Logo
Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Potential Effectiveness of Piperacillin/Tazobactam in Treating Pediatric Patients Infected with IMP-Type Carbapenemase-Producing Enterobacteriaceae

Author(s):
Xiu-Qin JiaXiu-Qin JiaXiu-Qin Jia ORCID1, Feng  PangFeng PangFeng  Pang ORCID2,*, Juan-Juan XuJuan-Juan XuJuan-Juan Xu ORCID1, Ming XinMing XinMing Xin ORCID1, Jian ZhangJian ZhangJian Zhang ORCID3
1The Key Laboratory of Molecular Pharmacology, Liaocheng People's Hospital, Liaocheng, China
2Department of Clinical Laboratory, Liaocheng People's Hospital, Liaocheng, China
3Institute of Immunopharmaceutical Sciences, School of Pharmaceutical Sciences, Shandong University, Jinan, China


Jundishapur Journal of Microbiology:Vol. 13, issue 12; e103118
Published online:Mar 07, 2021
Article type:Research Article
Received:Aug 16, 2020
Accepted:Feb 19, 2021
How to Cite:Xiu-Qin JiaFeng PangJuan-Juan XuMing XinJian ZhangPotential Effectiveness of Piperacillin/Tazobactam in Treating Pediatric Patients Infected with IMP-Type Carbapenemase-Producing Enterobacteriaceae.Jundishapur J Microbiol.2021;13(12):e103118.https://doi.org/10.5812/jjm.103118.

Abstract

Background:

The resistance rate of carbapenem-resistant Enterobacteriaceae (CRE) is increasing yearly but rarely reported in children.

Objectives:

This retrospective study analyzed the characteristics of isolated CRE strains in pediatric patients, intending to explore reasonable antimicrobial treatment options.

Methods:

Some CRE isolates were collected from infected pediatric patients in Liaocheng People’s Hospital from January 2014 to December 2019. The strain identification and antimicrobial susceptibility testing were conducted using Vitek mass spectrometry and the Vitek 2 system, respectively. The carbapenemase genotypes of blaKPC, blaIMP, blaVIM, blaNDM-1, and blaOXA-48 were each detected by polymerase chain reaction and sequencing. The molecular homology analysis of strains was conducted via Pulse-field Gel Electrophoresis (PFGE). The clinical data of CRE-infected pediatric patients were collected from the hospital’s medical data information system.

Results:

Twenty CRE strains were isolated from 1945 infected pediatric patients with Enterobacteriaceae. All CRE strains showed multiple resistance to commonly used antimicrobials. Twelve strains of imipenemase (IMP)-4 and seven strains of IMP-8 carbapenemase were confirmed. Besides, PFGE revealed that two strains of Escherichia coli and three of Klebsiella pneumoniae had indistinguishable patterns. Sixteen patients were cured, including 10 patients using piperacillin/tazobactam.

Conclusions:

This study found the major sources of resistance were IMP carbapenemases. Piperacillin/tazobactam is potentially effective for the treatment of CRE infection, despite insensitivity in vitro.

1. Background

In recent years, carbapenem-resistant Enterobacteriaceae (CRE) species have become a serious public health threat (1-3). Common nosocomial infectious agents of Enterobacteriaceae include Escherichia coli, Klebsiella pneumoniae, Enterobacter cloacae, Serratia marcescens, etc. In children, CRE infection is uncommon but can cause significant mortality and long-term hospitalization (4, 5). For children with CRE infection, the choice of treatment drugs is more limited due to the multi-drug resistance of CRE and the drug restriction of children (6-9). The CRE species have multiple mechanisms of drug resistance, mainly through the production of carbapenemases, which challenges the selection of antimicrobial agents for treating infection (1, 3, 10).

Strains that exhibit resistance to carbapenems have been identified as containing the bla gene, including class A (KPC, or K. pneumonia carbapenemase), class B (VIM [Verona integron-mediated metallo-β-lactamase], IMP [imipenemase], and NDM [New Delhi metallo-β-lactamase]), and class D (OXA-48 [oxacillinase]) carbapenemases (11). However, the genotypes and infection sites of infected individuals have been inconsistent among various reports, and the subjects have been primarily adults. There have been a few genotypic studies and treatment programs for children, due to the lack of data from randomized evaluations of various therapeutic approaches. Therefore, treatment options for children with CRE infection must refer to the adult literature, with potentially inappropriate choices of antibiotics.

2. Objectives

The present retrospective study reviewed cases of pediatric CRE infection that occurred at a tertiary general hospital in China. Due to the lack of specific drugs for CRE infection, we empirically selected piperacillin/tazobactam as the treatment drug based on previous drug sensitivity results. Meanwhile, we tested the genotype of CRE strains infecting children to study the future treatment plan of this type of strain.

3. Methods

3.1. Setting and Study Design

The inclusion criteria were children (age < 14 years) hospitalized in Liaocheng People’s Hospital in China from January 2014 to December 2019. Isolates included in this study were CRE strains that showed resistance to at least one carbapenem antibiotic. The research strains were obtained from qualified specimens associated with definite infection, based on the results of smear and culture, combined with clinical manifestations. The CRE isolates were consistently preserved at -80°C for research on drug resistance or nosocomial infection control. The included pediatric patients were treated in different districts of pediatric wards. The clinical infection data were compiled until death or hospital discharge, including ward, treatment, and outcome. The cases that could not be traced back were excluded.

3.2. Bacterial Identification and Susceptibility Testing

Non-duplicate Enterobacteriaceae strains were isolated and sorted in accordance with the time of isolation. The strain identification was performed using an automated mass spectrometry detection system (Vitek MS, bioMerieux, France). Antibiotic susceptibility was adjudged by the broth dilution method according to Clinical and Laboratory Standards Institute (CLSI) breakpoint definitions (12). If the minimum inhibitory concentration (MIC) to ertapenem was elevated (MIC ≥ 2 µg/mL), further testing by the Modified Hodge test (MHT) was performed as a phenotypic confirmatory method to investigate the mechanism of resistance (13).

3.3. Detection of Carbapenemases

We used the fragmentation method to extract plasmid DNA from bacteria and amplify the genes of blaKPC, blaIMP, blaVIM, blaOXA-48, and blaNDM-1, as in our previous studies (13). The primer sequences are shown in Table 1. Then, amplified DNA was directly subjected to electrophoresis, and the amplified product showing the target band at the corresponding position was regarded as a positive specimen. The positive amplicons were sequenced by Sangon Biotech (Shanghai). The instruments and reagents used for sequencing were ABI-PRISM 3730 and BigDye Terminator V3.1. Nucleotide sequences were compared with those in databases. The statistical significance of the matches was calculated using the Basic Local Alignment Search tool (BLAST).

Table 1.Universal Amplification Primers of Common Carbapenemase Genotypes
Target SegmentUniversal PrimersDesign Sequence (5’ - 3’)Product Length, bpAnnealing Temperature, °C
KPCKPC-FGATGTCACTGTATCGCCGTCT73955
KPC-RATAGTCATTTGCCGTGCCATA
VIM-1VIM-1-FTTATGGAGCAGCAACGATGT92054
VIM-1-RCAAAAGTCCCGCTCCAACGA
VIM-2VIM-2-FAAAGTTATGCCGCACTCACC95354
VIM-2-RTGCAACTTCATGTTATGCCG
IMP-1IMP-1-FTGAGCAAGTTATCTGTATTC74051
IMP-1-RTTAGTTGCTTGGTTTTGATG
IMP-2IMP-2-FGGCAGTCGCCCTAAAACAAA73754
IMP-2-RTAGTTACTTGGCTGTGATGG
NDM-1NDM-1-FCAACGGTTTGATCGTCAGG37056
NDM-1-RGATCCCAACGGTGATATTGTC

Universal Amplification Primers of Common Carbapenemase Genotypes

3.4. Molecular Homology Analysis

The pulse field gel electrophoresis (PFGE) analysis was used to determine the homology of CRE strains of the same genus. The matching restriction enzyme was XbaI. The DNA of the Salmonella serotype Braenderup H9812 strain was the standard marker. Then, the unweighted pair group method with arithmetic mean (UPGMA) was used to generate the relationship between the strains. According to the interpretation standard, more than 80% similarity in isolates of PFGE profiles were considered related strains.

3.5. Statistical Analysis

Statistical analysis was performed using SPSS version 24.0 to compare the clinical cure rates of patients treated with piperacillin/tazobactam or other drugs. The percentage difference was analyzed using Fisher’s exact test (T < 1). A P value of < 0.05 was considered significant.

4. Results

4.1. Classification and Distribution of CRE

During six years of data gathering in this study (2014 - 2019), 20 pediatric patients were identified with CRE infection, including seven and six patients with E. coli and K. pneumoniae, respectively, two patients each with K. pneumoniae, S. marcescens, and E. aerogenes, and one patient with E. cloacae (Table 2). Among these strains, there was no tendency for concentrated outbreaks. The proportion of CRE strains to the total number of corresponding species isolated ranged from 0.6% (E. coli) to 2.7% (E. aerogenes). Among the hospital wards, the highest rates of CRE infections were found in Neonatology and Pediatrics (six cases, each), followed by Pediatric Intensive Care Unit (PICU), Neonatal Intensive Care Units (NICU), and Pediatric Surgery (four, two, and two cases, respectively; Table 2). The CRE strains were isolated from respiratory secretions, blood samples, lavage fluids, and wound secretions (50%, 30%, 10%, and 10.0%, respectively).

Table 2.Classification and Distribution of Carbapenem-Resistant Enterobacteriaceae Isolates Obtained from 20 Pediatric Patients
Escherichia coliKlebsiella spp.S. marcescensEnterobacter spp.
K. pneumoniaeK. oxytocaE. aerogenesE. cloacae
n/No. (%)a7/1191 (0.6)6/412 (1.5)2/83 (2.4)2/78 (2.6)2/73 (2.7)1/108 (0.9)
Ward
Neonatology13-1-1
NICU----2-
Pediatrics2211--
Pediatric surgery2-----
PICU211---
Specimen
Blood1-2-21
Lavage fluid11----
Respiratory35-2--
Wound secretion2-----
Genotype
blaIMP-4422211
blaIMP-833--1-
None-1----

Classification and Distribution of Carbapenem-Resistant Enterobacteriaceae Isolates Obtained from 20 Pediatric Patients

4.2. Characteristics of CRE Strains

The sequencing and BLAST confirmed that 12 CRE strains produced IMP-4-type carbapenemases, as follows: four strains of E. coli, two each of K. pneumoniae, K. oxytoca, and S. marcescens, and one each of E. aerogenes and E. cloacae (Table 2). Seven CRE strains were confirmed to produce IMP-8 carbapenemases: three strains of K. pneumoniae, three strains of E. coli, and one strain of E. aerogenes. One strain (of K. pneumoniae) did not show any carbapenemase genotype. Besides, PFGE revealed that two strains of E. coli and three of K. pneumoniae had similar PFGE patterns, while the other CRE strains have no homology. The results of the drug sensitivity test showed that CRE had high resistance to carbapenems and cephalosporins, while resistance rates to tobramycin and ciprofloxacin were relatively low (Table 3). No strains resistant to tigecycline were observed.

Table 3.Antimicrobial Susceptibility of Carbapenem-Resistant Enterobacteriaceae Isolates from Pediatric Patients by Antibiotic, N
E. coliKlebsiella spp.S. marcescensEnterobacter spp.
K. pneumoniaeK. oxytocaE. aerogenesE. cloacae
SIRSIRSIRSIRSIRSIR
Total subjects762221
Ertapenem106006002200200100
Imipenem106006002002002001
Meropenem007006002020101100
Gentamicin205105002200200100
Tobramycin313231110200200100
PTZ025105011200200100
Ceftriaxone007105002110200001
Ceftazidime007006002200101001
Cefepime007006011200200100
Ciprofloxacin115501200200200100
Tigecycline700600200200200100

Antimicrobial Susceptibility of Carbapenem-Resistant Enterobacteriaceae Isolates from Pediatric Patients by Antibiotic, N

4.3. Patient Characteristics and Treatment

The age range of patients with CRE infection was between one day and eight years, and boys were the majority (15/20, 75.0%). All patients suffered from various complications, such as prematurity, coronary heart disease, and gastrointestinal dysfunction. In addition, seven patients (35.0%) were subject to invasive procedures, such as bronchoalveolar lavage and mechanical ventilation. Sixteen patients were clinically cured, including 10 patients administered piperacillin/tazobactam as an antimicrobial treatment (Table 4). Statistical analysis showed a significant difference between the piperacillin/tazobactam treatment group and the non-treatment group (Table 5).

Table 4.Antimicrobial Treatment and Outcome of Pediatric Patients with Carbapenem-Resistant Enterobacteriaceae Infection
Patient NumberGender/AgeInfection with CREAntibiotic TherapyOutcome
1) S. marcescensM/1 dayPneumoniaPTZ, 40/5 mg/kg, 14 daysClinical cure
2) S. marcescensF/5 daysPneumoniaPTZ, 40/5 mg/kg, 19 daysClinical cure
3) K. oxytocaF/4 yearsSepsisCeftriaxone, 60 mg/kg, 14 days and meropenem, 20mg/kg, 18 daysDeath
4) E. coliM/31 daysPneumoniaImipenem, 20mg/kg, 5 daysClinical cure
5) K. pneumoniaeF/3 monthsPneumoniaCeftriaxone, 80 mg/kg, 10 daysDeath
6) E. coliM/3 monthsPneumoniaCeftizoxime, 50 mg/kg, 8 daysClinical cure
7) E. coliF/3 yearsPneumonia and sepsisAmikacin, 7 mg/kg, 3 daysDeath
8) K. oxytocaM/ 6 yearsSepsisMeropenem, 20 mg/kg, 7 days and ceftriaxone, 80 mg/kg, 7 daysClinical cure
9) E. aerogenesM/4 monthsPneumoniaCeftriaxone, 80 mg/kg, 7 daysClinical cure
10) K. pneumoniaeM/11 daysPneumoniaPTZ, 80/10 mg/kg, 10 daysClinical cure
11) K. pneumoniaeM/2 yearsPneumonia and sepsisCompound sulfamethoxazole, 40 mg/kg, 6 daysDeath
12) E. coliM/6 monthsPneumoniaPTZ, 80/10 mg/kg, 7 daysClinical cure
13) K. pneumoniaeM/4 daysPneumonia and sepsisPTZ, 80/10 mg/kg, 7 daysClinical cure
14) E. aerogenesM/27 daysPneumoniaPTZ, 80/10 mg/kg, 7 daysClinical cure
15) E. coliM/4 yearsAcute appendicitisImipenem, 20 mg/kg, 6 daysClinical cure
16) K. pneumoniaeM/2 monthsPneumoniaPTZ, 80/10 mg/kg, 7 daysClinical cure
17) E. coliM/10 monthsPneumoniaPTZ, 80/10 mg/kg, 11 daysClinical cure
18) E. cloacaeM/13 daysPneumoniaPTZ, 80/10 mg/kg, 10 daysClinical cure
19) K. pneumoniaeM/30 daysPneumoniaCeftizoxime, 30 mg/kg, 6 daysClinical cure
20) E. coliF/8 yearsAcute appendicitisPTZ, 80/10 mg/kg, 5 daysClinical cure

Antimicrobial Treatment and Outcome of Pediatric Patients with Carbapenem-Resistant Enterobacteriaceae Infection

Table 5.The Clinical Cure Rate of Patients Treated with Piperacillin/Tazobactam or Other Drugs
Clinical CureMortality Attributed to CRETotalOne-tailed P
PTZ100100.0433
Other drugs6410
Total16420

The Clinical Cure Rate of Patients Treated with Piperacillin/Tazobactam or Other Drugs

5. Discussion

In the present study, CRE strains were collected over six years in infected pediatric patients, including several common Enterobacteriaceae spp. Although the CRE infection rate was low and did not cause large-scale outbreaks, the spread of several nosocomial infection strains with the same genotype was confirmed by PFGE. In addition, the isolation of strains from multiple pediatric departments and different infection sites still concerns us regarding infection control. Clinical treatment of CRE strains poses great difficulties, due to their multidrug resistance. For children infected with CRE, there are no authoritative guidelines recommending medications. Some of the rarely published evaluations are case reports, which have significant heterogeneity in population and treatment options (14). The available data support combination therapy, but there are insufficient data to recommend a particular regimen (15-17).

In the present study, after the drug sensitivity report was obtained, no child was treated with sensitive drugs such as tobramycin, ciprofloxacin, and tigecycline because of potential associated toxicity such as ear nephrotoxicity and malformed tooth or joint development. Some cases were treated empirically with a combination of insensitive antibacterial drugs, piperacillin, and tazobactam, based on previous local resistance data statistics; these patients achieved therapeutic results. This may provide a reference for the future antibacterial treatment of pediatric CRE infections. Although some potentially toxic drugs such as tigecycline were not selected during the treatment process, these drugs are compelling options for CRE treatment in special cases. One study of the susceptibility of Enterobacteriaceae isolates collected from pediatric patients in Asia from 2004 to 2012 found that the highest susceptibility to tigecycline was shown by K. oxytoca and E. coli (100.0% each) (18). In the present study, we obtained similar results, that is, the sensitivity of CRE isolates to tigecycline was 100.0%. Although there may be potential toxicity in the use of tigecycline, such as tooth enamel issue, this agent is still used as an effective antibacterial drug to treat children with CRE infections. Adult series have also shown that tigecycline is negatively associated with mortality dose-dependently (19, 20).

Some other reports indicate that carbapenem-containing combination therapy may be more effective than monotherapy or combination therapy without carbapenem (15, 16). However, one study concerning pediatric CRE bloodstream infection reported that it could not be determined whether combination therapy with or without meropenem was more effective. For patients who received meropenem, the subgroup with an isolate with MIC > 8 mg/L had a significantly higher mortality rate (100.0%, n = 8) than patients with an isolate with MIC ≤ 8 mg/L (45.5%, n = 22) (17). This indicates that the efficacy of carbapenems is uncertain for the treatment of CRE infection in children. Although by definition, carbapenem resistance suggests that the strain has antibacterial resistance to any type of carbapenem, in the present study, the resistance rates of CRE to ertapenem (70.0%), meropenem (90.0%), and imipenem (95.0%) differed. These isolates showed higher resistance to imipenem and meropenem than ertapenem, which may be associated with the produced IMP type of carbapenemase. This may be associated with the produced IMP type of carbapenemase. Furthermore, many novel antibiotics (e.g., ceftazidime-avibactam, meropenem-vaborbactam) were active against CRE strains that do not produce metallo-β-lactamases (MBL). However, in the pediatric population, where MBLs are common, the challenge of this particular carbapenemase type is the lack of new antibiotics that are active against this isolate.

Our study found that 19 out of 20 strains produced IMP carbapenemase. This is not consistent with other reports; in many studies, the frequency of IMP production was significantly lower than this value (3, 21-24), and KPC was the main type of carbapenemase (5, 7, 8). As known, IMP-type carbapenemase is a common type of MBL, and its drug resistance gene is mediated via chromosomes or plasmids and has been widely spread in non-fermenting bacteria such as Pseudomonas aeruginosa and Acinetobacter baumannii. In recent years, strains producing IMP-type MBLs have also been found in Enterobacteriaceae, drawing widespread clinical attention. Despite this, the report of IMP-type metalloenzymes in pediatrics is very rare. In our study, it was found that pediatric patients were infected with IMP carbapenemase CRE, which is helpful to guide reasonable medication for similar infections in the future.

5.1. Conclusions

This retrospective analysis found 20 cases of CRE infection in pediatric patients at a single hospital. The production of IMP carbapenemases was the major resistance mechanism. It is necessary to protect common infection sites in pediatric wards rigorously to prevent the spread of CRE infections. Although these strains were demonstrated as highly resistant to antibiotics, a healing effect was achieved by administering combined piperacillin and tazobactam, despite insensitivity in vitro.

Footnotes

References

  • 1.
    Martirosov DM, Lodise TP. Emerging trends in epidemiology and management of infections caused by carbapenem-resistant Enterobacteriaceae. Diagn Microbiol Infect Dis. 2016;85(2):266-75. [PubMed ID: 27033631]. https://doi.org/10.1016/j.diagmicrobio.2015.10.008.
  • 2.
    Nordmann P, Naas T, Poirel L. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791-8. [PubMed ID: 22000347]. [PubMed Central ID: PMC3310682]. https://doi.org/10.3201/eid1710.110655.
  • 3.
    Sekar R, Mythreyee M, Srivani S, Sivakumaran D, Lallitha S, Saranya S. Carbapenem-resistant Enterobacteriaceae in pediatric bloodstream infections in Rural Southern India. Indian Pediatr. 2017;54(12):1021-4. [PubMed ID: 28849764]. https://doi.org/10.1007/s13312-017-1204-1.
  • 4.
    Logan LK. Carbapenem-resistant enterobacteriaceae: an emerging problem in children. Clin Infect Dis. 2012;55(6):852-9. [PubMed ID: 22700827]. https://doi.org/10.1093/cid/cis543.
  • 5.
    Logan LK, Hujer AM, Marshall SH, Domitrovic TN, Rudin SD, Zheng X, et al. Analysis of beta-lactamase resistance determinants in Enterobacteriaceae from Chicago children: A multicenter survey. Antimicrob Agents Chemother. 2016;60(6):3462-9. [PubMed ID: 27021322]. [PubMed Central ID: PMC4879402]. https://doi.org/10.1128/AAC.00098-16.
  • 6.
    Hsu AJ, Tamma PD. Treatment of multidrug-resistant Gram-negative infections in children. Clin Infect Dis. 2014;58(10):1439-48. [PubMed ID: 24501388]. https://doi.org/10.1093/cid/ciu069.
  • 7.
    Stillwell T, Green M, Barbadora K, Ferrelli JG, Roberts TL, Weissman SJ, et al. Outbreak of KPC-3 producing carbapenem-resistant Klebsiella pneumoniae in a US Pediatric Hospital. J Pediatric Infect Dis Soc. 2015;4(4):330-8. [PubMed ID: 26582872]. https://doi.org/10.1093/jpids/piu080.
  • 8.
    Drew RJ, Turton JF, Hill RL, Livermore DM, Woodford N, Paulus S, et al. Emergence of carbapenem-resistant Enterobacteriaceae in a UK paediatric hospital. J Hosp Infect. 2013;84(4):300-4. [PubMed ID: 23831281]. https://doi.org/10.1016/j.jhin.2013.05.003.
  • 9.
    Chiotos K, Tamma PD, Flett KB, Naumann M, Karandikar MV, Bilker WB, et al. Multicenter study of the risk factors for colonization or infection with carbapenem-resistant Enterobacteriaceae in children. Antimicrob Agents Chemother. 2017;61(12). [PubMed ID: 28971864]. [PubMed Central ID: PMC5700345]. https://doi.org/10.1128/AAC.01440-17.
  • 10.
    Weiner LM, Webb AK, Limbago B, Dudeck MA, Patel J, Kallen AJ, et al. Antimicrobial-resistant pathogens associated with healthcare-associated infections: Summary of data reported to the national healthcare safety network at the centers for disease control and prevention, 2011-2014. Infect Control Hosp Epidemiol. 2016;37(11):1288-301. [PubMed ID: 27573805]. [PubMed Central ID: PMC6857725]. https://doi.org/10.1017/ice.2016.174.
  • 11.
    Viau R, Frank KM, Jacobs MR, Wilson B, Kaye K, Donskey CJ, et al. Intestinal carriage of carbapenemase-producing organisms: Current status of surveillance methods. Clin Microbiol Rev. 2016;29(1):1-27. [PubMed ID: 26511484]. [PubMed Central ID: PMC4771221]. https://doi.org/10.1128/CMR.00108-14.
  • 12.
    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-nineth informational supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2019.
  • 13.
    Pang F, Jia XQ, Song ZZ, Li YH, Wang B, Zhao QG, et al. Characteristics and management of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in a tertiary hospital. Afr Health Sci. 2016;16(1):153-61. [PubMed ID: 27358627]. [PubMed Central ID: PMC4915421]. https://doi.org/10.4314/ahs.v16i1.21.
  • 14.
    Morrill HJ, Pogue JM, Kaye KS, LaPlante KL. Treatment options for carbapenem-resistant enterobacteriaceae infections. Open Forum Infect Dis. 2015;2(2):ofv050. [PubMed ID: 26125030]. [PubMed Central ID: PMC4462593]. https://doi.org/10.1093/ofid/ofv050.
  • 15.
    Qureshi ZA, Paterson DL, Potoski BA, Kilayko MC, Sandovsky G, Sordillo E, et al. Treatment outcome of bacteremia due to KPC-producing Klebsiella pneumoniae: Superiority of combination antimicrobial regimens. Antimicrob Agents Chemother. 2012;56(4):2108-13. [PubMed ID: 22252816]. [PubMed Central ID: PMC3318350]. https://doi.org/10.1128/AAC.06268-11.
  • 16.
    Tumbarello M, Viale P, Viscoli C, Trecarichi EM, Tumietto F, Marchese A, et al. Predictors of mortality in bloodstream infections caused by Klebsiella pneumoniae carbapenemase-producing K. pneumoniae: Importance of combination therapy. Clin Infect Dis. 2012;55(7):943-50. [PubMed ID: 22752516]. https://doi.org/10.1093/cid/cis588.
  • 17.
    Nabarro LEB, Shankar C, Pragasam AK, Mathew G, Jeyaseelan V, Veeraraghavan B, et al. Clinical and bacterial risk factors for mortality in children with carbapenem-resistant Enterobacteriaceae bloodstream infections in India. Pediatr Infect Dis J. 2017;36(6):e161-6. [PubMed ID: 28005691]. https://doi.org/10.1097/INF.0000000000001499.
  • 18.
    Kehl SC, Dowzicky MJ. Global assessment of antimicrobial susceptibility among Gram-negative organisms collected from pediatric patients between 2004 and 2012: Results from the Tigecycline Evaluation and Surveillance Trial. J Clin Microbiol. 2015;53(4):1286-93. [PubMed ID: 25653413]. [PubMed Central ID: PMC4365249]. https://doi.org/10.1128/JCM.03184-14.
  • 19.
    Colombo S, Scolfaro C, Calitri C, Denina M, Carraro F, De Intinis G, et al. Carbapenemase-producing enterobacteriaceae (CPE) in the pediatric setting: Results from an 18-month survey. Infect Control Hosp Epidemiol. 2014;35(5):599-601. [PubMed ID: 24709738]. https://doi.org/10.1086/675843.
  • 20.
    Purdy J, Jouve S, Yan JL, Balter I, Dartois N, Cooper CA, et al. Pharmacokinetics and safety profile of tigecycline in children aged 8 to 11 years with selected serious infections: A multicenter, open-label, ascending-dose study. Clin Ther. 2012;34(2):496-507 e1. [PubMed ID: 22249106]. https://doi.org/10.1016/j.clinthera.2011.12.010.
  • 21.
    Zerr DM, Weissman SJ, Zhou C, Kronman MP, Adler AL, Berry JE, et al. The molecular and clinical epidemiology of extended-spectrum cephalosporin- and carbapenem-resistant Enterobacteriaceae at 4 US Pediatric Hospitals. J Pediatric Infect Dis Soc. 2017;6(4):366-75. [PubMed ID: 28339623]. [PubMed Central ID: PMC5907845]. https://doi.org/10.1093/jpids/piw076.
  • 22.
    Limbago BM, Rasheed JK, Anderson KF, Zhu W, Kitchel B, Watz N, et al. IMP-producing carbapenem-resistant Klebsiella pneumoniae in the United States. J Clin Microbiol. 2011;49(12):4239-45. [PubMed ID: 21998425]. [PubMed Central ID: PMC3233008]. https://doi.org/10.1128/JCM.05297-11.
  • 23.
    Senchyna F, Gaur RL, Sandlund J, Truong C, Tremintin G, Kultz D, et al. Diversity of resistance mechanisms in carbapenem-resistant Enterobacteriaceae at a health care system in Northern California, from 2013 to 2016. Diagn Microbiol Infect Dis. 2019;93(3):250-7. [PubMed ID: 30482638]. [PubMed Central ID: PMC7155946]. https://doi.org/10.1016/j.diagmicrobio.2018.10.004.
  • 24.
    Herruzo R, Ruiz G, Perez-Blanco V, Gallego S, Mora E, Vizcaino MJ, et al. Bla-OXA48 gene microorganisms outbreak, in a tertiary Children's Hospital, over 3 years (2012-2014): Case report. Medicine (Baltimore). 2017;96(40). e7665. [PubMed ID: 28984751]. [PubMed Central ID: PMC5737987]. https://doi.org/10.1097/MD.0000000000007665.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles