Jundishapur Journal of Microbiology

Image Credit:Jundishapur Journal of Microbiology

Frequency of qnr and aac(6’)Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran

Author(s):
Siavash   VaziriSiavash VaziriSiavash   Vaziri ORCID1, Mandana AfsharianMandana AfsharianMandana Afsharian ORCID1, Feizollah   MansouriFeizollah MansouriFeizollah   Mansouri ORCID1, Mohsen  AziziMohsen AziziMohsen  Azizi ORCID2, Fatemeh NouriFatemeh NouriFatemeh Nouri ORCID3, Nahid  Madadi-GoliNahid Madadi-GoliNahid  Madadi-Goli ORCID4, Zainab  Mohseni AfsharZainab Mohseni AfsharZainab  Mohseni Afshar ORCID1, Mohammad Hossein  ZamanianMohammad Hossein ZamanianMohammad Hossein  Zamanian ORCID1, Amirhooshang  AlvandiAmirhooshang AlvandiAmirhooshang  Alvandi ORCID2, Kamal AhmadiKamal AhmadiKamal Ahmadi ORCID2, 4,*
1Department of Infectious Disease, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran
2Department of Microbiology, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran
3Student Research Committee, Kermanshah University of Medical Sciences, Kermanshah, Iran
4Department of Mycobacteriology and Pulmonary Research, Pasteur Institute of Iran, Tehran, Iran

Jundishapur Journal of Microbiology:Vol. 13, issue 7; e100348
Published online:Sep 21, 2020
Article type:Research Article
Received:Dec 28, 2019
Accepted:Aug 31, 2020
How to Cite: Vaziri S, Afsharian M, Mansouri F, Azizi M, Nouri F, et al. Frequency of qnr and aac(6’)Ib-cr Genes Among ESBL-Producing Klebsiella pneumoniae Strains Isolated from Burn Patients in Kermanshah, Iran. Jundishapur J Microbiol. 2020;13(7):e100348. doi: https://doi.org/10.5812/jjm.100348

Abstract

Background:

Assessment of bacteria such as Klebsiella pneumonia has shown that Plasmid-mediated quinolone resistance (PMQR) affects antibiotics resistance (e.g., quinolones).

Objectives:

We studied the prevalence of qnr and aac(6’)Ib-cr genes in extended-spectrum beta-lactamase (ESBL)-producing K. pneumonia strains isolated from burn wounds of patients in the city of Kermanshah, Iran.

Methods:

This descriptive-analytical study was conducted on 126 K. pneumonia strains isolated collected from burn wounds. Biochemical tests were used to detect the strains. The frequency of the ESBL-producing isolates was determined by phenotypic tests of the combination disk (CD) method after determining the antibiotic susceptibility pattern of the isolates through the Kirby-Bauer disc diffusion test. The prevalence of the qnr and aac(6’)-Ib-cr genes was determined using their special primers as well as polymerase chain reaction (PCR).

Results:

Of the 126 K. pneumonia isolates, 52 (41.3%) were identified as ESBL-producing strains. ESBL-producing isolates showed higher resistance against antibiotics than non-ESBL-producing ones. PMQR relevance and resistance to ciprofloxacin were, respectively, determined at 80.76% and 59.6%. The most frequent gene was aac(6’)-Ib-cr (n = 70, 55.6%), followed by the qnrB (n = 44, 34.9%).

Conclusions:

This study showed a high prevalence of qnr genes in ESBL-producing K. pneumonia isolates and antibiotic resistance. Given the horizontal transmission of antibiotic resistance genes among bacteria by mobile genetic elements, timely identification of infections caused by ESBL-producing and antimicrobial-resistant K. pneumonia strains is of paramount importance.

1. Background

Nosocomial infections, also known as hospital-acquired infections, are common in burn patients due to the special features of the diseases, such as skin damage, physiological changes, prolonged hospitalization, and receiving aggressive interventions (1). Klebsiella pneumoniae belongs to the Enterobacteriaceae family and is described as a gram-negative, encapsulated, and lactose-fermenting bacteria (2) that is responsible for various hospital-acquired infections such as pneumonia, septicemia, diarrhea, liver abscess, endophthalmitis, meningitis, urinary tract infections, and bacteremia, whose mortality rates are high (3). Along with other gram-negative bacteria such as Pseudomonas aeruginosa and Acinetobacter baumannii, K. pneumonia pathogens are commonly isolated from patients with burn infections (4). Most of such infections are caused by multidrug-resistant (MDR) strains that interrupt the treatment processes (5). Besides, extended-spectrum beta-lactamase (ESBL)-producing K. pneumonia isolates are highly resistant to antibiotics, which further complicate infections and the treatment processes of burn patients. Moreover, MDR strains are resistant against beta-lactam antibiotics and different types of antibiotics, including quinolones and aminoglycosides (6). Quinolones and fluoroquinolones extensively use for the treatment of K. pneumonia-induced infections, mainly because of the resistance of these bacteria to the first-line drugs, which have led to a significant increase in resistance against them (7).
Plasmid-mediated quinolone resistance (PMQR) is mediated by the qnr genes, boosting antimicrobial resistance among bacteria due to their placement on mobile genetic elements. Therefore, PMQR also plays a significant role in quinolone resistance due to its high emission potential among Enterobacteriaceae (8). Three types of PMQR genes are identified so far, including the qnr, which is the most important one (9). In addition to resistance to quinolones, PMQR can be similarly effective in resistance against other antibiotics, especially beta-lactams and aminoglycosides (10). To date, five qnr groups are identified, including the qnrA, qnrB, qnrC, qnrD, and qnrS. Moreover, PMQR can exert its influence through two further mechanisms of QepA and OqxAB pumps and an aminoglycoside acetyltransferase known as the aac(6’)-Ib-cr, which cause reduced susceptibility against ciprofloxacin (9, 11, 12). The qnr genes also cause resistance against quinolones via inhibiting DNA gyrase and topoisomerase IV. Alongside aminoglycoside resistance, the aac(6’)-Ib-cr gene can correspondingly cause resistance against fluoroquinolones (13).

2. Objectives

No recent comprehensive research is performed on the prevalence rates of PMQR genes in K. pneumonia isolates among patients in the city of Kermanshah, Iran. Therefore, the present study aimed to determine the frequency of the qnrA, qnrB, qnrS, and aac(6’)-Ib-cr genes in K. pneumonia strains of burn wound infections collected from patients in the city of Kermanshah, Iran.

3. Methods

3.1. Isolate Collection and Recognition

The current descriptive-analytical study was conducted on 465 clinical samples collected from burn patients admitted to Imam Khomeini Hospital in Kermanshah from August 2017 to June 2018, who had burn wounds with no history of antibiotics consumption for more than a week. After collection, samples were immediately transferred to the laboratory under sterile conditions. Then, samples were cultured onto eosin methylene blue agar (EMB) and MacConkey agar (Merck Group, Germany) and subsequently incubated for 24 h at 37ºC. In total, 126 K. pneumonia isolates were detected using standard biochemical tests through culturing in triple sugar iron agar (TSI), sulfur-indole-motility (SIM), methyl red-Voges Proskauer (MRVP), citrate, and urea broths (3) (HiMedia Laboratories Pvt. Ltd.., India). Afterward, the identified K. pneumonia samples were maintained in trypticase soy broth (TSB) treated with 15% glycerol (-70°C).

3.2. Antibiotic Susceptibility Testing (AST)

The antimicrobial susceptibility patterns of samples were assessed via disk diffusion test based on the guidelines of the Clinical and Laboratory Standards Institute (CLSI) (14) for ciprofloxacin (5 μg), levofloxacin (5 μg), enrofloxacin (10 μg), ofloxacin (5 μg), gatifloxacin (5 μg), nalidixic acid (30 μg), gentamicin (10 μg), amikacin (30 μg), ceftazidime (30 μg), cefotaxime (30 μg), ceftriaxone (30 μg), and aztreonam (30 μg), as antibiotics provided by MAST (the United Kingdom). In cases that matching with the density of the 0.5 McFarland standards (1.5 × 108) was required, the concentration of the bacteria was used for antimicrobial susceptibility testing. The K. pneumonia, the American Type Culture Collection (ATCC) 700603, and the Escherichia coli, ATCC 25922 were further applied to ensure the quality of the antimicrobial susceptibility tests (3, 10).

3.3. ESBL Confirmation by Combination Disk (CD) Method

Isolates with a minimum inhibition zone diameter of 22, 25, and 27 mm, respectively, for ceftazidime, ceftriaxone, and cefotaxime were assessed for detecting ESBL genes. To confirm ESBL production, the CD method was further performed using 30 μg cefotaxime and ceftazidime disks impregnated with 10 μg clavulanic acid (MAST, the United Kingdom) on Mueller-Hinton agar (HiMedia Laboratories Pvt. Ltd., India) similar to the disc diffusion method. On the other hand, the strains with a minimum inhibition zone diameter equal to or more than 5 mm, in comparison with the single disc of the same antibiotic, were regarded as ESBL-producing (15).

3.4. Polymerase Chain Reaction (PCR)

After extracting the deoxyribonucleic acid (DNA) of the isolates by boiling, the frequency of the qnrA, qnrB, qnrS, and aac(6’)-Ib-cr genes was assessed using the PCR through special primers (Takapou Zist Co., Iran) (10), as shown in Table 1. The concentration of the DNA samples was determined at wavelength 260 nm using a NanoDrop Synergy HTX (Bio Tek Instrument, Inc Highland Park, USA) equal to 35 pmol/ul. Also, the purity of the extracted DNA at 260/280 nm was 1.85. PCR was accordingly performed using the total 25 μL volume, including Master mix (12.5 μL) (Sinoclon Co., Iran), 1 μL of the primers, bacterial DNA (2 μL), and sterilized distilled water until reaching 25 μL. The following stages were included in the PCR protocol: initial denaturation (94ºC/5 min), 30 main cycles according to Table 1, and extension (10 min/72ºC). The E. coli J53 strains, including pMG252, pMG298, and pMG306, were also considered, respectively, as positive controls of the qnrA, qnrB, and qnrS genes. Then, 1% agarose gel was applied for electrophoresis of the PCR yields, and the product was consequently stained by ethidium bromide.
Table 1.Primers and Temperature Cycles Used in PCR (30 Cycles)
PrimerSequence (5’-3’)Denaturation, 94ºCAnnealing, 1 minExtension, 72ºCProduct Size (bp)
qnrATTCTCACGCCAGGATTTGAG TGCCAGGCACAGATCTTGAC1 min57ºC1 min571
qnrBTGGCGAAAAAATTGAACAGAA GAGCAACGATCGCCTGGTAG1 min57ºC1 min594
qnrSGACGTGCTAACTTGCGTGAT AACACCTCGACTTAAGTCTGA1 min57ºC1 min388
aac (6’)-Ib-crTTGCGATGCTCTATGAGTGGCTA CTCGAATGCCTGGCGTGTTT1 min54ºC1 min482

3.5. Statistical Analysis

Data were analyzed using the IBM SPSS Statistics version 20 via the chi-square test and Fisher’s exact test. As well, P values less than 0.05 were considered statistically significant.

4. Results

Analyzing 126 K. pneumonia isolates showed a prevalence of 73 (57.9%) and 53 (42.1%) for males and females, respectively. The mean age of participants was 36.11 ± 48.42, and the youngest and oldest participants were 11 and 73 years, respectively. Most of the isolates (44 or 34.9%) with K. pneumonia were taken from patients aged 31 to 45 years, and the lowest was from patients less than 6 years (6 or 4.8%). All isolates were obtained from patients with burn wounds admitted to Imam Khomeini Hospital in the city of Kermanshah (Iran). The prevalence rate of MDR isolates was 54.8% (69 isolates). Based on the findings of the phenotypic test, 52 (41.3%) isolates (out of the 126) were ESBL-producing. In the positive ESBL isolates, the frequency of MDR isolates was 46 (88.5%). According to Table 2, the ESBL-producing isolates indicated more antimicrobial resistance than non-ESBL-producing samples (P < 0.05). The highest antimicrobial resistance level in ESBL-producing and non-ESBL-producing K. pneumonia isolates was against ceftriaxone (90.4%) and nalidixic acid (47.3%), respectively. In addition, the highest level of susceptibility in ESBL-producing and non-ESBL-producing samples was, respectively, against gatifloxacin (40.4%) and amikacin (10.9%) (Table 2).
Table 2.Results of Antibiotic Resistance Patterns in Positive and Negative ESBL-producing Klebsiella pneumonia Isolatesa
AntibioticsAll Strains (N = 126)ESBL Positive (N = 52)ESBL Negative (N = 74)P Value
RSIRSIRSI
NA69 (54.8)51 (40.5)6 (4.8)34 (65.4)16 (30.8)2 (3.8)35 (47.3)35 (47.3)4 (5.4)0.108
CIP66 (52.4)52 (41.3)8 (6.3)31 (59.6)16 (30.8)5 (9.6)35 (47.3)36 (48.6)3 (4.1)0.030b
LEV43 (34.1)76 (60.3)7 (5.6)23 (44.3)29 (55.7)020 (27)47 (63.5)7 (9.5)0.875
OFX48 (38.1)72 (57.1)6 (4.8)24 (46.2)26 (50)2 (3.8)24 (32.4)46 (62.2)4 (5.4)0.320
NOR59 (46.8)58 (46)9 (7.1)27 (52)23 (44.3)2 (3.8)32 (43.2)35 (47.3)7 (9.5)0.820
GAT38 (30.2)88 (69.8)021 (40.4)31 (59.6)017 (23)57 (77)00.029b
AK42 (33.3)82 (65.1)2 (1.6)34 (65.4)17 (32.7)1 (1.9)8 (10.9)65 (87.8)1 (1.3)0.0001b
GM52 (41.3)72 (57.1)2 (1.6)37 (71.2)14 (26.9)1 (1.9)15 (20.3)58 (78.4)1 (1.3)0.0001b
CTX57 (45.2)69 (54.8)045 (86.5)7(13.5)012 (16.2)62 (83.8)00.0001b
CAZ52 (41.3)72 (57.1)2 (1.6)43 (82.7)19 (17.3)09 (12.2)63 (85.1)00.0001b
CRO61 (48.4)65 (51.6)047 (90.4)5(9.6)014 (19)60 (81)00.0001b
ATM51 (40.5)75 (59.5)042 (80.8)10 (19.2)09 (12.2)65 (87.8)00.0001b

Abbreviations: AK, Amikacin; ATM, Aztreonam; CAZ, Ceftazidime; CIP, Ciprofloxacin; CRO, Ceftriaxone; CTX, Cefotaxime; GAT, Gatifloxacin; GM, Gentamicin; LEV, Levofloxacin; NA, Nalidixic Acid; NOR, Norfloxacin; OFX, Ofloxacin

aValues are expressed as No. (%).

bSignificant

Furthermore, PMQR genes were detected in 62.7% (n = 79) of 126 K. pneumonia isolates, of which 80.76% (n = 42) isolates were ESBL-producing. aac(6’)-Ib-cr was the most common gene resistant against quinolones (n = 70, 55.6%), followed by the qnrB (n = 44, 34.9%). Moreover, the simultaneous presence of resistance genes was observed in 37 strains with the qnrB and aac(6’)-Ib-cr (Figure 1). ESBL-producing samples correspondingly revealed more frequency regarding these genes (Table 3). These results indicated a significant correlation between the qnrB and aac(6’)-Ib-cr genes and resistance against most of the evaluated antibiotics, especially cephalosporins and aminoglycosides (P < 0.05). The PCR results for the detection of these genes are described in Figure 2.
Frequency of genes in single and multiple <i>Klebsiella pneumoniae</i> isolates
Figure 1.

Frequency of genes in single and multiple Klebsiella pneumoniae isolates

(Gel electrophoresis of PCR products of <i>qnr</i>) <i>qnrB</i>: 1- Lader (100 bp), 2- Negative control, 3- Positive control (594 bp), 4- Positive sample (594 bp): <i>qnrS</i>: 1- Lader (100 bp), 2- Negative control, 3- Positive sample (388 bp), 4- Positive control (388 bp): <i>aac(6’)-Ib-cr</i>: 1- Lader (100 bp), 2- Positive control (482 bp), 3- Positive sample (482 bp), 4- Negative control
Figure 2.

(Gel electrophoresis of PCR products of qnr) qnrB: 1- Lader (100 bp), 2- Negative control, 3- Positive control (594 bp), 4- Positive sample (594 bp): qnrS: 1- Lader (100 bp), 2- Negative control, 3- Positive sample (388 bp), 4- Positive control (388 bp): aac(6’)-Ib-cr: 1- Lader (100 bp), 2- Positive control (482 bp), 3- Positive sample (482 bp), 4- Negative control

Table 3.Frequency of Genes in Positive and Negative ESBL-producing Klebsiella pneumonia Isolates
GenesESBL PositiveESBL NegativeP Value
qnrA00-
qnrB24200.022a
qnrS640.179
aac(6’)-Ib-cr39310.0001a

aSignificant

5. Discussion

Klebsiella pneumonia is an opportunistic emerging pathogen that causes nosocomial infections. Quinolones are commonly used for treating infections caused by the Enterobacteriaceae species, including K. pneumonia. On the other hand, increased resistance to these antibiotics is associated with severe therapeutic outcomes (16). The present study aimed to evaluate the prevalence of quinolone resistance genes in ESBL-producing K. pneumoniae strains isolated from burn wounds. Most of the K. pneumonia positive isolates were found in males aged 31 to 45 years. Of the 126 K. pneumonia isolates, 69 (54.8%) were MDR and 52 (41.3%) ESBL-producing. According to the literature, the prevalence of ESBL-producing strains in Iran ranges from 12 to 72% (17-19). More than 88% of positive ESBL isolates were MDR.
Based on the previous studies, the frequency of MDR in the ESBL-producing K. pneumonia isolates ranges from 63.33 to 92%. That is consistent with the findings of the current study (5, 20-22). Accordingly, more than 86% of ESBL-producing strains were resistant against cephalosporins. Meanwhile, a study conducted in Iran has reported that almost all ESBL-producing strains were resistant to these antibiotics (23). Based on the findings, in the present study, the resistance of the ESBL-producing strains against aminoglycosides (68.3%) was higher than those reported by Goudarzi et al. (46.35%), Shams et al. (45%), and Eftekhar (36.7%) (10, 13, 22). Moreover, more than 50% of the ESBL-producing K. pneumonia isolates were resistant against fluoroquinolones, and the highest and lowest resistance was, respectively, found against nalidixic acid (65.4%) and gatifloxacin (40.4%). According to studies conducted in Iran, 37.5 - 80% of ESBL-producing K. pneumonia isolates are resistant to ciprofloxacin (10, 22, 24). In the present study, resistance against this antibiotic was 59.6% in ESBL-producing isolates. The global trend of resistance to fluoroquinolones in ESBL-producing bacteria is on the rise (25). Nevertheless, these conflicting results may be due to the difference in antibiotic susceptibility patterns, treatment regimens, types of isolates, geographical differences, and variations in health care control systems at medical centers (3).
PMQR genes play a significant role in resistance against quinolones and fluoroquinolones among ESBL-producing K. pneumonia isolates. The association between PMQR genes with resistance to quinolone and antibiotic-resistant K. pneumonia is reported by several studies (26). Most of the resistant isolates were found in K. pneumonia isolates (27, 28). In the present study, 79 (62.7%) out of 126 K. pneumoniae isolates harbored PMQR genes. However, PMQR determinants were found in 80.76% of ESBL-producing isolates. Based on the studies conducted in Iran, the prevalence of PMQR genes in K. pneumonia isolates ranges from 39.5 to 89.1% (10, 13, 26, 27, 29, 30), while in other countries it ranges from 11.1 to 100% (e.g., South Korea, the United States, and Syria) (31-33). Generally, susceptibility to quinolones and aminoglycosides is lower in species harboring the acetyltransferase aac(6’)-Ib-cr gene. In this study, the most common plasmid gene in K. pneumonia strains was the aac(6’)-Ib-cr (55.6%), as reported by several studies (34).
In the study by Kim et al., performed in South Korea, 55.3% of the isolates (n = 85) were carrying the aac(6’)-Ib-cr gene, which is consistent with the findings of the present study (35). In other studies performed by Goudarzi in Iran (city of Tehran) and Yang in Korea, the prevalence of aac(6’)-Ib-cr gene is reported as 68.8% and 77.5%, respectively, which is higher than the prevalence reported in the present study (13, 31). Moghadam et al. reported a prevalence of 31.8% for aac(6’)-Ib-cr gene (20). It worth noting that PMQR is mediated by the qnr genes, which can promote the rapid development of antibacterial resistance in the Enterobacteriaceae species due to being located on various integrons (9). In the current study, qnrB was the dominant gene (34.9%) of qnr genes. According to the studies performed in Iran, the prevalence of qnrB gene ranges from 1.6% - 88.9% (10, 13, 22). While studies conducted in other countries reported the qnrB as the most common qnr gene in K. pneumonia species (36-38).
In the present study, none of the isolates was carrying the qnrA gene, but in the study by Moghadam et al., the frequency of this gene is determined as 5.6% (20). Similar to the results of the current study, Hassuna et al., in a study performed in Egypt, couldn’t detect qnrA gene in K. pneumoniae isolates (39). The co-presence of the aac(6’)-Ib-cr and the qnrB genes in E. coli and K. pneumonia samples is also reported in various conducted all around the world (27, 40-42). The isolates carrying both genes are more resistant to aminoglycosides, cephalosporins, and quinolones, compared to those only harboring the aac(6’)-Ib-cr gene, which highlights the pivotal role of the qnrB in forming this type of resistance. Other resistance mechanisms, such as mutations in the gyrA and gyrC genes or existing of QepA inoculation pump, may also be responsible for high antibiotics resistance (43). In the present study, 37 (29.3%) isolates were simultaneously harboring qnrB and aac(6’)-Ib-cr genes. In studies performed by Alheib (in Syria) and Eftekhar (in the city of Tehran, Iran), 8 (33.3%) and 21 (50%) isolates were simultaneously carrying aac(6’)-Ib-cr and the qnrB genes, indicating a higher prevalence of antibiotic resistance compared to what was observed in the present study (10, 33).
Based on the study findings, the highest frequency of the qnr genes was observed in quinolone-resistant isolates. The highest prevalence rate of these genes was also reported in isolates resistant to quinolone (37). In the ESBL-producing K. pneumonia strains examined in the present study, the frequency of the qnrB and qnrS genes was 46.1% (24 isolates) and 11.5% (6 isolates), respectively. In ESBL-producing isolates studied by Dehghan Benadkouki et al., 30 were carrying only one of the qnr genes, including the qnrB (n = 12, 45.7%) and qnrS (n = 7, 15.3%), which to a great extent is in line with the findings of the present study (23). According to Shams et al., 51.7% of ESBL-producing isolates were harboring the qnr genes (22). The findings of studies in the United States, Malaysia, and China on the prevalence of qnr genes in ESBL-producing K. pneumonia isolates indicated a prevalence of 11.1, 48.9, and 65.5%, respectively (32, 37, 44).

5.1. Conclusions

This study showed high resistance to aminoglycosides and cephalosporins, as well as a comparatively high prevalence of fluoroquinolone-resistance genes in ESBL-producing K. pneumonia strains collected from burn patients in the city of Kermanshah (Iran). Also, ESBL-producing K. pneumonia isolates showed higher antibiotic resistance and more qnr genes were detected among them. Since burn patients experience severe life-threatening infections and due to the high antibiotic resistance in bacterial isolates inducing such infections, the results of this study are useful for developing plans to address the spread of resistant strains as well as the controlling antibiotic resistance.

Acknowledgments

Footnotes

References

  • 1.
    Perween N, PraKaSh SK, Siddiqui O. Multi drug resistant klebsiella isolates in burn patients: a comparative study. J Clin Diagn Res. 2015;9(9):DC14. [PubMed ID: 26500905]. [PubMed Central ID: PMC4606234]. https://doi.org/10.7860/JCDR/2015/13837.6576.
  • 2.
    Lari AR, Azimi L, Rahbar M, Alaghehbandan R, Sattarzadeh-Tabrizi M. First report of Klebsiella pneumonia carbapenemase-producing Pseudomonas aeruginosa isolated from burn patients in Iran: phenotypic and genotypic methods. GMS hygiene and infection control. 2014;9(1). [PubMed ID: 24653970]. [PubMed Central ID: PMC4606234]. https://doi.org/10.3205/dgkh000226.
  • 3.
    Vaziri S, Mansouri F, Abiri R, Alvandi A, Mortazavi SH, Ahmadi K, et al. Prevalence study of extended spectrum beta-lactamase in klebsiella pneumonia isolated from patients with ventilator-associated pneumonia in Kermanshah City, Iran. J Isfahan Med Sch. 2017;35(444):1113-9.
  • 4.
    Beige F, Salehi MB, Bahador N, Mobasherzadeh S. Plasmid mediated antibiotic resistance in isolated bacteria from burned patients. Jundishapur J Microbiol. 2015;8(1). e13567. [PubMed ID: 25789121]. [PubMed Central ID: PMC4350045]. https://doi.org/10.5812/jjm.13567.
  • 5.
    Maleki N, Tahanasab Z, Mobasherizadeh S, Rezaei A, Faghri J. Prevalence of CTX-M and TEM β-lactamases in Klebsiella pneumoniae isolates from patients with urinary tract infection, Al-Zahra hospital, Isfahan, Iran. Adv Biomed Res. 2018;7. [PubMed ID: 29456981]. [PubMed Central ID: PMC5812061]. https://doi.org/10.4103/abr.abr_17_17.
  • 6.
    Ghotaslou R, Sadeghi MR, Akhi MT, Hasani A, Asgharzadeh M. Prevalence and antimicrobial susceptibility patterns of ESBL, ampC and carbapenemase-producing enterobactericeae isolated from hospitalized patients in Azerbaijan, Iran. Iran J Pharm Res. 2018;17(Suppl):79. [PubMed ID: 29796032]. [PubMed Central ID: PMC5958327].
  • 7.
    Gallini A, Degris E, Desplas M, Bourrel R, Archambaud M, Montastruc J-L, et al. Influence of fluoroquinolone consumption in inpatients and outpatients on ciprofloxacin-resistant Escherichia coli in a university hospital. J Antimicrob Chemother. 2010;65(12):2650-7. [PubMed ID: 20876240]. https://doi.org/10.1093/jac/dkq351.
  • 8.
    Kammili N, Rani M, Styczynski A, latha M, Pavuluri PR, Reddy V, et al. Plasmid-mediated antibiotic resistance among uropathogens in primigravid women—Hyderabad, India. PloS One. 2020;15(5). e0232710. [PubMed ID: 32384111]. [PubMed Central ID: PMC7209122]. https://doi.org/10.1371/journal.pone.0232710.
  • 9.
    Jacoby GA, Strahilevitz J, Hooper DC. Plasmid-mediated quinolone resistance. Microbiol Spectr. 2014;2(5). [PubMed ID: 25584197]. [PubMed Central ID: PMC4288778]. https://doi.org/10.1128/microbiolspec.PLAS-0006-2013.
  • 10.
    Eftekhar F. Prevalence of qnr and aac (6’)-Ib-cr Genes in clinical isolates of Klebsiella Pneumoniae from Imam Hussein Hospital in Tehran. Iran J Med Sci. 2015;40(6):515. [PubMed ID: 26538780]. [PubMed Central ID: PMC4628142].
  • 11.
    Ruiz E, Sáenz Y, Zarazaga M, Rocha-Gracia R, Martínez-Martínez L, Arlet G, et al. qnr, aac (6′)-Ib-cr and qepA genes in Escherichia coli and Klebsiella spp.: genetic environments and plasmid and chromosomal location. J Antimicrob Chemother. 2012;67(4):886-97. [PubMed ID: 22223228]. https://doi.org/10.1093/jac/dkr548.
  • 12.
    Rodríguez-Martínez JM, Díaz de Alba P, Briales A, Machuca J, Lossa M, Fernández-Cuenca F, et al. Contribution of OqxAB efflux pumps to quinolone resistance in extended spectrum- β-lactamase-producing Klebsiella pneumoniae. J Antimicrob Chemother. 2013;68(1):68-73. [PubMed ID: 23011289]. https://doi.org/10.1093/jac/dks377.
  • 13.
    Goudarzi M, Azad M, Seyedjavadi SS. Prevalence of Plasmid-Mediated Quinolone Resistance Determinants and OqxAB Efflux Pumps among Extended-Spectrum -Lactamase Producing Klebsiella pneumoniae Isolated from Patients with Nosocomial Urinary Tract Infection in Tehran, Iran. Scientifica. 2015;2015:7. [PubMed ID: 26301114]. [PubMed Central ID: PMC4537771]. https://doi.org/10.1155/2015/518167.
  • 14.
    Wayne PA. Clinical and Laboratory Standards Institute : Performance standards for antimicrobial susceptibility testing : 20th informational supplement. CLSI document M100-S20. 2014.
  • 15.
    Mansouri S, Kalantar Neyestanaki D, Shokoohi M, Halimi S, Beigverdi R, Rezagholezadeh F, et al. Characterization of AmpC, CTX-M and MBLs types of β-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli producing Extended Spectrum β-lactamases in Kerman, Iran. Jundishapur J Microbiol. 2014;7(2). e8756. https://doi.org/10.5812/jjm.8756.
  • 16.
    Emami S, Shafiee A, Foroumadi A. Quinolones: Recent Structural and Clinical Developments. Iran J Pharm Res. 2010;4(3):123-36. https://doi.org/10.22037/ijpr.2010.628.
  • 17.
    Behrooozi A, Rahbar M, Jalil V. Frequency of extended spectrum beta-lactamase (ESBLs) producing Escherichia coli and Klebseilla pneumonia isolated from urine in an Iranian 1000-bed tertiary care hospital. Afr J Microbiol Res. 2010;4(9):881-4.
  • 18.
    Bagheri-Nesami M, Rafiei A, Eslami G, Ahangarkani F, Rezai MS, Nikkhah A, et al. Assessment of extended-spectrum β-lactamases and integrons among Enterobacteriaceae in device-associated infections: multicenter study in north of Iran. Antimicrob Resist Infect Control. 2016;5(52):1-8. [PubMed ID: 27980729]. [PubMed Central ID: PMC5134273]. https://doi.org/10.1186/s13756-016-0143-2.
  • 19.
    Feizabadi M, Mahamadi-Yeganeh S, Mirsalehian A, Mirafshar SM, Mahboobi M, Nili F, et al. Genetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010;4(10):609-15. [PubMed Central ID: PMC21045352]. https://doi.org/10.3855/jidc.1059.
  • 20.
    Moghadam MT, Shariati A, Mirkalantari S, Karmostaji A. The complex genetic Region Conferring transferable antibiotics resistance in MDR and XDR Klebsiella pneumoniae clinical isolates. New Microbes New Infect. 2020:100693. [PubMed ID: 32670591]. [PubMed Central ID: PMC7339125]. https://doi.org/10.1016/j.nmni.2020.100693.
  • 21.
    Tahanasab Z, Mobasherizadeh S, Moghadampour M, Rezaei A, Maleki N, Faghri J. High prevalence of multiple drug resistance among ESBLs-producing Klebsiella pneumoniae isolated from hospitalized patients in Isfahan, Iran. J Med Bacteriol. 2016;5(5-6):29-38.
  • 22.
    Shams E, Firoozeh F, Moniri R, Zibaei M. Prevalence of Plasmid-Mediated Quinolone Resistance Genes among Extended-Spectrum β -Lactamase-Producing Klebsiella pneumoniae Human Isolates in Iran. J Pathog. 2015;2015:1-7. [PubMed ID: 26618005]. [PubMed Central ID: PMC4649097]. https://doi.org/10.1155/2015/434391.
  • 23.
    Dehghan Banadkouki A, Eslami G, Zandi H, Dehghan Banadkouki A. Prevalence of qnr genes in extended-spectrum β-lactamase producing Klebsiella pneumoniae isolated from clinical urine specimens in university teaching hospitals, Iran. Int J Med Lab. 2017;4(1):25-33.
  • 24.
    Izadi N, Nasab MN, Mood EH, Meshkat Z. The Frequency of qnr Genes in Extended-Spectrum β-lactamases and non-ESBLs Klebsiella pneumoniae Species Isolated from Patients in Mashhad, Iran. Iran J Pathol. 2017;12(4):377. [PubMed ID: 29563934]. [PubMed Central ID: PMC5844683].
  • 25.
    Pai H, Seo M, Choi TY. Association of QnrB determinants and production of extended-spectrum β-lactamases or plasmid-mediated AmpC β-lactamases in clinical isolates of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2007;51(1):366-8. [PubMed ID: 17074790]. [PubMed Central ID: PMC1797679]. https://doi.org/10.1128/AAC.00841-06.
  • 26.
    Bouchakour M, Zerouali K, Claude JDPG, Amarouch H, El Mdaghri N, Courvalin P, et al. Plasmid-mediated quinolone resistance in expanded spectrum beta lactamase producing enterobacteriaceae in Morocco. J Infect Dev Countries. 2010;4(12):779-803. [PubMed ID: 21252459]. https://doi.org/10.3855/jidc.796.
  • 27.
    Karah N, Poirel L, Bengtsson S, Sundqvist M, Kahlmeter G, Nordmann P, et al. Plasmid-mediated quinolone resistance determinants qnr and aac (6′)-Ib-cr in Escherichia coli and Klebsiella spp. from Norway and Sweden. Diagn Microbiol Infect Dis. 2010;66(4):425-31. [PubMed ID: 20226333]. https://doi.org/10.1016/j.diagmicrobio.2009.12.004.
  • 28.
    Briales A, Rodríguez-Martínez JM, Velasco C, de Alba PD, Rodriguez-Bano J, Martinez-Martinez L, et al. Prevalence of plasmid-mediated quinolone resistance determinants qnr and aac (6′)-Ib-cr in Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain. Int J Antimicrob Agents. 2012;39(5):431-4. [PubMed ID: 22365240]. https://doi.org/10.1016/j.ijantimicag.2011.12.009.
  • 29.
    Peymani A, Farivar TN, Nikooei L, Najafipour R, Javadi A, Pahlevan AA. Emergence of plasmid-mediated quinolone-resistant determinants in Klebsiella pneumoniae isolates from Tehran and Qazvin provinces, Iran. J Prev Med Hyg. 2015;56(2). E61. [PubMed ID: 26789990]. [PubMed Central ID: PMC4718354].
  • 30.
    Zamani A, Mashouf RY, Namvar AME, Alikhani MY. Detection of magA Gene in Klebsiella spp. Isolated from clinical samplesdetection of magA. Iran J Basic Med Sci. 2013;16(2):173. [PubMed ID: 24298386]. [PubMed Central ID: PMC3843861].
  • 31.
    Yang HY, Nam YS, Lee HJ. Prevalence of plasmid-mediated quinolone resistance genes among ciprofloxacin-nonsusceptible Escherichia coli and Klebsiella pneumoniae isolated from blood cultures in Korea. Can J Infect Dis Med Microbiol. 2014;25(3):163-9. [PubMed ID: 25285114]. [PubMed Central ID: PMC4173980]. https://doi.org/10.1155/2014/329541.
  • 32.
    Wang M, Sahm DF, Jacoby GA, Hooper DC. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob Agents Chemother. 2004;48(4):1295-9. [PubMed ID: 15047532]. [PubMed Central ID: PMC375335]. https://doi.org/10.1128/AAC.48.4.1295-1299.2004.
  • 33.
    Alheib O, Al Kayali R, Abajy MY. Prevalence of plasmid-mediated quinolone resistance (PMQR) determinants among extended spectrum beta-lactamases (ESBL)-producing isolates of Escherichia coli and Klebsiella pneumoniae in Aleppo, Syria. Arch Clin Infect Dis. 2015;10(3). https://doi.org/10.5812/archcid.20631.
  • 34.
    Robicsek A, Strahilevitz J, Jacoby GA, Macielag M, Abbanat D, Hye Park C, et al. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat Med. 2005;12(1):83-8. [PubMed ID: 16369542]. https://doi.org/10.1038/nm1347.
  • 35.
    Kim YT, Jang JH, Kim HC, Kim H, Lee KR, Park KS, et al. Identification of strain harboring both aac(6')-Ib and aac(6')-Ib-cr variant simultaneously in Escherichia coli and Klebsiella pneumoniae. BMB Rep. 2011;44(4):262-6. [PubMed ID: 21524352]. https://doi.org/10.5483/BMBRep.2011.44.4.262.
  • 36.
    Wang A, Yang Y, Lu Q, Wang Y, Chen Y, Deng L, et al. Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infect Dis. 2008;8(1):68. [PubMed ID: 18498643]. [PubMed Central ID: PMC2409344]. https://doi.org/10.1186/1471-2334-8-68.
  • 37.
    Saiful Anuar AS, Mohd Yusof MY, Tay ST. Prevalence of plasmid-mediated qnr determinants and gyrase alteration in Klebsiella pneumoniae isolated from a university teaching hospital in Malaysia. Eur Rev Med Pharmacol Sci. 2013;17(13):1744-7. [PubMed ID: 23852897]. [PubMed Central ID: PMC23852897].
  • 38.
    Al-Marzooq F, Mohd Yusof MY, Tay ST. Molecular Analysis of Ciprofloxacin Resistance Mechanisms in Malaysian ESBL-Producing Klebsiella pneumoniae Isolates and Development of Mismatch Amplification Mutation Assays (MAMA) for Rapid Detection of gyrA and parC Mutations. BioMed Res Int. 2014;2014:10. [PubMed ID: 24860827]. [PubMed Central ID: PMC4000930]. https://doi.org/10.1155/2014/601630.
  • 39.
    Hassuna NA, AbdelAziz RA, Zakaria A, Abdelhakeem M. Extensively-Drug Resistant Klebsiella pneumoniae Recovered From Neonatal Sepsis Cases From a Major NICU in Egypt. Front Microbiol. 2020;11(1375). [PubMed ID: 32636828]. [PubMed Central ID: PMC7317144]. https://doi.org/10.3389/fmicb.2020.01375.
  • 40.
    Martínez-Martínez L, Eliecer Cano M, Manuel Rodríguez-Martínez J, Calvo J, Pascual Á. Plasmid-mediated quinolone resistance. Expert Rev Anti-infect Ther. 2008;6(5):685-711. [PubMed ID: 18847406]. https://doi.org/10.1586/14787210.6.5.685.
  • 41.
    Poirel L, Cattoir V, Nordmann P. Is plasmid-mediated quinolone resistance a clinically significant problem? Clin Microbiol Infect. 2008;14(4):295-7. [PubMed ID: 18190576]. https://doi.org/10.1111/j.1469-0691.2007.01930.x.
  • 42.
    Poirel L, Nordmann P. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J Antimicrob Chemother. 2005;56(3):463-9. [PubMed ID: 16020539]. https://doi.org/10.1093/jac/dki245.
  • 43.
    Hooper DC, Jacoby GA. Mechanisms of drug resistance: quinolone resistance. Ann New York Acad Sci. 2015;1354(1):12-31. [PubMed ID: 26190223]. [PubMed Central ID: PMC4626314]. https://doi.org/10.1111/nyas.12830.
  • 44.
    Yang H, Chen H, Yang Q, Chen M, Wang H. High Prevalence of Plasmid-Mediated Quinolone Resistance Genes qnr and aac (6′)-Ib-cr in Clinical Isolates of Enterobacteriaceae from Nine Teaching Hospitals in China. Antimicrob Agents Chemother. 2009;53(2):847. [PubMed Central ID: PMC2592877]. https://doi.org/10.1128/AAC.00830-08.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles