (61 males and 39 females) with an average age of 12.03 years (minimum 1 year, maximum 51 years). All subjects were from Sistan and Baluchestan province. There was no significant difference between the groups regarding sex and age (P > 0.05). All participants were unrelated to each other. The local Ethics Committee of the Zahedan University of Medical Sciences approved the project, and written informed consent was taken from all participants. Blood samples were collected in Na-EDTA tubes from patients and healthy controls and stored at -20 °C until DNA extraction. Genomic DNA extraction from blood samples was carried out as described previously (9). BHMT genomic sequence (NT_006713.15) was obtained from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). The polymorphism was searched and primers for T-ARMS-PCR, a simple and rapid method for detection of SNP (single nucleotide polymorphism), were designed (10-13) (Table 1)1). In T-ARMS-PCR method, two external primers (control band) and two inner primers (allele specific primers) were used. Polymerase chain reaction (PCR) was performed using commercially available PCR premix (AccuPower PCR Pre-Mix, BIONEER, Daejeon, South Korea) according to the manufacturer’s recommended protocol. One μL of template DNA (~ 100 ng/μL), 1 μL of each primer (10 μM), and 15 μL DNase-free water were added to a 0.2 mL PCR tube containing AccuPower PCR Pre-Mix. The PCR cycling condition for BHMT was 5 min at 95 °C followed by 30 cycles of 30 s at 95 °C, 30 s at 62 °C, and 17 s at 72 °C, with a final extension of 5 min at 72 °C. The PCR products were analyzed by electrophoresis on a 2% agarose gel containing 0.5 μg/mL of ethidium bromide and visualized by trans-illumination with UV light, and photographs were taken (Figure 1).

Table 1.The Primers used for Detection of BMHT rs3797546 Polymorphism
 Sequence (5ʹ -> 3ʹ)
FI (C allele)AGAGATGAGTATAGACTCATCTCCAGCTTC
RI (T allele)CACTGAAGTTCTTAGCTCTCAGCGATA
FOAACAAGTTTGAAGCCCGCTAATTTAG
ROAGGAGAATTAACTGGGCAAAGTAAGAAA

The Primers used for Detection of BMHT rs3797546 Polymorphism

Photograph of the PCR Products of BMHT rs3797546 Gene Polymorphism
Figure 1.

Photograph of the PCR Products of BMHT rs3797546 Gene Polymorphism

3.1. Statistical Analysis

The statistical analysis of data was performed using the SPSS 18.0 software. Demographic and biochemical parameters between the groups were analyzed by independent sample t-test for continuous data, and χ2 test for categorical data. The association between genotypes and NS-CL/P were estimated by computing the odds ratio (OR) and 95% confidence intervals (95% CI) from logistic regression analyses adjusted for sex and age. In T-ARMS-PCR method, two external primers (control band) and two inner primers (allele specific primers) were used. The product sizes for detection of BHMT rs3797546 polymorphism were: 195 bp for C allele, 271 bp for T allele, and 409 bp for control band. M: DNA Marker; Lanes 1, 4: rs3797546 TC; Lanes 2, 3, 5: rs3797546 TT.

4. Results

The distribution of genotype and allele frequencies of BHMT rs3797546 gene polymorphism in NS-CL/P and healthy subjects are shown in Table 2. The wild-type genotype (TT) was observed in 85% of the patients, whereas 15% were heterozygous (TC). In the control group, the frequencies of genotypes were 88% for TT, and 12% for TC. There were no significant differences regarding BHMT rs3797546 polymorphism between NS-CL/P and healthy subjects (χ2 = 0.38, P = 0.535). No significant differences were observed among NS-CL/P and control subjects regarding allele frequencies (P = 0.690). The genotypes of BHMT rs3797546 polymorphism in cases and controls were in HWE (Hardy-weinberg equilibrium) (χ2 = 0.66, P = 0.417; χ2 = 0.41, P = 0.523, respectively).

Table 2.Frequency Distribution of the BHMT rs3797546 Gene Polymorphism in CL/P and Control Group
 CL/P. No.Control, No.OR b (95%CI) 
BHMT rs3797546 polymorphism    
TT8588Ref.-
TC15121.29 (0.57-2.94)0.535
CC00- 
Alleles    
T1851881.00-
C15121.27 (0.58-2.79)0.690

Frequency Distribution of the BHMT rs3797546 Gene Polymorphism in CL/P and Control Group

5. Discussion

Though the CL/P etiology is mainly unknown, it has been proposed that both genetic and environmental factors contribute to the risk for NS-CL/P. In the present study, we examined DHMT rs3797546 gene polymorphism and susceptibility to CL/P in a sample of Iranian population. The BHMT rs3797546 polymorphism was not associated with risk/protection for NS-CL/P in our population.

Few studies focused on BHMT polymorphisms as candidate markers for CL/P. Hu et al. (8) investigated BHMT rs651852, rs3797546, and rs3733890 gene polymorphisms. They found neither allelic nor genotypic associations between NS-CL/P and rs651852 as well as rs3733890 polymorphisms. In contrast to our findings, their findings showed that the rs3797546 polymorphism increased the risk for NS-CL/P in a recessive inheritance model (P = 0.020, OR = 2.10, 95% CI = 1.11-3.95; CC vs. TT + TC), while Martinelli et al. (5) found no significant association between BHMT and BHMT2 variants and CL/P. Mostowska et al. (14) reported that individuals with AA genotype of the BHMT rs3733890 polymorphism had a significantly lower risk for orofacial clefts. Zhu et al. (7) did not find any association between BHMT r239q as well as BHMT2 rs626105 polymorphisms and susceptibility to spina bifida or orofacial clefts. In conclusion, our data suggested that DHMT gene polymorphism was not associated with risk/protection for NS-CL/P in a sample of Iranian population. Larger studies with different ethnicities are required to confirm our findings.

Acknowledgments

Footnotes

References

  • 1.
    Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet. 2009;374(9703):1773-85. [PubMed ID: 19747722]. https://doi.org/10.1016/S0140-6736(09)60695-4.
  • 2.
    Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet. 2011;12(3). [PubMed ID: 21331089]. https://doi.org/10.1038/nrg2933.
  • 3.
    Khazaei S, Shirani AM, Khazaei M, Najafi F. Incidence of cleft lip and palate in Iran. A meta-analysis. Saudi Med J. 2011;32(4):390-3. [PubMed ID: 21483999].
  • 4.
    Lidral AC, Moreno LM. Progress toward discerning the genetics of cleft lip. Current opinion ped. 2005;17(6):731-9.
  • 5.
    Martinelli M, Masiero E, Carinci F, Morselli PG, Pezzetti F, Scapoli L. New evidence for the role of cystathionine beta-synthase in non-syndromic cleft lip with or without cleft palate. Eur J Oral Sci. 2011;119(3):193-7. [PubMed ID: 21564312]. https://doi.org/10.1111/j.1600-0722.2011.00824.x.
  • 6.
    Mostowska A, Hozyasz KK, Biedziak B, Misiak J, Jagodzinski PP. Polymorphisms located in the region containing BHMT and BHMT2 genes as maternal protective factors for orofacial clefts. Eur J Oral Sci. 2010;118(4):325-32. [PubMed ID: 20662904]. https://doi.org/10.1111/j.1600-0722.2010.00757.x.
  • 7.
    Zhu H, Curry S, Wen S, Wicker NJ, Shaw GM, Lammer EJ, et al. Are the betaine-homocysteine methyltransferase (BHMT and BHMT2) genes risk factors for spina bifida and orofacial clefts? Am J Med Genet A. 2005;135(3):274-7. [PubMed ID: 15887275]. https://doi.org/10.1002/ajmg.a.30739.
  • 8.
    Hu Y, Chen E, Mu Y, Li J, Chen R. BHMT gene polymorphisms as risk factors for cleft lip and cleft palate in a Chinese population. Biomed Environ Sci. 2011;24(2):89-93. [PubMed ID: 21565678].
  • 9.
    Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, Bardestani GR, Kordi-Tamandani DM, et al. Lack of association between paraoxonase-1 Q192R polymorphism and rheumatoid arthritis in southeast Iran. Genet Mol Res. 2010;9(1):333-9. [PubMed ID: 20198589]. https://doi.org/10.4238/vol9-1gmr728.
  • 10.
    Hashemi M, Moazeni-Roodi A, Bahari A, Taheri M. A tetra-primer amplification refractory mutation system-polymerase chain reaction for the detection of rs8099917 IL28B genotype. Nucleoside Nucle Acid. 2012;31(1):55-60. [PubMed ID: 22257210]. https://doi.org/10.1080/15257770.2011.643846.
  • 11.
    Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, Taheri M, Bardestani GR, et al. The L55M polymorphism of paraoxonase-1 is a risk factor for rheumatoid arthritis. Genet Mol Res. 2010;9(3):1735-41. [PubMed ID: 20812194]. https://doi.org/10.4238/vol9-3gmr893.
  • 12.
    Hashemi M, Hoseini H, Yaghmaei P, Moazeni-Roodi A, Bahari A, Hashemzehi N, et al. Association of polymorphisms in glutamate-cysteine ligase catalytic subunit and microsomal triglyceride transfer protein genes with nonalcoholic fatty liver disease. DNA Cell Biol. 2011;30(8):569-75. [PubMed ID: 21438662]. https://doi.org/10.1089/dna.2010.1162.
  • 13.
    Hashemi M, Eskandari-Nasab E, Fazaeli A, Bahari A, Hashemzehi NA, Shafieipour S, et al. Association of genetic polymorphisms of glutathione-S-transferase genes (GSTT1, GSTM1, and GSTP1) and susceptibility to nonalcoholic fatty liver disease in Zahedan, Southeast Iran. DNA Cell Biol. 2012;31(5):672-7. [PubMed ID: 22011249]. https://doi.org/10.1089/dna.2011.1343.
  • 14.
    Mostowska A, Hozyasz KK, Wojcicki P, Dziegelewska M, Jagodzinski PP. Associations of folate and choline metabolism gene polymorphisms with orofacial clefts. J Med Genet. 2010;47(12):809-15. [PubMed ID: 19737740]. https://doi.org/10.1136/jmg.2009.070029.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles