Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Evaluation of Anti-bacterial, Anti-adenoviral, and Apoptosis-inducing Activity of Bacillus clausii Supernatant

Author(s):
Zahra Sadat FateminasabZahra Sadat Fateminasab1, Mohammad ShayestehpourMohammad Shayestehpour2, 3, Mohammad Reza ZolfaghariMohammad Reza Zolfaghari1,*
1Department of Microbiology, Faculty of Basic Science, Qom Branch, Islamic Azad University, Qom, Iran
2Department of Microbiology and Immunology, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, Iran
3Autoimmune Diseases Research Center, Kashan University of Medical Sciences, Kashan, Iran

Jundishapur Journal of Microbiology:Vol. 16, issue 1; e132952
Published online:Mar 25, 2023
Article type:Research Article
Received:Nov 08, 2022
Accepted:Jan 28, 2023
How to Cite:Fateminasab ZS, Shayestehpour M, Zolfaghari MR. Evaluation of Anti-bacterial, Anti-adenoviral, and Apoptosis-inducing Activity of Bacillus clausii Supernatant. Jundishapur J Microbiol. 2023;16(1):e132952. doi: https://doi.org/10.5812/jjm-132952

Abstract

Background:

Bacillus clausii is being studied as a probiotic candidate. There is insufficient information on the antimicrobial and anticancer effects of B. clausii.

Objectives:

The present investigation was designed to evaluate the anti-bacterial, anti-adenoviral, and apoptosis-inducing activity of B. clausii cell-free supernatant (CFS).

Methods:

First, the supernatant of B. clausii was collected after culture for 24 h. Then, its anti-bacterial impact on several genera of bacteria was assessed through the minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC). Adenovirus 5 (Ad5) was exposed to the CFS under four conditions, including pre-treatment: First infecting cells with CFS and then with the virus; pre-incubation: Incubation of the supernatant and virus for 1.5 hours and then adding to the cells; competition: Infection of cells with the simultaneous mixture of the supernatant and virus, and post-treatment: First infecting cells with the virus and then with CFS. The median tissue culture infectious dose (TCID50) technique determined the virus titer. Real-time PCR was performed to assess the E1A expression. After exposure to the CFS, real-time PCR was utilized to measure the expression of MicroRNA-145, BCL-2, and BAX in HeLa cancer cells.

Results:

Bacillus clausii supernatant showed an inhibitory effect on Methicillin-resistant Staphylococcus aureus (MRSA), Enterococcus faecalis, S. aureus, Pseudomonas aeruginosa, Escherichia coli, and Acinetobacter baumannii. The Ad5 titers were reduced by about 4.61, 4, 3.9, and 3.1 Log10 TCID50/mL in pre-treatment, pre-incubation, competition, and post-treatment tests (CFS dilution: 1/4), respectively. Similar results of the viral titration were seen when experimental and control E1A expression levels were compared. Also, B. clausii supernatant during 48 h exposure to HeLa cells increased the transcript of the BAX, BCL-2, and miR-145 genes to 9.1, 2.3, and 55 folds, respectively, compared to the untreated condition.

Conclusions:

Bacillus clausii can be a potent antimicrobial and anticancer agent. Further research is required to learn about the spectrum of anti-bacterial, antiviral, and anti-cancerous activities of B. clausii.

1. Background

Bacillus clausii is known as a probiotic bacterium. Previous research has shown that B. clausii has anti-bacterial properties, but the current data are insufficient. Recent studies have reported that the antimicrobials produced by B. clausii have activities against Clostridium difficile and Staphylococcus aureus in vitro (1). Bacillus clausii produces the class I antibiotic clausin, which works against Gram-positive bacteria (2). According to the current research, B. clausii has no anti-bacterial action on Gram-negative germs but has an inhibitory effect on some Gram-positive germs. More research is required to determine the range of its antimicrobial properties. Several bacilli have shown antiviral action against human viruses, such as B. subtilis to inhibit the HSV and influenza virus (3), B. horneckiae against herpes simplex virus 1 (4), and B. licheniformis against herpes simplex virus 2 (5). Additionally, the ribonuclease (binase) of B. pumilus has been developed as an inhibitor of rhinovirus serotype 1A and influenza A in cell culture (6). The direct activity of B. clausii and its metabolites against human viruses is unknown and needs more focus.
Probiotics have been shown to have anticancer properties. Also, B. licheniformis, B. subtilis, B. coagulans, and B. cereus have been studied for their ability to suppress cancer development or trigger apoptosis (7). However, there is little knowledge of B. clausii. Bacillus strains have been assessed for their effects on the BAX and BCL-2 genes in cancer cells (8-10), but no data have been published on B. clausii and cervical cancer HeLa cells. In addition, the possible role of Bacilli has not been assessed in upregulating the expression level of miR-145 involved in apoptosis.

2. Objectives

This work aimed to get further information on the anti-bacterial activity of B. clausii supernatant. Additionally, the possible inhibitory effect of B. clausii supernatant against adenovirus type 5 (Ad5) is investigated. Adenoviruses are one of the most common causes of respiratory diseases in humans. However, no study has published data on the inhibitory effect of probiotics on adenoviruses. We also aimed to evaluate the impact of the bacterial supernatant on the expression of genes associated with apoptosis in the HeLa cell line, such as BAX, BCL-2, and miR-145.

3. Methods

3.1. Bacteria, Cell Line, and Virus

Bacillus clausii (ATCC 700160) was purchased as lyophilized from the Iranian Biological Resource Center (IBRC). Fifty milliliters of B. clausii culture (106 CFU/mL) was cultured in a tryptic soy broth medium for 24 h. The culture suspensions were centrifuged (700 g, 25 minutes) to extract the cell-free supernatants. The IBRC provided S. aureus (ATCC 25923), Escherichia coli (ATCC 25922), Acinetobacter baumannii (ATCC 1960), Methicillin-resistant S. aureus (MRSA) (ATCC 43300), Pseudomonas aeruginosa (ATCC 27853), and Enterococcus faecalis (ATCC 25912). The virology department at Tarbiat Modares University (Tehran, Iran) provided HeLa cells, HEK-293 cells, and Ad5 as gifts.

3.2. Minimum Inhibitory Concentration and Minimum Bactericidal Concentration

Anti-bacterial activity of B. clausii was assessed on S. aureus, MRSA, E. faecalis, E. coli, and P. aeruginosa. Several colonies of isolates were put into the Brain Heart Infusion (BHI) medium (HiMedia, India) and cultivated for 24 h at 37°C. One hundred microliters of bacterial suspensions (1.5 × 105 CFU/mL) were added into 96-well plates and treated with 100 µL of different concentrations of each compound (dilutions 1/2 to 1/28). After 24 h storing at 37°C, the Minimum Inhibitory Concentration (MIC) was determined as the lowest dose at which the bacteria could not grow visibly. To find the minimum bactericidal concentration (MBC), TSB tubes with the lowest B. clausii supernatant were used to inoculate Trypticase soy agar using the pour plate technique (11).

3.3. Adenovirus Titration

According to a previously described procedure, we carried out a median tissue culture infectious dose (TCID50) experiment to evaluate the titer of adenovirus type 5 (12).

3.4. Cytotoxicity Assay of Bacillus clausii Supernatant

The HeLa cells were grown in cell culture microplates (20,000 cells per well) in triplicate to test the cytotoxicity of B. clausii supernatant. Dimethylthiazolyl-diphenyl tetrazolium bromide (MTT) test was used to determine cytotoxicity using a previously described procedure (13).

3.5. Antiviral Activity Assay

We cultured HEK-293 cells in six-well plates. Bacterial supernatants (dilutions 1/4 and 1/8) and Ad5 (MOI = 0.1) were added to cells in different conditions, including pre-treatment, pre-incubation, competition, and post-treatment, as previously described (14). The Ad5-infected cells were considered a control (without exposure to the bacterial supernatant).

3.6. Relative Expression of E1A Adenovirus and BAX, BCL-2, and microRNA-145 Genes in HeLa Cancer Cells

The E1A expression levels in different experimental assays were measured to approve TCID50 results. A real-time PCR test determined the level of the BCL-2, BAX, and microRNA-145 transcripts to evaluate the influence of B. clausii supernatant on the apoptosis activation in the HeLa cell line. First, 1 × 105 HeLa cells were grown in each well of six-well plates. The cells were treated with dilutions of bacterial supernatant (1/4 and 1/8) for 24 h and 48 h at 37°C. The RNX kit (SinaClon, Iran) isolated total RNA from the cultivated cells. A commercial cDNA Synthesis Kit (AddBio, South Korea) was used to transcribe one microgram of total RNA.
The cDNA for the miR-145 and U6 genes (as a control gene) was synthesized using the following RT primers: RT-U6–5′-ATATGGAACGCTTCACGAATTTGC-3′, RT-miR-145-5p-5′-TCGTATCCAGTGCAGGGTC CGAGGTATTCGCACTGGATACGACAG. The real-time PCR was done in the ABI StepOnePlusTM equipment and specific primers (Table 1). The PCR mixture included 12.5 µL of Ampliqon master mix (Denmark), 0.5 µL (10 µmol) of each primer, 2 µL of cDNA, and 9.5 µL of Distilled Water (DW). Amplifications were carried out using the following cycling profile: 94°C for 10 minutes and then 40 cycles, including 20 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The results were normalized against the expression of human beta-globin (U6 for miR-145), and the 2-ddCT technique was utilized to estimate the relative expression of genes.
Table 1.Primers Used in Real-time PCR Assay for Determination of Expression Levels of Apoptosis-related Genes BAX, BCL-2, and microRNA-145
PrimersSequence (5-3)Product Size (bp)References
miR145-forwardTCCAGTTTTCCCAGGAATCCC85(12)
miR145-reverseATCCAGTGCAGGGTCCGA
U6-forwardGAGAAGATTAGCATGGCCCCT90(12)
U6-reverseATATGGAACGCTTCACGAATTTGC
Bax-forwardCCTGTGCACCAAGGTGCCGGAACT99(15)
Bax-reverseCCACCCTGGTCTTGGATCCAGCCC
Bcl-2-forwardTTGTGGCCTTCTTTGAGTTCGGTG114(15)
Bcl-2-reverseGGTGCCGGTTCAGGTACTCAGTCA
B-Actin-forwardGGCGGCACCACCATGTACCCT202(15)
B-Actin-reverseAGGGGCCGGACTCGTCATACT
E1A-forwardACCTCCTAGCCATTTTGAACCAC122(12)
E1A-reverseGTCAATCCCTTCCTGCACCG

3.7. Statistical Analysis

GraphPad Prism 6.0 software was used to compare TCID50 and real-time PCR data between the control and treated groups by a student's t-test.

4. Results

4.1. Minimum Inhibitory Concentration/Minimum Bactericidal Concentration

By determining the MIC and MBC, the anti-bacterial activity of B. clausii supernatant was examined against several bacterial genera (Table 2). The cell-free supernatant of B. calusii had an inhibitory effect on E. faecalis, S. aureus, MRSA, E. coli, P. aeruginosa, and A. baumannii. The anti-bacterial effect of E. faecalis occurred at a lower concentration of B. calusii supernatant than that of other bacteria. The bacterial supernatant had no bactericidal activity against MRSA, P. aeruginosa, and A. baumannii.
Table 2.Determination of Minimum Inhibitory (MIC) and Minimum Bactericidal Concentration (MBC) of Bacillus clausii Supernatant Against Bacteria
TestEnterococcus faecalisStaphylococcus aureusMRSAEscherichia coliPseudomonas aeruginosaAcinetobacter baumannii
MIC1/321/161/41/161/41/4
MBC1/161/8-1/8--

4.2. Cell Viability Assay

The results of HeLa cell viability are shown in Figure 1. The MTT findings revealed that incubating HeLa cells for 24 and 48 hours with bacterial supernatant at a concentration of 1/2 reduced viable cells proportion to 65% and 40%, respectively. Additionally, 80% of cells were still alive after exposure to CFS at concentrations above 1/4 for 24 h and above 1/8 for 48 h.
MTT assay for the viability of HeLa cells after treatment with different concentrations of <i>Bacillus clausii</i> supernatant
Figure 1.

MTT assay for the viability of HeLa cells after treatment with different concentrations of Bacillus clausii supernatant

4.3. Anti-adenoviral Effect of Bacillus clausii Supernatant

The human Ad5 titer was 8.91 ± 0.14 Log10 TCID50/mL when B. clausii supernatant was absent (control). The Ad5 titer was calculated after incubation of CFS (dilution: 1/4 and 1/8) and HEK-293 cells in different conditions. Data are summarized in Table 3 and Figure 2. The Ad5 titer in pre-treatment, pre-incubation, competition, and post-treatment conditions with a concentration of 1/4 supernatant dropped by 4.61, 4, 3.9, and 3.1 Log10 TCID50/mL, respectively. As demonstrated in Figure 2, the Ad5 titer was significantly lower (P-value 0.05) in all experiments than in the control group. The mean Ad5 titer in the pre-incubation and competition tests was similar. Similar results of the viral titration were shown when the E1A expression in the experimental and control tests was compared (Figure 2B). The most significant reduction in E1A-adenovirus expression was seen in the pre-treatment assay.
Table 3.Results of Ad5 Titer in Different Experimental Assays of Bacillus clausii Supernatant Inoculation
Different Experimental AssaysMean Ad5 Titer (Log10 TCID50/mL ± SD)
Supernatant Dilution: 1/4Supernatant Dilution: 1/8
Pre-treatment4.30 ± 0.285.33 ± 0.14
Pre-incubation4.91 ± 0.165.91 ± 0.28
Competition5.00 ± 0.146.08 ± 0.16
Post-treatment5.75 ± 0.166.33 ± 0.28
Control8.91 ± 0.148.91 ± 0.14
Human Ad5 titer (A) and E1A expression level (B) in different experimental conditions of <i>Bacillus clausii</i> inoculation. Statistical differences between the mean virus titer (or E1A expression) at each stage of bacterial inoculation and the mean virus titer in the absence of bacteria (control) were analyzed by the student test (ns: Not significant; **** P-value &lt; 0.0001, *** P-value &lt; 0.001).
Figure 2.

Human Ad5 titer (A) and E1A expression level (B) in different experimental conditions of Bacillus clausii inoculation. Statistical differences between the mean virus titer (or E1A expression) at each stage of bacterial inoculation and the mean virus titer in the absence of bacteria (control) were analyzed by the student test (ns: Not significant; **** P-value < 0.0001, *** P-value < 0.001).

4.4. Effect of Bacillus clausii Supernatant on the Expression of BAX, BCL-2, and miR-145 Genes

When B. clausii supernatant was added to HeLa cells for 24 h at a concentration of 1/8, the levels of BAX, BCL-2, and miR-145 genes increased to 2.8, 1.16, and 6.3 folds, respectively, compared with untreated cells. In addition, 1/4 dilution of the bacterial supernatant during 48 h increased BAX, BCL-2, and miR-145 genes by 5.5, 1.5, and 9.1 folds (Figure 3). A concentration of 1/8 B. clausii supernatant during 48 h could elevate the level of BAX, BCL-2, and miR-145 genes by 5.4, 1.7, and 24 folds, respectively, compared to the untreated condition.
The expression of apoptosis-related genes BAX, BCL-2, and miR-145 in HeLa cancer cells after exposure to <i>Bacillus clausii </i>supernatant for 24 (A) and 48 (B) hours.
Figure 3.

The expression of apoptosis-related genes BAX, BCL-2, and miR-145 in HeLa cancer cells after exposure to Bacillus clausii supernatant for 24 (A) and 48 (B) hours.

5. Discussion

Several Bacillus species are investigated in humans as potential probiotic candidates. The current study evaluated the anti-bacterial, anti-adenoviral, and apoptotic effects of B. clausii supernatant. Data showed that the B. clausii supernatant inhibits some bacterial strains and human adenovirus type 5. Furthermore, it remarkably induced the level of the apoptosis-linked genes BAX and miR-145. Several studies have demonstrated that B. clausii strains produce metabolites with bacterial inhibitory and anti-fungal effects. In the current work, B. clausii supernatant after 24 h of culture had anti-bacterial effects on E. faecalis, S. aureus, MRSA, E. coli, P. aeruginosa, and A. baumannii. Clausin is a lantibiotic recently isolated from B. clausii and is active against some gram-positive microbes (3). In the previous studies, it inhibited M. luteus at MIC = 16 mg/L and MRSA at MIC = 128 mg/L (4). Similarly, in the present study, B. clausii had an inhibitory effect on MRSA at a MIC equal to 1/4 dilution of the bacterial supernatant. Ripert et al. showed that compounds secreted by B. clausii inhibit toxins of two pathogens, C. difficile and B. cereus (16). Using a colony overlay test, Ripert et al. examined the inhibitory effect of the strains O/C, N/R, SIN, and T of B. clausii, which are probiotics.
The B. clausii CFS had inhibitory effects on S. aureus, E. faecium, Lactobacillus lactis, and C. difficile but had no inhibitory effect on gram-negative germs (E. coli, Salmonella typhimurium, S. flexneri, Vibrio cholerae, V. parahaemolyticus, and P. fluorescens) (1). In the present work, contrary to the findings of Urdaci et al., B. clausii supernatant had an antimicrobial effect on E. coli, P. aeruginosa, and A. baumannii. This disagreement in results may be due to variations in the research techniques or strains utilized in the two investigations. One of the aims of the present study was the in vitro assessment of the anti-adenoviral activity of B. clausii. The B. clausii CFS showed an antiviral impact on all tests conducted in different conditions. However, the pre-treatment condition showed the highest drop in Ad5 titer. The virus's titer was 4.61 Log10 TCID50/mL lower than the control. It is conceivable that the supernatant of B. clausii can cause interference in adenovirus adhesion to the target cell. As a result, it keeps the virus from entering the cell. This finding was obtained in a few investigations on other probiotics. The culture supernatant of vaginal lactobacilli displayed a strong neutralizing effect on herpes simplex virus type 2 before viral entrance (17). Contrary to the present study, Mousavi et al. found that the CFS of L. crispatus did not show a significant antiviral activity on HSV (18).
MicroRNA-145 is a tumor suppressor often expressed in healthy, normal cells but drastically downregulated in malignant cells (12, 19). Recent research has suggested that miR-145 may be essential for controlling tumor cell growth, migration, invasion, and death in many malignancies (20). According to Pan et al., raising miR-145 levels in A549 cells resulted in a notable rise in the expression of BAX and a decline in the expression of MMP2, MMP9, and BCL-2. The A549 cells' apoptosis is accelerated by increasing the proportion of BAX to BCL-2 (21). The molecular mechanisms by which miR-145 promotes apoptosis in HeLa cells are unknown. However, Li et al. suggested that miR-145 can increase cell death in the HeLa cell line by modulating Wnt/β-catenin (20). In the current study, 24 and 48-hour incubations of B. clausii supernatant with HeLa cell line increased the level of miR-145 by 24 and 55 folds, respectively. Therefore, B. clausii supernatant can have an anti-tumor effect on HeLa cells through increasing tumor suppressor miR-145. This finding has been reported in a few previous studies. Fahmy et al. found that B. longum can induce the production of microRNA-145 in murine colorectal tumors (22). In the study of Anton et al., the expression of miRNA145 in cervical cells was upregulated after contact with bacteria-free supernatants of Gardnella vaginalis (23).

5.1. Conclusions

Bacillus clausii can be a potent antimicrobial and anticancer agent. However, further studies can determine its anti-bacterial, antiviral, and anticancer activity spectrum.

Footnotes

References

  • 1.
    Urdaci MC, Bressollier P, Pinchuk I. Bacillus clausii probiotic strains: antimicrobial and immunomodulatory activities. J Clin Gastroenterol. 2004;38(6 Suppl):S86-90. [PubMed ID: 15220667]. https://doi.org/10.1097/01.mcg.0000128925.06662.69.
  • 2.
    Bouhss A, Al-Dabbagh B, Vincent M, Odaert B, Aumont-Nicaise M, Bressolier P, et al. Specific interactions of clausin, a new lantibiotic, with lipid precursors of the bacterial cell wall. Biophys J. 2009;97(5):1390-7. [PubMed ID: 19720027]. [PubMed Central ID: PMC2749765]. https://doi.org/10.1016/j.bpj.2009.06.029.
  • 3.
    Starosila D, Rybalko S, Varbanetz L, Ivanskaya N, Sorokulova I. Anti-influenza activity of a Bacillus subtilis probiotic strain. Antimicrob Agents Chemother. 2017;61(7). [PubMed ID: 28416546]. [PubMed Central ID: PMC5487639]. https://doi.org/10.1128/AAC.00539-17.
  • 4.
    Marino-Merlo F, Papaianni E, Maugeri TL, Zammuto V, Spano A, Nicolaus B, et al. Anti-herpes simplex virus 1 and immunomodulatory activities of a poly-gamma- glutamic acid from Bacillus horneckiae strain APA of shallow vent origin. Appl Microbiol Biotechnol. 2017;101(20):7487-96. [PubMed ID: 28879435]. https://doi.org/10.1007/s00253-017-8472-5.
  • 5.
    Sanchez-Leon E, Bello-Morales R, Lopez-Guerrero JA, Poveda A, Jimenez-Barbero J, Girones N, et al. Isolation and characterization of an exopolymer produced by Bacillus licheniformis: In vitro antiviral activity against enveloped viruses. Carbohydr Polym. 2020;248:116737. [PubMed ID: 32919551]. [PubMed Central ID: PMC7345415]. https://doi.org/10.1016/j.carbpol.2020.116737.
  • 6.
    Shah Mahmud R, Muller C, Romanova Y, Mostafa A, Ulyanova V, Pleschka S, et al. Ribonuclease from Bacillus acts as an antiviral agent against negative- and positive-sense single stranded human respiratory RNA viruses. Biomed Res Int. 2017;2017:5279065. [PubMed ID: 28546965]. [PubMed Central ID: PMC5435908]. https://doi.org/10.1155/2017/5279065.
  • 7.
    Hajare SN, Subramanian M, Gautam S, Sharma A. Induction of apoptosis in human cancer cells by a Bacillus lipopeptide bacillomycin D. Biochimie. 2013;95(9):1722-31. [PubMed ID: 23770444]. https://doi.org/10.1016/j.biochi.2013.05.015.
  • 8.
    Karimi Ardestani S, Tafvizi F, Tajabadi Ebrahimi M. Heat-killed probiotic bacteria induce apoptosis of HT-29 human colon adenocarcinoma cell line via the regulation of Bax/Bcl2 and caspases pathway. Hum Exp Toxicol. 2019;38(9):1069-81. [PubMed ID: 31117840]. https://doi.org/10.1177/0960327119851255.
  • 9.
    Dolati M, Tafvizi F, Salehipour M, Movahed TK, Jafari P. Inhibitory effects of probiotic Bacillus coagulans against MCF7 breast cancer cells. Iran J Microbiol. 2021;13(6):839-47. [PubMed ID: 35222863]. [PubMed Central ID: PMC8816703]. https://doi.org/10.18502/ijm.v13i6.8089.
  • 10.
    Madempudi RS, Kalle AM. Antiproliferative effects of Bacillus coagulans unique IS2 in colon cancer cells. Nutr Cancer. 2017;69(7):1062-8. [PubMed ID: 28910156]. https://doi.org/10.1080/01635581.2017.1359317.
  • 11.
    Pirnia M, Edalatian Dovom MR, Tabatabaee Yazdi F, Shahidi F. [The antibacterial effects of the aqueous and ethanolic extracts of Cordiamyxa L. Fruit on Staphylococcus aureus, Bacillus cereus, Escherichia coli, and Salmonella typhi]. Qom Univ Med Sci J. 2015;9(4):39-48. Persian.
  • 12.
    Shayestehpour M, Moghim S, Salimi V, Jalilvand S, Yavarian J, Romani B, et al. Targeting human breast cancer cells by an oncolytic adenovirus using microRNA-targeting strategy. Virus Res. 2017;240:207-14. [PubMed ID: 28867494]. https://doi.org/10.1016/j.virusres.2017.08.016.
  • 13.
    Shayestehpour M, Rahimi MR, Piroozmand A, Khaledi A, Fateminasab ZS. In vitro evaluation of antiviral activity effect of selenium, Bacillus clausii supernatant, and their combination on the replication of herpes simplex virus 1. Jundishapur Journal of Microbiology. 2022;15(8). https://doi.org/10.5812/jjm-129848.
  • 14.
    Barzoki MG, Malekshahi SS, Shayestehpour M. In vitro evaluation of antiviral activity of Shouchella clausii probiotic strain and bacterial supernatant against herpes simplex virus type 1. Arch Microbiol. 2022;204(8):522. [PubMed ID: 35879582]. https://doi.org/10.1007/s00203-022-03137-9.
  • 15.
    Komorowska D, Gajewska A, Hikisz P, Bartosz G, Rodacka A. Comparison of the Effects of resveratrol and its derivatives on the radiation response of MCF-7 breast cancer cells. Int J Mol Sci. 2021;22(17). [PubMed ID: 34502426]. [PubMed Central ID: PMC8431402]. https://doi.org/10.3390/ijms22179511.
  • 16.
    Ripert G, Racedo SM, Elie AM, Jacquot C, Bressollier P, Urdaci MC. Secreted compounds of the probiotic Bacillus clausii strain O/C inhibit the cytotoxic effects induced by clostridium difficile and Bacillus cereus toxins. Antimicrob Agents Chemother. 2016;60(6):3445-54. [PubMed ID: 27001810]. [PubMed Central ID: PMC4879374]. https://doi.org/10.1128/AAC.02815-15.
  • 17.
    Zabihollahi R, Motevaseli E, Sadat SM, Azizi-Saraji AR, Asaadi-Dalaie S, Modarressi MH. Inhibition of HIV and HSV infection by vaginal lactobacilli in vitro and in vivo. Daru. 2012;20(1):53. [PubMed ID: 23351891]. [PubMed Central ID: PMC3555973]. https://doi.org/10.1186/2008-2231-20-53.
  • 18.
    Mousavi E, Makvandi M, Teimoori A, Ataei A, Ghafari S, Samarbaf-Zadeh A. Antiviral effects of Lactobacillus crispatus against HSV-2 in mammalian cell lines. J Chin Med Assoc. 2018;81(3):262-7. [PubMed ID: 29037754]. https://doi.org/10.1016/j.jcma.2017.07.010.
  • 19.
    Shayestehpour M, Moghim S, Salimi V, Jalilvand S, Yavarian J, Romani B, et al. Selective replication of miR-145-regulated oncolytic adenovirus in MCF-7 breast cancer cells. Future Virology. 2016;11(10):671-80. https://doi.org/10.2217/fvl-2016-0069.
  • 20.
    Li Q, Yu X, Yang L. MiR-145 inhibits cervical cancer progression and metastasis by targeting WNT2B by Wnt/beta-catenin pathway. Int J Clin Exp Pathol. 2019;12(10):3740-51. [PubMed ID: 31933762]. [PubMed Central ID: PMC6949761].
  • 21.
    Pan Y, Ye C, Tian Q, Yan S, Zeng X, Xiao C, et al. miR-145 suppresses the proliferation, invasion and migration of NSCLC cells by regulating the BAX/BCL-2 ratio and the caspase-3 cascade. Oncol Lett. 2018;15(4):4337-43. [PubMed ID: 29541201]. [PubMed Central ID: PMC5835894]. https://doi.org/10.3892/ol.2018.7863.
  • 22.
    Fahmy CA, Gamal-Eldeen AM, El-Hussieny EA, Raafat BM, Mehanna NS, Talaat RM, et al. Bifidobacterium longum suppresses murine colorectal cancer through the modulation of oncomiRs and tumor suppressor miRNAs. Nutr Cancer. 2019;71(4):688-700. [PubMed ID: 30862187]. https://doi.org/10.1080/01635581.2019.1577984.
  • 23.
    Anton L, Sierra LJ, DeVine A, Barila G, Heiser L, Brown AG, et al. Common cervicovaginal microbial supernatants alter cervical epithelial function: Mechanisms by which Lactobacillus crispatus contributes to cervical health. Front Microbiol. 2018;9:2181. [PubMed ID: 30349508]. [PubMed Central ID: PMC6186799]. https://doi.org/10.3389/fmicb.2018.02181.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles