Association of Genotype and Haplotype of IL-28B Gene with Hepatitis C Infection Outcome in Iran: Spontaneous Clearance Versus Chronic Infection

Authors

Jamal Sarvari1, 2, Mehran Mansouri1, Tayebeh Hashempoor3, Seyed Younes Hosseini2, Afagh Moattari2, Neda Pirbonyeh2, Razieh Dowran2, Javad Moayedi3, Zahra Musavi3, Mohamad-Reza Fattahi1,*
1Gastroenterohepatology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
2Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
3Shiraz HIV/AIDS Research Center, Institute of Health, Shiraz University of Medical Sciences, Shiraz, Iran
*Corresponding Author: Mohamad-Reza Fattahi, MD, Associated Professor of Internal Medicine, Gastroenterohepatology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. Tel: +98-7136281442, E-mail: Email: [email protected]

Hepatitis Monthly:Vol. 17, issue 5; e45745
Published online:Apr 12, 2017
Article type:Research Article
Received:Jan 21, 2017
Accepted:Apr 08, 2017
How to Cite:Sarvari J, Mansouri M, Hashempoor T, Hosseini SY, Moattari A, et al. Association of Genotype and Haplotype of IL-28B Gene with Hepatitis C Infection Outcome in Iran: Spontaneous Clearance Versus Chronic Infection. Hepat Mon. 2017;17(5):e45745. doi: https://doi.org/10.5812/hepatmon.45745

Abstract

Background:

Spontaneous viral clearance occurs in 10% to 40% of individuals after hepatitis C virus infection. Some polymorphisms in IL-28B gene may influence the outcome of HCV infection. The present study aimed at investigating the genotype and allele frequency of IL-28B rs12979860 and rs8099917 SNPs in HCV infected patients in addition to determining their association with disease outcome.

Methods:

A total of 302 patients with chronic hepatic C infection and 36 individuals whose infection was spontaneously cleared were included in this case-control study. The presences of chronic or spontaneously cleared infection in participants were determined by serologic and molecular methods. Genomic DNA of the participants was extracted using salting out method. IL-28B/IFN-λ3 gene polymorphisms were conducted using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).

Results:

The frequency of CC genotype (P = 0.001) and C allele (P = 0.0007) of IL-28B gene at rs12979860 SNP was significantly higher in participants with spontaneously cleared HCV infection compared to that of those who were chronically infected. In the case of rs8099917 SNP of IL-28B, no correlation was found between frequency of genotype (P = 0.17) or allele (P = 0.12) and HCV infection outcome. The results of haplotype analysis showed the association of CT (P = 0.012) and TT (P = 0.013) haplotypes with spontaneous clearance and chronic infection, respectively.

Conclusions:

The findings implied that individuals with CC or CT genotype at rs12979860 SNP but rs8099917 SNP was not in association with spontaneous clearance of HCV in an Iranian population with HCV infection.

Highlights

1. Background

HCV is a global health problem with an estimated 130 million chronically infected people worldwide (1). The seroprevalence of HCV is near 0.6% in Iran (2). Unfortunately, for unknown reasons, spontaneous clearance is uncommon and most patients (50% - 85%) progress towards chronic infection, based on worldwide reports, and are subsequently at risk for liver diseases including cirrhosis and hepatocellular carcinoma (2, 3). Interferons (IFNs) are key cytokines in establishing a multifaceted antiviral response. Based on their structural features, receptor usage, and biological activities, 3 distinct types of IFNs are now recognized (Type I, II, and III) (4). In humans, Type III IFN group encompasses 3 closely related IFN-λ proteins, IFN-λ1, -λ2, and -λ3 (also known as IL-29, IL-28A, and IL-28B, respectively) that were discovered in 2003 (5). Among them, IL-28B/IFN-λ3 has shown more intensive activity against HCV. Human IL28B lies on the longer arm of Chromosome 19, on 19q13.13, and contains 6 exons (5). Innate antiviral activity induced by IFN-λ has been demonstrated against many viruses including encephalomyocarditis virus, hepatitis B virus (HBV), and vesicular stomatitis virus both in culture and animals (4-6).
There are some polymorphisms in IFN-λ3 gene including rs12980275A/G, rs8099917T/G, rs28416813C/G, and rs12979860C/T. The most important IFN-λ3 gene SNPs that showed a relationship with response to therapy and spontaneous clearance are rs12979860 C and rs8099917 T alleles.
IFN-λ is expressed in virus-infected cells, and it induces remarkable antiviral protection in a wide variety of cells, especially when cooperating with type I IFNs (4). In HCV infection, it seems to exert pivotal antiviral functions because a polymorphism near 3kb upstream of the gene appears to be linked to the outcome of infection although the mode of action is still unknown (7).
It has been reported that a number of factors including age, sex, jaundice, viral genotype, route of transmission, and coinfection with human immunodeficiency virus (HIV) or HBV affect the outcome of HCV infection as spontaneous clearance or chronic state (8, 9). However, recently some studies have confirmed the significant role of heritability and ethnicity in host immune response to HCV infection (10, 11).
Spontaneous viral clearance following acute infection is related to racial differences. Recent studies have found a predictive role for genetic variation in IL28B/IFN-λ3 gene region on Chromosome 19 in response to pegylated interferon (PEG-IFN) plus ribavirin therapy and also in spontaneous clearance of HCV infection (10, 11). This finding has since been confirmed in other independent cohorts (12). Genetic variation in the IL28B/IFN-λ3 gene, the rs12979860 C, and the rs8099917 T allele has been shown to strongly predict viral clearance (12, 13). Spontaneous clearance of HCV infection has also been reported to be associated with HLA class I and II (14, 15), IL-10 (16), IL-4 (17), IFN-γ (18), and PD-1 (17). To the best of our knowledge, few studies have been conducted on the effects of these polymorphisms on spontaneous clearance of HCV infection in Iran. Accordingly, in the present study, we explored the genotypes and allele frequency of IFN-λ3 at rs12979860C/T and the rs8099917T/G SNPs in HCV infected patients in Fars province, in South of Iran. In addition, we investigated whether their genotype and/or allele are significantly associated with HCV infection outcome: spontaneous clearance versus chronic infection.

2. Methods

2.1. Patients

In this case-control study, participants (n = 338) were recruited consecutively from the gastroenterohepatology research center at Nemazee hospital in Shiraz, Iran, from September 2012 to March 2014. In this study, 36 participants had spontaneously resolved HCV infection and 302 patients had chronic HCV infection. All the patients were negative for HBV and HIV infections and the status of HBV and HIV serology was determined based on the medical records. The HIV/HCV and HBV/HCV coinfected patients were excluded from the study. The study was approved by the hospital and the university’s ethics committee, and written informed consent was obtained from each participant before sampling.

2.2. Viral Infection State

Chronic or resolved HCV infection was diagnosed through medical records and was then confirmed by performing ELISA and RT-PCR as described before (18, 19). Briefly, all samples were screened by ELISA assay to confirm serologic state. The presence of virus genome was also evaluated by a gel-based and real-time PCR method. Briefly, a verified in-house Nested-PCR method, which was developed in our lab, was applied as a screening method (18). In addition, a commercial qualitative real-time PCR for virus detection (Amplisens HCV-FRT, Russia) was also employed. The detection limit of this virus detection kit was acclaimed to be near 10 IU/mL. Diagnosis of spontaneous clearance was based on the presence of HCV Ab, normal level of serum ALT/AST, and the negative results of qualitative RT-PCR or real-time PCR for 2 tandem samples with at least 6 months interval.

2.3. Genomic DNA Extraction and Analysis of Cytokine Polymorphisms

A 5 ml blood sample was drawn from each participant and placed in EDTA anticoagulant. DNA was extracted from peripheral blood leukocytes using the salting out procedure. The quality and quantity of extracted DNA were examined by a Nanodrop instrument. Polymorphism at positions rs12979860 and rs8099917 was identified using polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) as described by Sharafi et al. (20) with some modifications. The sequences of primers were shown at Table 1. The PCR reaction was performed in total volume of 25 μL, containing 1X reaction buffer, 200 μM of each dNTPs (Cinnagene Inc. Iran), 1U Taq DNA polymerase (Cinnagene Inc. Iran), 0.5 μM of each specific primers, 2% DMSO and 1.5 mM MgCl2, while 200 - 300 ng of template was included in each reaction for rs12979860 and rs8099917 SNPs. Then, all samples were introduced into Bsh1236I (BstUI) and BseMI (BsrDI) enzymes digestion to find polymorphisms at rs12979860 and rs8099917, respectively. The digestion pattern of each reaction was developed after the products were run on 2% agarose gel.
Table 1.
Primer Sequences and Enzyme/Methods Used for Detection of IL-28B Gene Polymorphisms by RFLP
SNPPrimersEnzyme
rs12979860F5'- GCGGAAGGAGCAGTTGCGCT -3'BstUI based RFLP
R5'- GGGGCTTTGCTGGGGGAGTG -3'
rs8099917F5'-CCCACTTCTGGAACAAATCGTCCC -3'BseMI based RFLP
R5'- TCTCCTCCCCAAGTCAGGCAACC -3'
Abbreviation: RFLP, restriction fragment length polymorphism.
During the gel analysis of digestion, in the case of rs12979860 polymorphism, the presence of 241, 196, and 45bp bands was demonstrative of heterogeneous CT genotype. Sole presence of 241bp band was indicative of homozygous status for the TT genotype, and appearance of 196 and 45bp bands were demonstrative of CC.
On the other side, presence of 552, 322, and 230 bp bands pattern was an indicator of heterogenous status, GT genotype at rs8099917 SNPs. Sole presence of 552 bp band demonstrated the homozygous state for the T allele, and also the appearance of 322 and 230 bp bands reflected the GG genotype.

2.4. Statistical Method

Data were analyzed by χ2 test using EPI-Info 2000 and SPSS Version 15 softwares. To investigate the statistics of haplotype analysis, data were introduced into specific software (Arlequin 3.1 and EpiInfo). Software package was used for haplotype analysis as well. P values less than 0.05 were considered as significant.

3. Results

A total of 338 participants infected with HCV were enrolled in the present study. Of them, 296 participants (87.5%) were male and 42 (12.5%) were female. Moreover, the male to female ratios in chronic and spontaneous cleared groups were 263/39 and 33/3, respectively, which were not significantly different (P = 0.59). The mean ages of chronic and clearance groups were 39.3 and 36.5 years, respectively, and the difference was not significant (P > 0.05).
Based on the medical records, the more prevalent genotype (only from the major part of chronic cases) revealed to be Genotype 3a (51.5%), 1 (46%) and 2 (< 0.5%) in our population.
The polymorphisms of IL-28B at rs12979860 and rs8099917 SNPs were determined in 232 and 328 individuals infected with HCV, respectively. The employed genotyping method have been shown analytical sensitivity and specificity of 100% for both SNPs genotypes when compared to sequencing results (20) (Table 2).
Table 2.
IL-28B Genotypes Frequency in Chronic and Spontaneously Cleared Groupsa
IFN-λ GenotypeChronicSpontaneous ClearanceP Value
rs129798600.001b
CC41 (20.8)20 (57.1)
CT102 (54.9)13 (37.9)
TT54 (22.3)2 (5.7)
Total197 (100)35 (100)
rs80999170.17
TT166 (56.9)26 (72.3)
TG120 (41.1)10 (27.7)
GG6 (2)0
Total292 (100)36 (100)
aValues are expressed as No. (%).
bWith the statistically significant value.
The distribution of cytokine genotype and allele of rs12979860C/T and rs8099917T/G SNPs in cleared patients and those with chronic infection is shown in Tables 3 and 4. Statistically significant differences in genotype and allele distribution were observed between the 2 clinical groups for IL-28B rs12979860C/T, but not for rs8099917T/G SNP.
Table 3.
IL-28B Allele Frequency in Chronic and Spontaneously Cleared Groupsa
IFN-λ AlleleChronicSpontaneous ClearanceP Value
rs129798600.0007b
C184 (41.6)53 (75.8)
T210 (58.4)17 (24.2)
Total394 (100)70 (100)
rs80999170.12
T452 (77.4)62 (83.2)
G132 (22.6)10 (13.8)
Total584 (100)72 (100)
aValues are expressed as No. (%).
bWith the statistically significant value.
Table 4.
IL-28B Haplotype Frequency in Chronic and Spontaneously Cleared Groupsa
HaplotypeChronicSpontaneous ClearanceP Value
TT245 (31.7)20 (16.7)0.013b
TG109 (14.1)10 (8.3)0.16
CT342 (44.3)80 (66.7)0.012b
CG76 (9.8)10 (8.3)0.75
Total772 (100)120 (100)
Abbreviations: CG, (rs12979860Crs8099917G); CT, (rs12979860Crs8099917T); TG, (rs12979860Trs8099917G); TT, (rs12979860Trs8099917T).
aValues are expressed as No. (%).
bWith the statistically significant value.
The frequency of CC genotype (57.1% vs. 20.8%) and C allele (75.8% vs 41.64%) of IL-28B at rs12979860 SNP was higher in spontaneously cleared patients compared to those with chronic HCV infection. In the case of rs8099917 SNP, no association was observed between frequency of rs8099917TT (72.3% vs 56.9%) genotype and T allele (83.2 % VS 77.4 %) in the 2 groups.
It has been reported that these polymorphisms were under linkage disequilibrium. Distribution of different haplotype frequencies in both groups is demonstrated in Table 4. The presence of CG and TG haplotype was not associated with HCV infection outcome, but the CT haplotype was more frequently present in spontaneous clearance participants than in those with chronic infection (P = 0.012, OR = 1.5 and CI = 1.19 - 2.08). On the other hand, the frequency of TT haplotype was significantly higher in chronic group than in those who spontaneously clear the infection (P = 0.013, OR = 0.53 and CI = 0.31 - 0.88).

4. Discussion

Understanding the factors that predict spontaneous clearance of HCV infection would improve clinical decision-making in the early therapeutic intervention (21). Genome-wide association studies have demonstrated that genetic variations in the region near the IL28B gene are associated with the absence of HCV RNA in anti-HCV antibody-positive individuals: presumed spontaneous HCV clearance (10).
In this study, we found that the frequency of CC genotype and C allele of IL-28B gene at rs12979860 SNP of IL-28B was significantly higher in spontaneously cleared patients compared to those with chronic HCV infection. In agreement with our results, Thomas at al. (10) found that individuals with C/C genotype at rs12979860 have strongly enhanced the resolution of HCV infection among individuals of both European and African ancestry. Moreover, it has been reported that spontaneous HCV clearance was more common in patients with the C/C genotype compared with T/T (64% versus 6%) (12). It was also shown that jaundice during acute infection was more common among patients with C/C genotype compared to non-C/C patients (32.7% versus 16.1%) (12). In addition, Falleti et al. (22) showed that the presence of the T allele was strongly associated with chronic HCV infection in Italian populations. Fabris at al. (23) reported that patients with TT genotype at the IL-28B rs12979860 SNP are more prone to get cirrhosis than those with CC or CT genotype.
Langerhans et al. reported that carriers of rs12979860 C allele constantly tended to have higher IL-29 and IL-28 serum levels than those with a T/T genotype in their study groups (7). They also demonstrated that patients with chronic hepatitis C had significantly lowered IL-29 serum levels than participants who had spontaneously cleared a previous HCV infection, and healthy controls, those with rs12979860TT genotype (7). In Iran, Sharafi et al. (24) showed that the frequency of CC genotype is higher in spontaneously cleared participants than in those with chronic HCV infection. Accordingly, we can conclude that CC genotype at IL-28B gene of rs12979860 SNP, which might be associated with higher IFN--λ level, may predispose patients to spontaneously cleared HCV infection. Many studies have also been done to find the association of this polymorphism with response to therapy (11, 21, 25, 26). In Iran, Mahboobi et al. (27) have reported that individuals with C/C and C/T genotypes of rs12979860 show higher sustained virologic response (SVR) rate compared to those with TT genotype. Rashidi et al. (28) showed that the frequency of CC genotype of rs12979860C/T in individuals with SVR was higher than in those who were unresponsive to therapy. Thompson et al. (29) reported that in Caucasians, the CC IL-28B type was associated with improved early viral kinetics and a greater likelihood of SVR compared with CT and rs12979860TT.
There was no statistically significant difference between the participants with spontaneously cleared HCV infection and those with chronic HCV infection in the frequency of alleles and genotypes at rs8099917T/G SNP of IL-28B gene. Similarly, Liu et al. (30) found no association between this polymorphism and spontaneous clearance of hepatitis C in a Chinese population. Shi et al. (31) also showed no effect of these polymorphisms on spontaneous clearance of HCV in a Chinese group. On the other hand, Rauch et al. (32) found a strong association between HCV chronicity and polymorphism at because TT genotype was associated with clearance, whereas GG was associated with chronic infection. Di Iulio et al. (13) showed a correlation of this SNP with spontaneous HCV clearance. The association of this polymorphism with clearance has been reported in uremic patients (33). According to these reports, we can conclude that in some regions and racial groups including Iran and China, polymorphism at rs8099917T/G was not associated with spontaneous HCV infection clearance, but in other areas such as the United States, Europe (13), Brazil (17), and Morocco (34) this polymorphism affects HCV infection outcome. An association between this polymorphism and response to therapy in patients infected with HCV was reported in some studies (11, 35).
Haplotype analysis based on linkage disequilibrium between SNPs is a useful method for finding predisposing genes in complex diseases. In this study, the results of haplotype analysis showed that those with CT haplotype are more prone to spontaneously clear HCV infection, but those with TT are susceptible to chronic infection after infection with HCV. In agreement with our results, Harrison et al. found that almost all individuals who spontaneously cleared HCV infection have CT haplotype (36).
Although sex has been reported as a factor influencing the outcome of HCV infection, we did not find a significant association between sex and outcome of HCV infection.
Although the study highlighted the association of some SNP of IL28B/IFN-λ3 with clearance/chronicity of HCV infection, some limitations including a retrospective property of the study and small size of cleared individuals as well as uneven amount of females to males should be considered in the future study.
In conclusion, in this study, we found that the frequencies of CC genotype and C allele at rs12979860C/T (but not at rs8099917T/G) as well as CT haplotype are significantly higher in those with spontaneously cleared HCV infection compared to those with chronic HCV infection. Therefore, we suggested that IL-28B gene at rs12979860C/T is a genetic factor, which may influence HCV infection outcome in the Iranian population.

Acknowledgments

Footnotes

  • Funding/Support:This study was financially supported by grant No. 91-4744 and 90-2872 from vice-chancellery of research of Shiraz University of Medical Sciences.

  • Conflict of Interest:All authors declare no conflict of interest.

References

  • 1.
    Hajarizadeh B, Razavi-Shearer D, Merat S, Alavian SM, Malekzadeh R, Razavi H. Liver Disease Burden of Hepatitis C Virus Infection in Iran and the Potential Impact of Various Treatment Strategies on the Disease Burden. Hepat Mon. 2016;16(7). ee37234. [PubMed ID: 27642346]. https://doi.org/10.5812/hepatmon.37234.
  • 2.
    Mirminachi B, Mohammadi Z, Merat S, Neishabouri A, Sharifi AH, Alavian SH, et al. Update on the Prevalence of Hepatitis C Virus Infection Among Iranian General Population: A Systematic Review and Meta-Analysis. Hepat Mon. 2017;17(2).
  • 3.
    Sarvari J, Norozian H, Fattahi MR, Pirbonyeh N, Moattari A. The Role of Interferon Gamma Gene Polymorphism (+874A/T, +2109A/G, and -183G/T) in Response to Treatment Among Hepatitis C Infected Patients in Fars Province, Southern Iran. Hepat Mon. 2014;14(1). ee14476. [PubMed ID: 24497880]. https://doi.org/10.5812/hepatmon.14476.
  • 4.
    Donnelly RP, Kotenko SV. Interferon-lambda: a new addition to an old family. J Interferon Cytokine Res. 2010;30(8):555-64. [PubMed ID: 20712453]. https://doi.org/10.1089/jir.2010.0078.
  • 5.
    Witte K, Witte E, Sabat R, Wolk K. IL-28A, IL-28B, and IL-29: promising cytokines with type I interferon-like properties. Cytokine Growth Factor Rev. 2010;21(4):237-51. [PubMed ID: 20655797]. https://doi.org/10.1016/j.cytogfr.2010.04.002.
  • 6.
    Li M, Liu X, Zhou Y, Su SB. Interferon-lambdas: the modulators of antivirus, antitumor, and immune responses. J Leukoc Biol. 2009;86(1):23-32. [PubMed ID: 19304895]. https://doi.org/10.1189/jlb.1208761.
  • 7.
    Langhans B, Kupfer B, Braunschweiger I, Arndt S, Schulte W, Nischalke HD, et al. Interferon-lambda serum levels in hepatitis C. J Hepatol. 2011;54(5):859-65. [PubMed ID: 21145813]. https://doi.org/10.1016/j.jhep.2010.08.020.
  • 8.
    Fedorchenko SV, Martynovich TL, Liashok OV, Kariuk Zh A, Ianchenko VI. [Spontaneous HCV clearance: an association with gender, age, viral genotypes, infection transmission routes, and markers of HBV and HIV]. Ter Arkh. 2010;82(3):52-6. [PubMed ID: 20564924].
  • 9.
    Gao B, Hong F, Radaeva S. Host factors and failure of interferon-alpha treatment in hepatitis C virus. Hepatology. 2004;39(4):880-90. [PubMed ID: 15057887]. https://doi.org/10.1002/hep.20139.
  • 10.
    Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O'Huigin C, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature. 2009;461(7265):798-801. [PubMed ID: 19759533]. https://doi.org/10.1038/nature08463.
  • 11.
    Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 2009;461(7262):399-401. [PubMed ID: 19684573]. https://doi.org/10.1038/nature08309.
  • 12.
    Tillmann HL, Thompson AJ, Patel K, Wiese M, Tenckhoff H, Nischalke HD, et al. A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice. Gastroenterology. 2010;139(5):1586-92. 1592 e1. [PubMed ID: 20637200]. https://doi.org/10.1053/j.gastro.2010.07.005.
  • 13.
    di Iulio J, Ciuffi A, Fitzmaurice K, Kelleher D, Rotger M, Fellay J, et al. Estimating the net contribution of interleukin-28B variation to spontaneous hepatitis C virus clearance. Hepatology. 2011;53(5):1446-54. [PubMed ID: 21360716]. https://doi.org/10.1002/hep.24263.
  • 14.
    Kuniholm MH, Anastos K, Kovacs A, Gao X, Marti D, Sette A, et al. Relation of HLA class I and II supertypes with spontaneous clearance of hepatitis C virus. Genes Immun. 2013;14(5):330-5. [PubMed ID: 23636221]. https://doi.org/10.1038/gene.2013.25.
  • 15.
    Ksiaa L, Ayed-Jendoubi S, Sfar I, Gorgi Y, Najjar HA, Abdallah TB, et al. Clearance and persistence of hepatitis C virus in a Tunisian population: association with HLA class I and class II. Viral Immunol. 2007;20(2):312-9. [PubMed ID: 17603847]. https://doi.org/10.1089/vim.2006.0060.
  • 16.
    Mangia A, Santoro R, Piattelli M, Pazienza V, Grifa G, Iacobellis A, et al. IL-10 haplotypes as possible predictors of spontaneous clearance of HCV infection. Cytokine. 2004;25(3):103-9. [PubMed ID: 14698136].
  • 17.
    Ramos JA, Silva R, Hoffmann L, Ramos AL, Cabello PH, Urmenyi TP, et al. Association of IL-10, IL-4, and IL-28B gene polymorphisms with spontaneous clearance of hepatitis C virus in a population from Rio de Janeiro. BMC Res Notes. 2012;5:508. [PubMed ID: 22986179]. https://doi.org/10.1186/1756-0500-5-508.
  • 18.
    Sarvari J, Moattari A, Pirbonyeh N, Moini M, Hosseini SY. The Impact of IFN-gamma Gene Polymorphisms on Spontaneous Clearance of HCV Infection in Fars Province, Southern of Iran. J Clin Lab Anal. 2016;30(4):301-7. [PubMed ID: 25990657]. https://doi.org/10.1002/jcla.21855.
  • 19.
    Ajorloo M, Bamdad T, Hashempour T, Alborzi AM, Mozhgani SH, Asadi R, et al. Detection of Specific Antibodies to HCV-ARF/CORE+1 Protein in Cirrhotic and Non-Cirrhotic Patients with Hepatitis C: A Possible Association with Progressive Fibrosis. Arch Iran Med. 2015;18(5):304-7. [PubMed ID: 25959912].
  • 20.
    Sharafi H, Pouryasin A, Alavian SM, Behnava B, Keshvari M, Mehrnoush L, et al. Development and Validation of a Simple, Rapid and Inexpensive PCR-RFLP Method for Genotyping of Common IL28B Polymorphisms: A Useful Pharmacogenetic Tool for Prediction of Hepatitis C Treatment Response. Hepat Mon. 2012;12(3):190-5. [PubMed ID: 22550527]. https://doi.org/10.5812/hepatmon.849.
  • 21.
    Grebely J, Petoumenos K, Hellard M, Matthews GV, Suppiah V, Applegate T, et al. Potential role for interleukin-28B genotype in treatment decision-making in recent hepatitis C virus infection. Hepatology. 2010;52(4):1216-24. [PubMed ID: 20803561]. https://doi.org/10.1002/hep.23850.
  • 22.
    Falleti E, Bitetto D, Fabris C, Cussigh A, Fornasiere E, Cmet S, et al. Role of interleukin 28B rs12979860 C/T polymorphism on the histological outcome of chronic hepatitis C: relationship with gender and viral genotype. J Clin Immunol. 2011;31(5):891-9. [PubMed ID: 21647799]. https://doi.org/10.1007/s10875-011-9547-1.
  • 23.
    Fabris C, Falleti E, Cussigh A, Bitetto D, Fontanini E, Bignulin S, et al. IL-28B rs12979860 C/T allele distribution in patients with liver cirrhosis: role in the course of chronic viral hepatitis and the development of HCC. J Hepatol. 2011;54(4):716-22. [PubMed ID: 21146242]. https://doi.org/10.1016/j.jhep.2010.07.019.
  • 24.
    Sharafi H, Alavian SM, Behnava B, Pouryasin A, Keshvari M. The Impact of IFNL4 rs12979860 Polymorphism on Spontaneous Clearance of Hepatitis C; A Case-Control Study. Hepat Mon. 2014;14(10). ee22649. [PubMed ID: 25419220]. https://doi.org/10.5812/hepatmon.22649.
  • 25.
    Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, et al. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. 2009;41(10):1105-9. [PubMed ID: 19749757]. https://doi.org/10.1038/ng.449.
  • 26.
    Origa R, Marceddu G, Danjou F, Perseu L, Satta S, Demartis FR, et al. IFNL3 polymorphisms and HCV infection in patients with beta thalassemia. Ann Hepatol. 2015;14(3):389-95. [PubMed ID: 25864220].
  • 27.
    Mahboobi N, Behnava B, Alavian SM. IL28B SNP genotyping among Iranian HCV-infected patients: A preliminary report. Hepat Mon. 2011;11(5):386-8. [PubMed ID: 22087170].
  • 28.
    Rashidi R, Toosi MN, Siya RS, Forutan H, Merat S, Daryani NE. The Effect of Interleukin 28 B Polymorphism on Sustained Virology Response (SVR) in Patients with Chronic Hepatitis C. Govaresh. 2010;15(3):202-8.
  • 29.
    Thompson AJ, Muir AJ, Sulkowski MS, Ge D, Fellay J, Shianna KV, et al. Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus. Gastroenterology. 2010;139(1):120-9 e18. [PubMed ID: 20399780]. https://doi.org/10.1053/j.gastro.2010.04.013.
  • 30.
    Liu Y, Ma H, Chen S, Wang J, Liu G, Xu M, et al. Interleukin-28B genetic variations and spontaneous clearance of hepatitis C antibody-positive blood donors in China. Transfusion. 2013;53(10 Pt 2):2498-504. [PubMed ID: 23782163]. https://doi.org/10.1111/trf.12305.
  • 31.
    Shi X, Pan Y, Wang M, Wang D, Li W, Jiang T, et al. IL28B genetic variation is associated with spontaneous clearance of hepatitis C virus, treatment response, serum IL-28B levels in Chinese population. PLoS One. 2012;7(5). ee37054. [PubMed ID: 22649509]. https://doi.org/10.1371/journal.pone.0037054.
  • 32.
    Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J, Mueller T, et al. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology. 2010;138(4):1338-45. 1345 e1-7. [PubMed ID: 20060832]. https://doi.org/10.1053/j.gastro.2009.12.056.
  • 33.
    Yu ML, Dai CY, Huang CF, Lee JJ, Yeh ML, Yeh SM, et al. High hepatitis B virus surface antigen levels and favorable interleukin 28B genotype predict spontaneous hepatitis C virus clearance in uremic patients. J Hepatol. 2014;60(2):253-9. [PubMed ID: 24096049]. https://doi.org/10.1016/j.jhep.2013.09.023.
  • 34.
    Ezzikouri S, Alaoui R, Rebbani K, Brahim I, Fakhir FZ, Nadir S, et al. Genetic variation in the interleukin-28B gene is associated with spontaneous clearance and progression of hepatitis C virus in Moroccan patients. PLoS One. 2013;8(1). ee54793. [PubMed ID: 23358556]. https://doi.org/10.1371/journal.pone.0054793.
  • 35.
    Riva E, Scagnolari C, Turriziani O, Antonelli G. Hepatitis C virus and interferon type III (interferon-lambda3/interleukin-28B and interferon-lambda4): genetic basis of susceptibility to infection and response to antiviral treatment. Clin Microbiol Infect. 2014;20(12):1237-45. [PubMed ID: 25273834]. https://doi.org/10.1111/1469-0691.12797.
  • 36.
    Harrison GL, Pryor J, Malani J, Supuri M, Masta A, Teriboriki B, et al. Infection frequency of hepatitis C virus and IL28B haplotypes in Papua New Guinea, Fiji, and Kiribati. PLoS One. 2013;8(8). ee66749. [PubMed ID: 23976941]. https://doi.org/10.1371/journal.pone.0066749.

Copyright

Copyright © 2017, Kowsar Corp. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

2
Jun
2020
The Study of IFNL3 Gene Rs12979860 Polymorphism in the Hepatitis C Virus Patients and Healthy Population in Tehran Province, Iran

The Study of IFNL3 Gene Rs12979860 Polymorphism in the Hepatitis C Virus Patients and Healthy Population in Tehran Province, Iran

Mohsen Koolivand,
Zeinab Allamehzadeh,
Ali Ahmadi,
Ramezan Ali Taheri,
Kazem Hassanpour,
Afshin Zeini
,et al.

Koolivand M, Allamehzadeh Z, Ahmadi A, Taheri RA, Hassanpour K, et al. The Study of IFNL3 Gene Rs12979860 Polymorphism in the Hepatitis C Virus Patients and Healthy Population in Tehran Province, Iran. Jundishapur J Microbiol. 2020;13(5):e95798. doi: https://doi.org/10.5812/jjm.95798

1
Oct
2014

The Impact of IFNL4 rs12979860 Polymorphism on Spontaneous Clearance of Hepatitis C; A Case-Control Study

Heidar Sharafi,
Seyed Moayed Alavian,
Bita Behnava,
Ali Pouryasin,
Maryam Keshvari

Sharafi H, Alavian SM, Behnava B, Pouryasin A, Keshvari M. The Impact of IFNL4 rs12979860 Polymorphism on Spontaneous Clearance of Hepatitis C; A Case-Control Study. Hepat Mon. 2014;14(10):e22649. doi: https://doi.org/10.5812/hepatmon.22649

19
Sep
2017

Interleukin 28B Genetic Polymorphism and Spontaneous Recovery from Hepatitis B Virus Infection in an Iranian Azeri Population

Jafar Mehdizadeh Baghbani,
Sousan Mirnajd Gerami,
Morteza Ghojazadeh,
Morteza Jabbarpour Bonyadi,
Mohammad Hossein Somi

Mehdizadeh Baghbani J, Mirnajd Gerami S, Ghojazadeh M, Jabbarpour Bonyadi M, Somi MH. Interleukin 28B Genetic Polymorphism and Spontaneous Recovery from Hepatitis B Virus Infection in an Iranian Azeri Population. Hepat Mon. 2017;17(9):e11706. doi: https://doi.org/10.5812/hepatmon.11706

14
Sep
2016

The Effect of IL28B Gene Polymorphism on Treatment Response in Iranian Patients with Hepatitis C Virus Infection

Fateme Zare,
Hossein Hadinedoushan,
Mohsen Akhondi Meybodi,
Mahdi Dehghanmanshadi,
Seyyed Ali Mirghanizade Bafghi,
Mahmood Vakili

Zare F, Hadinedoushan H, Akhondi Meybodi M, Dehghanmanshadi M, Mirghanizade Bafghi SA, et al. The Effect of IL28B Gene Polymorphism on Treatment Response in Iranian Patients with Hepatitis C Virus Infection. Jundishapur J Microbiol. 2016;9(12):e31501. doi: https://doi.org/10.5812/jjm.31501

7
Sep
2018

Association between interleukin 10 polymorphisms (-592C/A and - 819 C/T) with response to treatment in Iranian patients with hepatitis C virus

Farahnaz Bineshian,
Sanam Mohsenin,
Zohreh Sharifi

Bineshian F, Mohsenin S, Sharifi Z. Association between interleukin 10 polymorphisms (-592C/A and - 819 C/T) with response to treatment in Iranian patients with hepatitis C virus. koomesh. 2018;20(3):e152984. doi:

More by these authors

Jamal SarvariPubMedScholar
Mehran MansouriPubMedScholar
Tayebeh HashempoorPubMedScholar
Seyed Younes HosseiniPubMedScholar
Afagh MoattariPubMedScholar
Neda PirbonyehPubMedScholar
Razieh DowranPubMedScholar
Javad MoayediPubMedScholar
Zahra MusaviPubMedScholar
Mohamad-Reza FattahiPubMedScholar
Share
Cited by
Metrics