1. Background
Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is one of the most important foodborne pathogens that produces verotoxin and has been traditionally associated with foodborne infection from consumption of foods with animal origin, particularly those originating from cattle, such as ground beef and burgers (1). Hemorrhagic Colitis (HC) and Hemolytic Uremic Syndrome (HUS) are two chronic and potentially fatal illnesses caused by EHEC (2). Consumption of undercooked minced beef is the most common route of transmission of EHEC. Thousands of illnesses and hospitalizations and hundreds of deaths due to this bacterium has been reported (3).
To the best of our knowledge, isolation of the pathogenic organism from ground beef and meat products in various countries such as Republic of Ireland (4), Egypt (5), Switzerland (6), Turkey (7), Mexico (8), USA (9), Brazil (10) and China (11) has been documented. In Iran, there has been a number of assays on the isolation and the prevalence of E. coli O157:H7 in ground beef and beef products. Jafareyan reported that 10 (6.8%) of the 148 ground beef samples were contaminated with E. coli O157:H (12). Shekarforoush et al. detected verotoxigenic E. coli O157:H7 in six (3.92%) of the 153 sheep carcass samples (13) and Shahrokhabadi found that six (4.05%) of the 148 bovine carcasses samples were contaminated With the bacterium (14).
The pathogenicity of E. coli O157:H7 is affected by several virulence factors. The main factor contributing to the pathogenicity is its ability to produce potential cytotoxins called Shiga-toxins (Stx), encoded by stx1 and stx2 genes (15). Other described virulence factors include intimin, encoded by the eaeA gene and EHEC hemolysin encoded by the EHEC hlyA gene (16). Also, it has been reported that non-O157 strains could be verocytotoxigenic (17, 18).
2. Objectives
The aim of the present study was to determine the prevalence of viable Non-Sorbitol Fermenting (NSF) E. coli containing rfbE O157 and flic H7 genes and, to detect the presence of the stx1 and stx2 genes in isolates from ground beef samples obtained from butcheries in Ahvaz city, Iran.
3. Materials and Methods
3.1. Sample Preparation
A total of 200 samples of fresh ground beef were obtained from butcheries located in different parts of Ahvaz during a six-month period. Samples were transported to the laboratory under cold conditions. Samples were analyzed according to E. coli O157:H7 isolation procedures on the same day.
3.2. Isolation and Identification of Non-Sorbitol Fermenting Escherichia coli
All samples were examined for the presence of NSF E. coli by regular procedures (19). Ten grams of each sample was added to 90 mL Tryptone Soy Broth (TSB) (Quelab, Canada) supplemented with novobiocin (20 mg/L, Sigma) and homogenized. After incubation for 24 hours at 37˚C, a 100-µL suspension was spread onto Cefixime Telluride-Sorbitol MacConkey (CT-SMAC) agar (scharlau, Spain) supplemented with cefixime (0.25 mg/mL) and tellurite potassium (2.5 mg/mL). Plates were incubated for 24 hours at 37˚C and examined for typical E. coli colonies (colorless, circular with brown center). The suspected NSM E. coli colonies were plated on both Eosin-Methylene Blue agar (EMB) (Scharlau, Spain) and Tryptone Bile x-Glucoronide (TBX) (Merck, Germany) and were incubated at 37°C for 24 hours. Also, the suspected isolates were subjected to Polymerase Chain Reaction (PCR) analysis to identify virulent genes.
3.3. The Polymerase Chain Reaction Procedures
3.3.1. DNA Extraction
Extraction was performed using a modification of the method previously described by Lopez-Saucedo et al. (20). Presumptive E. coli colonies were separately grown overnight in 5 mL of TSB at 37°C. These cultures were centrifuged (Hitachi 1110, Germany), the pellet was resuspended in 1 mL of sterile distilled water, and samples were heated at 100°C for ten minutes. After heating, the suspension was again centrifuged and the supernatant was used as the PCR template.
3.3.2. Polymerase Chain Reaction and Electrophoresis
Presumptive colonies in two steps were subjected to the PCR assay for amplification of four pairs of specific primers, including: (FliC) H7 and O157 in first and stx1 and stx2 in the second steps, according to the following program for both steps: initial denaturation at 94˚C for three minutes, and then 35 cycles comprised of denaturation at 94˚C for 45 seconds, annealing at 60˚C for 45 seconds, and an extension at 72˚C for 60 seconds. Following this, a final extension at 72˚C for five minutes was carried out. Each PCR tube contained 25 μL of reaction mixture, consisting of 2.5 µL of PCR buffer (10x), 1.5 µL MgCl2 (50 mM), 1 µl dNTP (10 mM), 0.5 µl Taq polymerase (2.5 U), 4 µL of a mixture of the two forward and revised primers (15 µM), 10.5 µL of ddH2O and 5 μL of template extracted DNA. The mixture was then processed in a thermocycler (Bioer Technology Co., China). The targets, primer sequences and amplicon sizes for the PCR products are shown in Table 1.
| Primer | Size (bp) | Sequence | Reference |
|---|---|---|---|
| O157 | 259 | (21) | |
| F: 5 –CGGACATCCATGTGATATGG-3 | |||
| R: 5-TTGCCTATGTACAGCTAATCC -3 | |||
| (FliC) H7 | 625 | (22) | |
| F : 5- GCGCTGTCGAGTTCTATCGAGC -3 | |||
| R: 5- CAACGGTGACTTTATCGCCATTCC -3 | |||
| STX1 | 614 | (23) | |
| F: 5 – ACACTGGATGATCTCAGTGG-3 | |||
| R: 5- CTGAATCCCCCTCCATTATG -3 | |||
| STX2 | 779 | (23) | |
| F : 5- CCATGACAACGGACAGCAGTT -3 | |||
| R: 5- CCTGTCAACTGAGCAGCACTTTG -3 |
List of Target Genes, Sequence of Primers and Product Size (bp)
The amplified PCR products were detected by electrophoresis (Paya pajoohesh, Iran) and staining, and visualized under UV light illumination (UVT-20 SL, Iran).
4. Results
The present study focused on identification of virulent genes in NSF isolates from ground beef in Ahvaz city. A total of 23 strains of NSF E. coli were recovered from 200 meat samples (11.5%) by CT-SMAC culture agar and plating on EMB agar. Among these, 14 strains were colorless on TBX medium and probably had negative ß-glucuronidase enzyme activity. Our findings showed that two strains contained both O157 and H7 genes, one strain was O157 and nine strains were only H7 positive. Virulent stx1 and stx2 genes were found only in an O157:H7 strain (Figures 1 and 2).
1, Ladder 100 bp plus; 2, positive control (E. coli O157:H7 strain ATCC 43895); 3, negative control; 4, H7 positive isolate; 5, O157:H7 isolate; 6, O157:H7 isolate; 7, O157 isolate.
1, Ladder 100 bp plus; 2, positive control (E. coli O157:H7 strain containing stx1 and stx2 genes; culture collection of Dep. of pathobiology, University of Shiraz); 3, negative control; 4- H7 isolate; 5, O157:H7 isolate; 6, O157:H7 isolate containing stx1 and stx2 genes; 7, O157 isolate.
In conclusion, 1.5% of ground beef samples contaminated the O157 E. coli strain meanwhile 1% of samples were O157:H7 positive and 0.5% of samples were O157:H7 positive containing virulent stx1 and stx2 genes.
5. Discussion
Beef is one of the favorable consumed meats in the world. It has been noted that beef carcass and ground beef are the most important sources of E. coli O157:H7 (24). Infections caused by these bacteria could lead to diarrhea, hemorrhagic colitis or Hemolytic Uremic Syndrome (HUS) (25). The bacterium recognized as low dose foodborne pathogens (17).
In our study, serovar O157:H7, not motile O157 and non-O157 E. coli were isolated from two (1%), one (0.5%) and 20 (10%) ground beef samples, respectively, which indicates the risk of consumption of this kind of food if severely undercook. Several studies have shown that E. coli O157:H7 and other Shiga-Toxin E. coli (STEC) are present in meat products; mostly beef products. For example Cagney et al. (4) investigated the prevalence and numbers of E. coli O157:H7 in minced beef and beef burgers in supermarkets and butcheries in the Republic of Ireland. Overall, E. coli O157:H7 was recovered from 43 samples (2.80%). In France, Vernozy-Rozand et al. reported that 0.12% (4/3450) of samples were positive for E. coli O157:H7 in large-scale processed minced beef (26). Escherichia coli non-O157, E. coli O157: NM (not motile) and E. coli O157:H7 were isolated from 53 (20.5%), 13 (5%) and seven (2.7%) of the 258 beef carcasses, respectively, sampled by Varela-Hernandez in Mexico (8). Ahmed and Shimamoto recovered E. coli O157:H7 from 4.3% ground beef collected from butcheries in Egypt (5). Fantelli and Stephan detected O157:H7 in 2.3% of 213 ground beef samples (6), while this pathogen was isolated from 7.6% of 251 ground beef samples by Sarimehmetoglu, in Turkey (7). In Argentina, Chinen isolated E. coli O157:H7 from 3.8% of 161 ground beef samples (27). Other studies found very different results, ranging from 16.8% (50/296) E. coli O157:H7 samples in Washington State, USA (28) to 0%, as determined by the study of Tarr et al., which did not recover the pathogen from 1400 retail ground minced beef samples from six stores in Seattle, USA (29).
A few studies have indicated that the isolation of the bacterium in meat products in Iran. For example Rahimi (30) reported a high prevalence of E. coli O157:H7 in beef samples (8.2%), followed by water buffalo (5.3%), sheep (4.8%), camel (2.0%) and goat (1.7%). Again, in another study from Iran, high incidence of E. coli O157:H7 in ruminant's meat samples was reported by Momtaz, where, 238 (29.02%) samples were positive for the presence of E. coli. All of the isolates had more than one virulence gene including stx1, stx2, eaeA and hly (31). In South-West of Iran, E. coli O157:H7 was found in six (3.92%) of 153 sheep carcasses (13). In Isfahan, Jafareyan-Sedigh reported that 10 (6.8%) of 148 sheep meat samples were contaminated with E. coli O157:H7 (12). Shahrokhabadi recovered the pathogen from six (4.05%) of 148 cattle carcasses in Slaughterhouse of Rafsanjan (14).
Various factors such as verocytotoxin (encoded by stx1 and stx2), a protein called intimin (encoded by eaeA gene) and enterohemolysin (encoded by EHEC hlyA gene) are linked to the pathogenesis of E. coli O175:H7 (16, 21, 31). In the current study, 20 non-O175 E. coli with no virulent stx1 and stx2 genes were isolated. Meanwhile, it has been reported that non-O157 strains could also be verocytotoxigenic (17, 18). Our data showed that 14 strains were colorless on TBX medium and were assumed to be the O157 strain yet only three of them contained O157 genes. It was concluded that this medium could not be a reliable medium for the detection of O157 strains. Also, the H7 gene was identified in nine non-O157 strains and may belong to the O55 strain because the flic genes of O55:H7 and O157:H7 strains are closely related (32).
Generally, 1.5% of ground beef samples were contaminated with O157 E.coli. These kinds of products may pose risks to the health of consumers if eaten raw or undercooked. To reduce risk, the incorporation of all agents involved in the beef supply chain is necessary. Also, application of Hazard Analysis of Critical Control Points (HACCP) from the farm to the abattoir should be applied by governmental authorities. Consumers and retailers should be educated about the disease and methods of prevention. A zero tolerance policy could be useful to control E. coli O157 in meat products in the country.
