Logo

Antimicrobial Resistance Profile of Extended-spectrum Beta-lactamase Genes in Escherichia coli Isolates Using Multiplex PCR Technique

Author(s):
Mohammad RaiszadehMohammad Raiszadeh1, Mohamad Ali KhosraviMohamad Ali Khosravi2, Hadis FathizadehHadis Fathizadeh3, 4, Morteza KhodaparastMorteza Khodaparast5, Seyyed Mohammad Saeed GhiasiSeyyed Mohammad Saeed Ghiasi6, Davoud EsmaeiliDavoud EsmaeiliDavoud Esmaeili ORCID2,*
1School of Medicine, Trauma Research Center, Bqiyatallah Al-Azam Hospital, Baqiyatallah University of Medical Sciences, Tehran, Iran
2Department of Microbiology and Applied Virology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
3Student Research Committee, Sirjan School of Medical Sciences, Sirjan, Iran
4Department of Laboratory Sciences, Sirjan School of Medical Sciences, Sirjan, Iran
5Department of Clinical Cardiac Electrophysiology, Atherosclerosis Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
6Assistant Professor, Cardiac Anesthesiology Fellowship, Atherosclerosis Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran


Jentashapir Journal of Cellular and Molecular Biology:Vol. 13, issue 4; e130078
Published online:Dec 13, 2022
Article type:Research Article
Received:Oct 25, 2022
Accepted:Nov 22, 2022
How to Cite:Mohammad RaiszadehMohamad Ali KhosraviHadis FathizadehMorteza KhodaparastSeyyed Mohammad Saeed GhiasiDavoud Esmaeiliet al.Antimicrobial Resistance Profile of Extended-spectrum Beta-lactamase Genes in Escherichia coli Isolates Using Multiplex PCR Technique.Jentashapir J Cell Mol Biol.13(4):e130078.https://doi.org/10.5812/jjcmb-130078.

Abstract

Background:

Broad-spectrum antibiotic resistance genes are one of the most common developing resistance genes worldwide. Accordingly, it is of paramount importance to study the extended-spectrum beta-lactamase (ESBL) genes to report them to physicians to select the most appropriate treatment.

Objectives:

This study aimed to detect three genes of ESBL such as TEM, AmpC, and KPC simultaneously.

Methods:

Primers were designed for ESBL genes such as TEM, AmpC, and KPC with Genscript software. In this study, control-positive genes were used for the PCR set-up. Fifty isolates of Escherichia coli isolated in the Baqiyatallah Hospital were confirmed and checked by Multiplex PCR.

Results:

This study revealed that TEM, AmpC, and KPC primers could detect positive control genes. The sensitivity and specificity of the multiplex PCR technique for these genes were 0.001 ng and 100%, respectively.

Conclusions:

This study revealed that a Multiplex PCR with a sensitivity of 0.001 ng and 100% specificity can detect ESBL genes precisely. Accordingly, the rapid and precise detection of the antibiotic resistance genes and the recommendation of an appropriate treatment pattern can decrease the distribution of antibiotic resistance occurrence and economic cost.

1. Background

One of the most significant achievements of medical sciences is beta-lactams. In this regard, the emergence of resistance to beta-lactam antibiotics has become a global concern. The coding gene of this enzyme is abundant in the E. coli strains. This made the World Health Organization (WHO) to highlight the risk of developing antibiotic-resistant strains. The WHO recommended the WHONET software to health centers to inform physicians about the results of local and global antibiotic resistance (1).

Phenotypic tests are the simplest techniques for the detection of antibiotic resistance worldwide. However, the phenotypical tests fail to detect the extended-spectrum beta-lactamase (ESBL) antibiotic resistance fully (2-5).

The Multiplex PCP method can detect 2 or 3 target sequences simultaneously. The rapid and exact detection and reports on the findings can help physicians treat their patients. Beta-lactam antibiotics are antibiotics effective in treating bacterial infections worldwide (2, 3, 5).

Since beta-lactams are inactive by β-lactamases, there is a need to use appropriate antibiotics to prevent the spread of antibiotic resistance genes.

ESBLs are enzymes inactivating beta-lactam antibiotics by attacking to beta-lactam ring (2-5).

ESBL refers to a group of enzymes hydrolyzing beta-lactam antibiotics such as penicillin, cephalosporin, cephamycin, and monobactam. The most abundant type of ESBL is the CTX-M beta-lactamase (6-9).

The widespread use of antibiotics and the advent of drug resistance concerning the prevalence of ESBLs in the strains are serious concerns. Beta-lactam is one of the antibiotics used against these bacteria. In recent years, the occurrence of multi-drug-resistance (MDR) isolates has aroused many concerns about selecting the appropriate antibiotic pattern. Accordingly, molecular techniques for the rapid and correct identification of antibiotic resistance are valuable (10-14).

2. Objectives

This study aimed to set up and design a Multiplex PCR technique for detecting extended beta-lactamase genes using the Multiplex PCR method.

3. Methods

3.1. Sample Collection

Several 50 E. coli clinical isolates were collected from the laboratory of Baqiyatallah Hospital and were confirmed by biochemical tests. Disc combine was used for the ESBL phenotypic identification.

3.2. Design Primer

First, complete DNA sequences were searched on the NCBI. The primers were designed with the Genscript software. The forward and reverse primers were blasted, and the results confirmed the suitability of the designed primers. Three primer pairs were evaluated with Oligo Analyzer software. Then the primers were evaluated with silico PCR amplification software (Table 1).

Table 1.ESBL-designed Primers for TEM, AmpC, and KPC Genes
GeneForward-PrimerReverse-PrimerTmAmplicon Size (bp)
TEMGAGGACCGAAGGAGCTAACCTTGCCGGGAAGCTAGAGTAA60188
AmpCCTCGACCTCGCGACCTATACCTGCCACTGGCGGTAGTAGT60102
KPCCAGCTCATTCAAGGGCTTTCGTCCAGACGGAACGTGGTAT60283

ESBL-designed Primers for TEM, AmpC, and KPC Genes

3.3. Determining Primer Sensitivity

Primer sensitivity was studied with different DNA dilutions. The nucleic acid serial dilution was prepared, and for all genomic dilutions, PCR was performed. The lowest dilution of the PCR reaction was set as test sensitivity.

3.4. Determining Primer Specificity

To obtain the specificity of the primers, the PCR reaction was performed considering the above conditions for the nucleic acid Staphylococcus aureus and Bacillus subtilis.

3.5.DNA Extraction

Nucleic acid extraction was carried out by the Cinnaclon kit. The purity and concentration of the nucleic acid were measured by spectrophotometry Nanodrop.

3.6.PCR Reaction

The PCR was carried out to amplify the genes, and the final volume of the PCR reaction was 25 µL. (Tables 2 and 3).

Table 2.Concentrations and Components in PCR Reaction
ComponentsConcentration
Master mix (1x)12.5 µL (1x)
Forward primer (0.1 - 1 µm)1 µL (10 µm)
Reverse primer (0.1 - 1 µm)1 µL (10 µm)
Template DNA1 µL (20 pg)
Sterile deionized water9.5 µL
Total volume25 µL

Concentrations and Components in PCR Reaction

Table 3.PCR Reactions in Corbett Thermocycler
Cycle PCRTemperatureTime (Second)Number Cycle
Primary denaturation95°C3001
Second denaturation95°C3035
Annealing60°C4535
Extension72°C4035
Final extension72°C3001

PCR Reactions in Corbett Thermocycler

3.7. Gel Electrophoresis

The DNA amplified by PCR was observed on a 1% (w/v) agarose gel electrophoresis with SYBR® Safe (Qiagen) color.

4. Results

4.1. Antibiogram Test

Disc diffusion was evaluated in 50 bacterial samples isolated in the Baqiyatallah Hospital (Table 4).

Table 4.Antibiotic Resistance Pattern of Escherichia coli Isolates
AntibioticsResistant (%)Intermediate (%)Sensitive (%)
Ofloxacin (OFX)9604
Amikacin (AN)453025
Piperacillin (PIP)9811
Ciprofloxacin (CP)9622
Gentamicin (GM)79615
Cefotaxime (CTX)9811
Nitrofurantoin (FM)491435
Imipenem (IMI)391150
Meropenem (MER)30565
Norfloxacin (NOR)9631

Antibiotic Resistance Pattern of Escherichia coli Isolates

4.2. Multiplex PCR Results

The multiplex PCR results for the ESBLs of AmpC, TEM, and KPC on 1% agarose gel are illustrated in Figure 1. The sensitivity and specificity of the multiplex PCR technique for ESBL genes were 0.001 ng and 100%, respectively.

Multiplex PCR results for <i>ESBL</i> genes on gel agarose 1%. S: Wells for primer specificity containing primers with DNA <i>S. aureus</i> and <i>B. subtilis</i>; N: Wells containing primers without DNA as a negative control; P: Wells containing primers and DNA containing <i>ESBL</i> gene as a positive clinical control; M: Well-containing three-pair primers of ESBL genes; <i>AmpC</i>: Well containing <i>AmpC</i> gene primer; <i>TEM</i>: Well containing <i>TEM</i> gene primer; <i>KPC</i>: Well containing <i>KPC</i> gene primer.
Figure 1.

Multiplex PCR results for ESBL genes on gel agarose 1%. S: Wells for primer specificity containing primers with DNA S. aureus and B. subtilis; N: Wells containing primers without DNA as a negative control; P: Wells containing primers and DNA containing ESBL gene as a positive clinical control; M: Well-containing three-pair primers of ESBL genes; AmpC: Well containing AmpC gene primer; TEM: Well containing TEM gene primer; KPC: Well containing KPC gene primer.

4.3. Frequency of ESBL Genes

The confirmed primers of TEM, KPC, and AmpC genes were evaluated in the 50 Escherichia coli clinical isolates (Table 5).

Table 5.Frequency of ESBL Genes in Escherichia coli Isolates
GenesResistant, Frequency %
TEM58
KPC18
AmpC84

Frequency of ESBL Genes in Escherichia coli Isolates

5. Discussion

The extensive use of antibiotics affected the prevalence of antibiotic resistance genes in different regions. The increased prescription of broad-bet-lactams and long hospitalization caused the spread of antibiotic-resistant genes.

Beta-lactams are one of the most common antimicrobial agents in treating serious infections induced by Enterobacteriaceae infections. The emergence of resistance to beta-lactams antibiotics have resulted in many treatment failures (10, 15-19).

The present study used the multiplex PCR technique to detect the ESBL TEM, KPC, and AmpC genes simultaneously.

The sensitivity of the multiplex PCR for the TEM, KPC, and AmpC genes was 0.001 ng, and the test specificity was 100%. The results indicated that molecular and phenotypic tests were compatible.

This method decreases the use of costly and widespread antibiotics and promotes preparation for the rapid diagnosis of antibiotic resistance when epidemics occur. Given the significance of identifying multi-drug resistance bacteria, it is necessary to design appropriate methods for the rapid and correct detection of antibiotic resistance (10, 15-19).

The resistance to these antibiotics is caused by genetic structures such as integrons, transposons, and plasmids; therefore, there is concerns about the transmission of antibiotic resistance genes to other bacteria (17, 18).

In the present study, resistance to Cefotaxime and piperacillin was reported; however, the isolates of pandemic-drug-resistance (PDR) were not reported. The multi-drug-resistance (MDR) and extensive drug-resistance (XDR) isolates were also reported (18, 19).

The present study showed that about 100% of E. coli isolates had an MDR pattern, which was of a great concern.

According to the present findings, the highest frequency of resistance to piperacillin and cefotaxime antibiotics was 98%. The highest rates of sensitivity to the Meropenem and Imipenem antibiotics were reported to be 55% and 50%, respectively. In his study in the Jahrom Hospital, Emamghorashi and Kohanteb reported antibiotic resistance to vancomycin, gentamicin, Nitrofurantoin, amikacin, and ciprofloxacin to be 56.2, 72.1, 34.3, 28.6, and 6.7%, respectively. In this study, the frequency of resistance to these antibiotics was significantly higher than in Emamghorashi and Kohanteb’s study. The acquisition and spread of antibiotic-resistance genes over time cause such inconsistency (20).

In a study by Mobasherizadeh et al., extent-spectrum β-lactamases from UTI infections in admitted and outpatient patients were isolated in Esfahan, and the resistance rates of Klebsiella pneumonia and Escherichia coli producing β-lactamases were 41.6 and 47.97%, respectively, suggesting the lowest and highest antibiotic resistance for nitrofurantoin (16.7%) and cotrimoxazole (75%), respectively (21).

Kaikha and Rava in Zahedan reported the antibiotic resistance rates of E. coli to the antibiotics nitrofurantoin, amikacin, ceftazidime, and gentamicin were 26.1, 19.5, 44.8, 13.7, and 4.5%, respectively. Their reported values were below the ones reported in the present study (22).

In Heidari-Soureshjani et al.’s study, the rates of antibiotic resistance to nalidixic acid, cotrimoxazole, nitrofurantoin, ciprofloxacin, cefotaxime, gentamicin, and imipenem were 67, 21, 32, 8, 49, 7, 43, and 38%, respectively (23).

The ESBL genes are effective agents in emerging resistance to beta-lactam antibiotics. Organisms containing ESBL genes are more pathogenic and virulent; hence, the timely and accurate diagnosis of this type of resistance, reporting the findings to physicians, and the provision of an appropriate medical advice can reduce patient problems and promote their treatment. In this study, fifty-eight percent of the isolates contained the TEM gene, eighteen percent of the isolates contained the KPC gene, and eighty-four percent of the isolates contained the AmpC gene. Furthermore, in the present study, 58% of the samples contained the KPC, TEM, and AmpC genes simultaneously. Shahcheraghi et al.'s study showed that 24% of isolates contained the TEM gene. This frequency is lower than the value reported in the present study. The distribution of the resistant plasmids among E.coli isolates probably arouses antibiotic resistance (24). In 2008, a comprehensive study on ESBL enzymes was conducted in Switzerland, which showed that 42.9% of the isolates contained the AmpC gene.

The studies that used the PCR method for detecting ESBL genes showed that nearly 50% of reported isolates contain TEM genes, which was compatible with the findings of the present study (1, 25-32). Recent studies have indicated that resistance to beta-lactam induced by ESBL is increasing rapidly. Possible reasons are the improper administration of antibiotics, the lack of appropriate methods in identifying antibiotic resistance, and the improper interpretation of new identification methods.

5.1. Conclusions

Antibiotic resistance, the prevalence of broad-spectrum beta-lactamase genes, and the extent of spectrum-beta-lactamase in gram-negative bacteria are global concerns and require infection control management. Regarding the immediate and accurate detection of these strains, the multiplex method proposed in this study would help physicians to prescribe appropriate antibiotics and avoid extended hospital stays and high costs.

Acknowledgments

Footnotes

References

  • 1.
    Esmaeili D, Daymad SF, Neshani A, Rashki S, Marzhoseyni Z, Khaledi A. Alerting prevalence of MBLs producing Pseudomonas aeruginosa isolates. Gene Reports. 2019;16:100460. https://doi.org/10.1016/j.genrep.2019.100460.
  • 2.
    Black JA, Moland ES, Thomson KS. AmpC disk test for detection of plasmid-mediated AmpC beta-lactamases in Enterobacteriaceae lacking chromosomal AmpC beta-lactamases. J Clin Microbiol. 2005;43(7):3110-3. [PubMed ID: 16000421]. [PubMed Central ID: PMC1169113]. https://doi.org/10.1128/JCM.43.7.3110-3113.2005.
  • 3.
    Wright AJ. The penicillins. Mayo Clin Proc. 1999;74(3):290-307. [PubMed ID: 10090000]. https://doi.org/10.4065/74.3.290.
  • 4.
    Rolinson GN. Forty years of beta-lactam research. J Antimicrob Chemother. 1998;41(6):589-603. [PubMed ID: 9687097]. https://doi.org/10.1093/jac/41.6.589.
  • 5.
    Ataee RA, Golmohammadi R, Alishiri GH, Mirnejad R, Najafi A, Esmaeili D, et al. Simultaneous Detection of Mycoplasma pneumoniae, Mycoplasma hominis and Mycoplasma arthritidis in Synovial Fluid of Patients with Rheumatoid Arthritis by Multiplex PCR. Arch Iran Med. 2015;18(6):345-50. [PubMed ID: 26058928].
  • 6.
    Khosravi MA, Najafi A, Esmaeili D. Design multiplex PCR for detection of rapid and correct the metallobetalactamase. Gene Reports. 2019;17:100498. https://doi.org/10.1016/j.genrep.2019.100498.
  • 7.
    Fisher JF, Meroueh SO, Mobashery S. Bacterial resistance to beta-lactam antibiotics: compelling opportunism, compelling opportunity. Chem Rev. 2005;105(2):395-424. [PubMed ID: 15700950]. https://doi.org/10.1021/cr030102i.
  • 8.
    Zowawi HM, Balkhy HH, Walsh TR, Paterson DL. beta-Lactamase production in key gram-negative pathogen isolates from the Arabian Peninsula. Clin Microbiol Rev. 2013;26(3):361-80. [PubMed ID: 23824364]. [PubMed Central ID: PMC3719487]. https://doi.org/10.1128/CMR.00096-12.
  • 9.
    Jain S, Khety Z. Changing antimicrobial resistance pattern of isolates from an ICU over a 2 year period. J Assoc Physicians India. 2012;60:27-8. 33. [PubMed ID: 23029718].
  • 10.
    Mendiratta DK, Deotale V, Narang P. Metallo-beta-lactamase producing Pseudomonas aeruginosa in a hospital from a rural area. Indian J Med Res. 2005;121(5):701-3. [PubMed ID: 15937376].
  • 11.
    Samuelsen O, Buaro L, Giske CG, Simonsen GS, Aasnaes B, Sundsfjord A. Evaluation of phenotypic tests for the detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa in a low prevalence country. J Antimicrob Chemother. 2008;61(4):827-30. [PubMed ID: 18227087]. https://doi.org/10.1093/jac/dkn016.
  • 12.
    Rodriguez-Martinez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53(11):4783-8. [PubMed ID: 19738025]. [PubMed Central ID: PMC2772299]. https://doi.org/10.1128/AAC.00574-09.
  • 13.
    Fair RJ, Tor Y. Antibiotics and bacterial resistance in the 21st century. Perspect Medicin Chem. 2014;6:25-64. [PubMed ID: 25232278]. [PubMed Central ID: PMC4159373]. https://doi.org/10.4137/PMC.S14459.
  • 14.
    Wilke MS, Lovering AL, Strynadka NC. Beta-lactam antibiotic resistance: a current structural perspective. Curr Opin Microbiol. 2005;8(5):525-33. [PubMed ID: 16129657]. https://doi.org/10.1016/j.mib.2005.08.016.
  • 15.
    Meskini M, Esmaeili D. The study of formulated Zoush ointment against wound infection and gene expression of virulence factors Pseudomonas aeruginosa. BMC Complement Altern Med. 2018;18(1):185. [PubMed ID: 29903005]. [PubMed Central ID: PMC6003004]. https://doi.org/10.1186/s12906-018-2251-4.
  • 16.
    Blair JM, Webber MA, Baylay AJ, Ogbolu DO, Piddock LJ. Molecular mechanisms of antibiotic resistance. Nat Rev Microbiol. 2015;13(1):42-51. [PubMed ID: 25435309]. https://doi.org/10.1038/nrmicro3380.
  • 17.
    Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE. Multiplex PCR: optimization and application in diagnostic virology. Clin Microbiol Rev. 2000;13(4):559-70. [PubMed ID: 11023957]. [PubMed Central ID: PMC88949]. https://doi.org/10.1128/CMR.13.4.559.
  • 18.
    Tajvidi N, Mahbod SA, Hosseini Shokoh SJ, Naseh I, Tajvidi MA. In-vitro resistance pattern of Escherichia coli isolated from patients with urinary tract infection in tehran. Ann Med Health Sci Res. 2013;11(4):330-4.
  • 19.
    Torshizi R, Zamanzad B, Mokhtareyan K, Karimi A. Determination of CTX-M genes in enterobacteriaceae producing extended-spectrum beta-lactamase using PCR method. J Shahrekord Uuniv Med Sci. 2011;13:9-17.
  • 20.
    Emamghorashi F, Kohanteb J. Antibiotic Resistance Pattern of E-Coli isolated from Urinary Tract Infection. Pars Jahrom Univ Med Sci. 2007;5(1):1-9.
  • 21.
    Mobasherizadeh M, Bidoki SK, Mobasherizadeh S. [Prevalence of CTX-M genes in Escherichia coli strains in outpatient and inpatient cases with urinary tract infections in Isfahan, Iran]. J Isfahan Med Sch. 2016;33(360):2019-25. Persian.
  • 22.
    Keikha M, Rava M. [Evaluation of antibiotic resistance of Escherichia coli strains isolated from urinary tract infections in outpatients referring to Nabi Akram Hospital in Zahedan]. J Paramed Sci Rehabil. 2018;6(4):73-8. Persian. https://doi.org/10.22038/jpsr.2017.21755.1556.
  • 23.
    Heidari-Soureshjani E, Heidari M, Doosti A. [Epidemiology of urinary tract infection and antibiotic resistance pattern of E. coli in patients referred to Imam Ali hospital in Farokhshahr, Chaharmahal va Bakhtiari, Iran]. J Shahrekord Univ Med Sci. 2013;15(2):9-15. Persian.
  • 24.
    Shahcheraghi F, Noveiri H, Nasiri S. Detection of bla TEM and bla SHVgenes among clinical isolates of E. coli from Tehran hospitals. Iran J Med Microbiol. 2007;1(3):1-8.
  • 25.
    Peter-Getzlaff S, Polsfuss S, Poledica M, Hombach M, Giger J, Bottger EC, et al. Detection of AmpC beta-lactamase in Escherichia coli: comparison of three phenotypic confirmation assays and genetic analysis. J Clin Microbiol. 2011;49(8):2924-32. [PubMed ID: 21653764]. [PubMed Central ID: PMC3147754]. https://doi.org/10.1128/JCM.00091-11.
  • 26.
    Mansouri S, Shareifi S. Antimicrobial resistance pattern of Escherichia coli causing urinary tract infections, and that of human fecal flora, in the southeast of Iran. Microb Drug Resist. 2002;8(2):123-8. [PubMed ID: 12118516]. https://doi.org/10.1089/107662902760190662.
  • 27.
    Jafari-Sales A, Shadi-Dizaji A. Molecular analysis of CTX-M genes among ESBL producing in Pseudomonas aeru-ginosa isolated from clinical samples by Multiplex-PCR. Hozan J Environment Sci. 2018;2(5):17-29.
  • 28.
    Hosseinpor H, Khaledi A, Esmaeili D. The properties of nanofiber scaffolds of polyurethane-Cinnamomum zeylanicum against pathogens of Pseudomonas aeruginosa and Staphylococcus aureus. Polym Bulletin. 2020;78(1):223-45. https://doi.org/10.1007/s00289-019-03095-1.
  • 29.
    Abadi AH, Mahdavi M, Khaledi A, Esmaeili SA, Esmaeili D, Sahebkar A. Study of serum bactericidal and splenic activity of Total-OMP- CagA combination from Brucella abortus and Helicobacter pylori in BALB/c mouse model. Microb Pathog. 2018;121:100-5. [PubMed ID: 29709690]. https://doi.org/10.1016/j.micpath.2018.04.050.
  • 30.
    Bahador A, Bazargani A, Taheri M, Hashemizadeh Z, Khaledi A, Rostami H, et al. Clonal lineages and virulence factors among Acinetobacter baumannii isolated from Southwest of Iran. J Pure Appl Micribiol. 2013;7:1559-66.
  • 31.
    Ghazi Hosseini SA, Einollahi B, Ebrahimi M, Fallah J, Esmaeili D. Warning of outbreak of important antibiotic resistance in strains of urology and nephrology wards. Gene Rep. 2020;20:100684. https://doi.org/10.1016/j.genrep.2020.100684.
  • 32.
    Rohani S, Heidari F, Esmaeili D. Genotyping and phenotyping patterns of Escherichia coli from UTI specimens from patients referred to the urology ward of Baqiyatallah hospital. Gene Rep. 2020;19:100594. https://doi.org/10.1016/j.genrep.2020.100594.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles