J Inflamm Dis

Image Credit:J Inflamm Dis

Evaluation of P16INK4a Expression in Pre-malignant and Malignant Cervical Tissues

Author(s):
Masoumeh AslanimehrMasoumeh AslanimehrMasoumeh Aslanimehr ORCID1,*, Taghi Naserpour-FarivarTaghi Naserpour-Farivar2, Hamid SadeghiHamid Sadeghi3, 1, Siavash BakhshianSiavash Bakhshian2, Fatemeh Samiee-RadFatemeh Samiee-Rad4
1Medical Microbiology Research Center, Qazvin University of Medical Sciences, Qazvin, Iran
2Departments of Microbiology, Faculty of Medicine, Qazvin University of Medical Sciences, Qazvin, Iran
3Student Research Committee, Qazvin University of Medical Sciences, Qazvin, Iran
4Department of Pathology, Qazvin University of Medical Sciences, Qazvin, Iran

Journal of Inflammatory Diseases:Vol. 28, issue 3; e159096
Published online:Sep 30, 2024
Article type:Research Article
Received:Jul 06, 2024
Accepted:Aug 20, 2024
How to Cite:Aslanimehr M, Naserpour-Farivar T, Sadeghi H, Bakhshian S, Samiee-Rad F. Evaluation of P16INK4a Expression in Pre-malignant and Malignant Cervical Tissues. J Inflamm Dis. 2024;28(3):e159096. doi: https://doi.org/10.69107/jid-159096

Abstract

Background:

Cervical cancer (CC) is the fourth most prevalent malignancy in women worldwide and a major cause of cancer-related mortality among females in developing countries. P16INK4a is a tumor suppressor protein with an inhibitory role in the proliferation of abnormal cells. The association between the expression of this protein and CC has established it as a diagnostic biomarker for CC.

Objectives:

This study evaluated the expression level of P16INK4a in cervical squamous cell carcinoma (CSCC).

Methods:

Eighty-three formalin-fixed paraffin-embedded (FFPE) cervical tissue samples were obtained from the pathology department of Kowsar Gynecology Reference Hospital in Qazvin Province, Iran. The expression level of the P16INK4a gene was investigated using relative quantitative real-time PCR (RT-qPCR).

Results:

P16INK4a overexpression was observed in 55% (12/22) of cancerous samples, 46% (6/13) of intraepithelial squamous lesions, and 33% (8/24) of tissues with koilocytic changes, with N-fold overexpression of 6.01 (P = 0.001), 3.24 (P = 0.003), and 1.12 (P = 0.007), respectively.

Conclusions:

The results of this study showed that the expression level of P16INK4a increased with cancer progression. Therefore, the expression level of P16INK4a can be utilized as a biomarker for diagnosis.

1. Background

Cervical cancer (CC) is the fourth most common cause of death in women worldwide, and primary screening for precancerous lesions significantly decreases mortality (1). The World Health Organization (WHO) estimated that 604,000 women were diagnosed with CC and 342,000 women died in 2020 (2). The correlation between CC and HPV infection is well-established (3). Approximately 90% of women with CC test positive for human papillomavirus (HPV) infection (4). The CC is caused by persistent HPV infection, particularly HPV-16/18 (5). The progression of CC from HPV infection to high-grade lesions and carcinoma occurs gradually over several years (6). Thus, it is essential to identify an effective, rapid, affordable, and minimally invasive diagnostic method for CC.
Squamous cell carcinoma (SCC) and adenocarcinoma (AC) are the two main histological types of CC (7). Based on global mortality data from 2018, SCC and AC accounted for nearly 80% and 20% of CC deaths, respectively (8). The CC primarily occurs in developing countries, with a high prevalence in Asia and the Sub-Saharan region of Africa due to limited screening for HPV and lack of vaccination programs (2, 9). In contrast, in developed countries, HPV vaccines are widely available, resulting in a reduced incidence of neoplastic and dysplastic lesions (10, 11).
Currently, the most commonly used CC screening methods include the Pap test (Pap smear), HPV test, and colposcopy. However, the false-negative rate for Pap smears is relatively high. While colposcopy is straightforward, its accuracy is dependent on human factors (12, 13). Therefore, there is a clinical need for diagnostic techniques that are accurate, valid, sensitive, and specific.
Human papillomavirus is a causative factor for CC and mediates oncogenesis via E6 and E7 proteins, which interact with p53 and p16, tumor-suppressor genes and cell cycle regulatory proteins, respectively, resulting in malignant cervical transformation (14). Additionally, these viral oncoproteins E6 and E7 play essential roles in promoting and sustaining cervical carcinogenesis, and both are overexpressed during cervical transformation (15, 16).
P16INK4a is a cyclin-dependent kinase (CDK)2 inhibitor encoded by the CDKN2A gene (17). P16INK4a is overexpressed in HPV-positive CC (18) and in a subset of head and neck squamous cell cancers, playing a critical role in cell cycle regulation (19). Although immunohistochemical (IHC) analyses have shown strong associations between P16INK4a protein expression and CC (20), few studies have quantitatively evaluated P16INK4a mRNA expression.

2. Objectives

This study assessed the expression level of P16INK4a mRNA in cervical squamous cell carcinoma (CSCC) as a biomarker using relative quantitative real-time PCR (RT-qPCR) in Qazvin, Iran.

3. Methods

3.1. Tissue Samples

One hundred archived formalin-fixed paraffin-embedded (FFPE) cervical tissue samples were obtained from the Pathology Department of Kowsar Gynecology Reference Hospital in Qazvin, Iran, between June 2009 and November 2019. All hematoxylin and eosin (HE)-stained slide samples were assessed and confirmed by an expert pathologist, and the intended zone was punched.
According to cytological and histological diagnoses, all samples were divided into four groups: (1) Samples with normal reports (without neoplastic or dysplastic changes); (2) samples with cervicitis and koilocytic changes; (3) specimens with squamous intraepithelial lesions, including low-grade squamous intraepithelial lesions (LSIL) and high-grade squamous intraepithelial lesions (HSIL); and (4) samples with cases of cancer (SCC and AC).

3.2. RNA Extraction and cDNA Synthesis

The FFPE samples were cut from each block for RNA extraction. RNA was extracted using a purification kit (Roche High Pure FFPE DNA isolation kit, Germany) according to the manufacturer’s instructions. The quality and quantity of the extracted RNA were assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). The RNA extracted from each sample was transcribed into cDNA using the Bioneer AccuPower CycleScript RT Premix (dN6) (Bioneer, Korea) according to the manufacturer’s instructions.

3.3. cDNA Quality Control

The quality of the synthesized cDNA was verified by running it on a 2% agarose gel. A SYBR green-based real-time PCR was performed, with β-actin (ACTB) used as an internal control.
Briefly, for each reaction in a 0.1 mL reaction tube, the mixture included 2 µL of cDNA template, 10 µL of 2X TAKARA SYBR Premix ExTaq II SYBR Green master mix (TAKARA BIO INC, Japan), 0.8 µL each of forward and reverse primers, 0.4 µL of ROX reference dye, and 6 µL of sterile dH2O, bringing the total volume to 20 µL per reaction.
The temperature protocol consisted of an initial denaturation at 95°C for 2 minutes, followed by 40 cycles at 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 30 seconds, without a final extension step. All experiments were conducted using the step one plus real-time system (Applied Biosystems, CA, USA). Only samples positive for ACTB were included in the study.

3.4. Quantitative Real-time PCR

SYBR green-based real-time PCR was conducted to analyze the expression of the P16INK4a gene relative to ACTB, used as the reference gene for normalization. The primers used for real-time PCR are listed in Table 1.
Table 1.Primers Used to Amplify Fragments of the P16INK4a and ACTB Genes
PrimersSequence (5 - 3)Ref.
P16INK4a(21)
ForwardGGGGGCACCAGAGGCAGT
ReverseGGTTGTGGCGGGGGCAGTT
ACTB(22)
ForwardCTGGAACGGTGAAGGTGACA
ReverseAAGGGACTTCCTGTAACAATGCA
For each reaction in a 0.1 mL reaction tube, the mixture included 2 µL of cDNA template, 10 µL of 2X TAKARA SYBR Premix ExTaq II SYBR Green master mix (TAKARA BIO INC, Japan), 0.8 µL each of forward and reverse primers, 0.4 µL of ROX reference dye, and 6 µL of sterile dH2O, making a total volume of 20 µL per reaction.
The temperature protocol began with an initial denaturation at 95°C for 2 minutes, followed by 40 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 30 seconds, without a final extension step. Melting curves were generated between 50°C and 95°C with a temperature increment of 0.2°C.
Each run included negative controls for both P16INK4a and ACTB. The PCR products were electrophoresed on a 2% agarose gel to verify correct amplification and were sequenced to confirm PCR specificity.

3.5. Statistical Analysis

After data collection, the findings were presented as statistical tables and numerical indices. Statistical analysis was performed using SPSS for Windows version 21.0 (IBM, US). The chi-square test or Fisher's exact test was applied for data analysis. A P-value of less than 0.05 was considered statistically significant.

4. Results

Out of 100 FFPE cervical tissue samples, real-time PCR for P16INK4a gene expression was performed on 83 samples (17 samples were excluded as they did not meet the inclusion criteria). Based on histological reports, the 83 included samples were categorized as follows: Normal samples without neoplastic or dysplastic changes (n = 24), pre-cancerous samples with koilocytic changes (n = 24), samples with high and low intra-epithelial neoplasia (n = 13), and samples with CC (n = 22). Positive P16INK4a expression with variable mRNA levels was observed across the groups, including the normal sample group 3/24 (12.5%), the pre-cancerous sample group 14/37 (38%), and the cancerous sample group 12/22 (55%) (Table 2).
Table 2.P16INK4a Positive and Negative Samples According to Pathology Group a
GroupPositiveNegativeP-Value b
Normal (n = 24)3 (12.5)21 (87.5)-
Koilocytic changes (n = 24)8 (33)16 (67)0.007
Squamous intraepithelial lesions (n = 13)6 (46)7 54 ()0.003
Cancer (n = 22)12 (55)10 (45)0.001

a Values are presented as No. (%).

b P < 0.05 was considered statistically significant.

The samples reported as positive for P16INK4a gene expression proceeded to the quantitative calculation stage to determine the relative expression level of this gene. The analysis compared the increase in P16INK4a gene expression relative to ACTB as a housekeeping gene in the premalignant and malignant groups against the normal samples as the control group. The final relative expression levels were calculated using the 2-∆∆Ct method (Table 3).
Table 3.Quantitative Up Expression Relative to Normal Group (N-fold)
VariablesN-fold Up ExpressionP-Value
Koilocytic changes1.120.007
Squamous intraepithelial lesions3.420.003
Cancer6.010.001
Regarding the pathology reports as the gold standard for diagnosis, the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the P16INK4a gene expression assessment in this study were evaluated as a laboratory test compared to the gold standard provided by the pathological group (Table 4).
Table 4.Sensitivity, Specificity, Positive Predictive Value, Negative Predictive Value and Accuracy of Our Test Compared to Pathology Reports a
VariablesKoilocyticLSILHSILCancer
Sensitivity33.34066.754.5
Specificity87.587.587.587.5
Positive predictive value72.757.14080
Negative predictive value56.877.895.567.7
Accuracy6073.585.271.7

Abbreviations: LSIL, low-grade squamous intraepithelial lesions; HSIL, high-grade squamous intraepithelial lesions.

a Values are presented as percentage.

5. Discussion

Cervical cancer, a largely preventable illness, is one of the most prevalent cancers in low- and middle-income countries affecting women (23). Nearly 85% of deaths worldwide due to CC occur in developing and underdeveloped countries, with the mortality rate being almost 20 times higher in low- and middle-income countries compared to first-world countries (24). Biomarkers have been emphasized in cancer prevention research due to their role in identifying neoplastic transformation processes in HPV-infected epithelial cells. Based on a deep molecular understanding, the cyclin-dependent kinase inhibitor P16INK4a is remarkably overexpressed in all HPV-transformed cells (25). Although the P16INK4a protein is deactivated in most cancers due to mutations, gene deletion, and hypermethylation, an increase in the expression level of P16INK4a occurs in CC (26).
In the current study, P16INK4a overexpression was observed in 3 out of 24 normal samples without neoplastic or dysplastic changes. While most studies report zero or negligible levels of P16INK4a in normal samples (27, 28), some studies, in agreement with our findings, have reported the expression of P16INK4a in normal samples (29, 30). It is noteworthy that the presence and increased expression level of P16INK4a can also be associated with aging and cellular stress; therefore, such changes in non-cancerous cases are not unexpected (31, 32).
In our study, the expression of P16INK4a was significantly increased in the pre-cancerous group, including tissues with koilocytic changes and intraepithelial squamous lesions, compared to the normal group (P-value = 0.007 and 0.003, respectively). A study conducted by Farzanehpour et al. similarly showed a remarkable increase in the expression level of the P16INK4a gene in the pre-cancerous group compared to normal groups (P-value = 0.0013) (33). Furthermore, the results of this study demonstrated a substantially higher expression of P16INK4a in cancerous samples compared to pre-cancerous samples (P-value = 0.001). This considerable increase in P16INK4a expression during the transformation from normal to cancerous tissues has been corroborated in several types of cancer (33-37).
Therefore, based on the analysis of normal, pre-cancerous, and CC samples, the high-level expression of P16INK4a can be regarded as an indicative marker for the early detection of CSCC.

5.1. Conclusions

Although the expression of the P16INK4a gene steadily increases as the disease progresses to cancer, with the highest expression observed in the cancer stage, the low sensitivity of this test makes it unsuitable for screening abnormal cervical conditions. Therefore, it appears that P16INK4a would be more appropriate as a confirmatory complementary test for follow-up treatment.

Acknowledgments

Footnotes

References

  • 1.
    Aljakouch K, Hilal Z, Daho I, Schuler M, Krauss SD, Yosef HK, et al. Fast and Noninvasive Diagnosis of Cervical Cancer by Coherent Anti-Stokes Raman Scattering. Anal Chem. 2019;91(21):13900-6. [PubMed ID: 31483624]. https://doi.org/10.1021/acs.analchem.9b03395.
  • 2.
    Felix MM, Tavares MV, Santos IP, Batista de Carvalho ALM, Batista de Carvalho LAE, Marques MPM. Cervical Squamous Cell Carcinoma Diagnosis by FTIR Microspectroscopy. Molecules. 2024;29(5). [PubMed ID: 38474435]. [PubMed Central ID: PMC10934502]. https://doi.org/10.3390/molecules29050922.
  • 3.
    Hussain S, Nasare V, Kumari M, Sharma S, Khan MA, Das BC, et al. Perception of human papillomavirus infection, cervical cancer and HPV vaccination in North Indian population. PLoS One. 2014;9(11). e112861. [PubMed ID: 25386964]. [PubMed Central ID: PMC4227878]. https://doi.org/10.1371/journal.pone.0112861.
  • 4.
    Daniyal M, Akhtar N, Ahmad S, Fatima U, Akram M, Asif HM. Update knowledge on cervical cancer incidence and prevalence in Asia. Asian Pac J Cancer Prev. 2015;16(9):3617-20. [PubMed ID: 25987011]. https://doi.org/10.7314/apjcp.2015.16.9.3617.
  • 5.
    Petry KU. HPV and cervical cancer. Scand J Clin Lab Invest Suppl. 2014;244:59-62. discussion 62. [PubMed ID: 25083895]. https://doi.org/10.3109/00365513.2014.936683.
  • 6.
    Schiffman M, Doorbar J, Wentzensen N, de Sanjose S, Fakhry C, Monk BJ, et al. Carcinogenic human papillomavirus infection. Nat Rev Dis Primers. 2016;2:16086. [PubMed ID: 27905473]. https://doi.org/10.1038/nrdp.2016.86.
  • 7.
    Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87-108. [PubMed ID: 25651787]. https://doi.org/10.3322/caac.21262.
  • 8.
    Teng N, Abu-Rustum NR, Bahador A, Bookman MA, Bristow RE, Campos S, et al. Cervical cancer guidelines. Clinical practice guidelines in oncology. J Natl Compr Canc Netw. 2004;2(6):612-30. [PubMed ID: 19780304]. https://doi.org/10.6004/jnccn.2004.0051.
  • 9.
    Buskwofie A, David-West G, Clare CA. A Review of Cervical Cancer: Incidence and Disparities. J Natl Med Assoc. 2020;112(2):229-32. [PubMed ID: 32278478]. https://doi.org/10.1016/j.jnma.2020.03.002.
  • 10.
    Chan CK, Aimagambetova G, Ukybassova T, Kongrtay K, Azizan A. Human Papillomavirus Infection and Cervical Cancer: Epidemiology, Screening, and Vaccination-Review of Current Perspectives. J Oncol. 2019;2019:3257939. [PubMed ID: 31687023]. [PubMed Central ID: PMC6811952]. https://doi.org/10.1155/2019/3257939.
  • 11.
    Cheng L, Wang Y, Du J. Human Papillomavirus Vaccines: An Updated Review. Vaccines (Basel). 2020;8(3). [PubMed ID: 32708759]. [PubMed Central ID: PMC7565290]. https://doi.org/10.3390/vaccines8030391.
  • 12.
    Liebermann EJ, VanDevanter N, Shirazian T, Frias Guzman N, Niles M, Healton C, et al. Barriers to Cervical Cancer Screening and Treatment in the Dominican Republic: Perspectives of Focus Group Participants in the Santo Domingo Area. J Transcult Nurs. 2020;31(2):121-7. [PubMed ID: 31046602]. https://doi.org/10.1177/1043659619846247.
  • 13.
    Li L, Zheng Z, Li L. Evaluation of human-papillomavirus screening for cervical cancer in China's rural population. PeerJ. 2019;7. e8152. [PubMed ID: 31875147]. [PubMed Central ID: PMC6927345]. https://doi.org/10.7717/peerj.8152.
  • 14.
    Singh V, Husain N, Akhtar N, Khan MY, Sonkar AA, Kumar V. p16 and p53 in HPV-positive versus HPV-negative oral squamous cell carcinoma: do pathways differ? J Oral Pathol Med. 2017;46(9):744-51. [PubMed ID: 28186650]. https://doi.org/10.1111/jop.12562.
  • 15.
    Byrne HJ, Behl I, Calado G, Ibrahim O, Toner M, Galvin S, et al. Biomedical applications of vibrational spectroscopy: Oral cancer diagnostics. Spectrochim Acta A Mol Biomol Spectrosc. 2021;252:119470. [PubMed ID: 33503511]. https://doi.org/10.1016/j.saa.2021.119470.
  • 16.
    Wang R, Wang Y. Fourier Transform Infrared Spectroscopy in Oral Cancer Diagnosis. Int J Mol Sci. 2021;22(3). [PubMed ID: 33530491]. [PubMed Central ID: PMC7865696]. https://doi.org/10.3390/ijms22031206.
  • 17.
    Sherr CJ. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol. 2001;2(10):731-7. [PubMed ID: 11584300]. https://doi.org/10.1038/35096061.
  • 18.
    Lesnikova I, Lidang M, Hamilton-Dutoit S, Koch J. p16 as a diagnostic marker of cervical neoplasia: a tissue microarray study of 796 archival specimens. Diagn Pathol. 2009;4:22. [PubMed ID: 19589135]. [PubMed Central ID: PMC2714065]. https://doi.org/10.1186/1746-1596-4-22.
  • 19.
    Pyeon D, Newton MA, Lambert PF, den Boon JA, Sengupta S, Marsit CJ, et al. Fundamental differences in cell cycle deregulation in human papillomavirus-positive and human papillomavirus-negative head/neck and cervical cancers. Cancer Res. 2007;67(10):4605-19. [PubMed ID: 17510386]. [PubMed Central ID: PMC2858285]. https://doi.org/10.1158/0008-5472.CAN-06-3619.
  • 20.
    Pannone G, Rodolico V, Santoro A, Lo Muzio L, Franco R, Botti G, et al. Evaluation of a combined triple method to detect causative HPV in oral and oropharyngeal squamous cell carcinomas: p16 Immunohistochemistry, Consensus PCR HPV-DNA, and In Situ Hybridization. Infect Agent Cancer. 2012;7:4. [PubMed ID: 22376902]. [PubMed Central ID: PMC3313884]. https://doi.org/10.1186/1750-9378-7-4.
  • 21.
    Kanellou P, Zaravinos A, Zioga M, Stratigos A, Baritaki S, Soufla G, et al. Genomic instability, mutations and expression analysis of the tumour suppressor genes p14(ARF), p15(INK4b), p16(INK4a) and p53 in actinic keratosis. Cancer Lett. 2008;264(1):145-61. [PubMed ID: 18331779]. https://doi.org/10.1016/j.canlet.2008.01.042.
  • 22.
    Daud ,I, Scott ME. Validation of reference genes in cervical cell samples from human papillomavirus-infected and -uninfected women for quantitative reverse transcription-PCR assays. Clin Vaccine Immunol. 2008;15(9):1369-73. [PubMed ID: 18632922]. [PubMed Central ID: PMC2546663]. https://doi.org/10.1128/CVI.00074-08.
  • 23.
    Herrero R, Murillo R. 48 Cervical Cancer. Cancer Epidemiology and Prevention. 4th ed. New York: Oxford Academic; 2017. https://doi.org/10.1093/oso/9780190238667.003.0048.
  • 24.
    Small WJ, Bacon MA, Bajaj A, Chuang LT, Fisher BJ, Harkenrider MM, et al. Cervical cancer: A global health crisis. Cancer. 2017;123(13):2404-12. [PubMed ID: 28464289]. https://doi.org/10.1002/cncr.30667.
  • 25.
    von Knebel Doeberitz M, Reuschenbach M, Schmidt D, Bergeron C. Biomarkers for cervical cancer screening: the role of p16(INK4a) to highlight transforming HPV infections. Expert Rev Proteomics. 2012;9(2):149-63. [PubMed ID: 22462787]. https://doi.org/10.1586/epr.12.13.
  • 26.
    Tornesello ML, Buonaguro L, Giorgi-Rossi P, Buonaguro FM. Viral and cellular biomarkers in the diagnosis of cervical intraepithelial neoplasia and cancer. Biomed Res Int. 2013;2013:519619. [PubMed ID: 24383054]. [PubMed Central ID: PMC3872027]. https://doi.org/10.1155/2013/519619.
  • 27.
    Volgareva G, Zavalishina L, Andreeva Y, Frank G, Krutikova E, Golovina D, et al. Protein p16 as a marker of dysplastic and neoplastic alterations in cervical epithelial cells. BMC Cancer. 2004;4:58. [PubMed ID: 15339339]. [PubMed Central ID: PMC517716]. https://doi.org/10.1186/1471-2407-4-58.
  • 28.
    Tan GC, Norlatiffah S, Sharifah NA, Razmin G, Shiran MS, Hatta AZ, et al. Immunohistochemical study of p16 INK4A and survivin expressions in cervical squamous neoplasm. Indian J Pathol Microbiol. 2010;53(1):1-6. [PubMed ID: 20090212]. https://doi.org/10.4103/0377-4929.59173.
  • 29.
    Queiroz C, Silva TC, Alves VA, Villa LL, Costa MC, Travassos AG, et al. P16(INK4a) expression as a potential prognostic marker in cervical pre-neoplastic and neoplastic lesions. Pathol Res Pract. 2006;202(2):77-83. [PubMed ID: 16376485]. https://doi.org/10.1016/j.prp.2005.08.012.
  • 30.
    Gupta R, Srinivasan R, Nijhawan R, Suri V, Uppal R. Protein p 16INK4A expression in cervical intraepithelial neoplasia and invasive squamous cell carcinoma of uterine cervix. Indian J Pathol Microbiol. 2010;53(1):7-11. [PubMed ID: 20090213]. https://doi.org/10.4103/0377-4929.59174.
  • 31.
    Cuschieri K, Wentzensen N. Human papillomavirus mRNA and p16 detection as biomarkers for the improved diagnosis of cervical neoplasia. Cancer Epidemiol Biomarkers Prev. 2008;17(10):2536-45. [PubMed ID: 18842994]. [PubMed Central ID: PMC2900792]. https://doi.org/10.1158/1055-9965.EPI-08-0306.
  • 32.
    Lodish HF. Molecular cell biology. 8th ed. New York: Macmillan; 2008.
  • 33.
    Farzanehpour M, Muhammadnejad A, Akhavan S, Emami Razavi AN, Jalilvand S, Salimi V, et al. P16INK4A Immunohistochemistry as a Gold Standard for Cervical Cancer and Precursor Lesions Screening. Iran J Public Health. 2020;49(2):312-22. [PubMed ID: 32461939]. [PubMed Central ID: PMC7231710].
  • 34.
    Hilliard NJ, Krahl D, Sellheyer K. p16 expression differentiates between desmoplastic Spitz nevus and desmoplastic melanoma. J Cutan Pathol. 2009;36(7):753-9. [PubMed ID: 19519606]. https://doi.org/10.1111/j.1600-0560.2008.01154.x.
  • 35.
    Zhao P, Mao X, Talbot IC. Aberrant cytological localization of p16 and CDK4 in colorectal epithelia in the normal adenoma carcinoma sequence. World J Gastroenterol. 2006;12(39):6391-6. [PubMed ID: 17072968]. [PubMed Central ID: PMC4088153]. https://doi.org/10.3748/wjg.v12.i39.6391.
  • 36.
    Milde-Langosch K, Bamberger AM, Rieck G, Kelp B, Loning T. Overexpression of the p16 cell cycle inhibitor in breast cancer is associated with a more malignant phenotype. Breast Cancer Res Treat. 2001;67(1):61-70. [PubMed ID: 11518467]. https://doi.org/10.1023/a:1010623308275.
  • 37.
    Dai CY, Furth EE, Mick R, Koh J, Takayama T, Niitsu Y, et al. p16(INK4a) expression begins early in human colon neoplasia and correlates inversely with markers of cell proliferation. Gastroenterology. 2000;119(4):929-42. [PubMed ID: 11040180]. https://doi.org/10.1053/gast.2000.17952.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles