Detection of Mycobacterium tuberculosis in Peripheral Blood Mononuclear Cells from Patients with Pulmonary Tuberculosis

Author(s):
Farimah YarmohammadiFarimah Yarmohammadi1, 2, Ali FarhadiAli FarhadiAli Farhadi ORCID1, Narges HassanaghaeiNarges Hassanaghaei3, Gholamreza  Rafiei DehbidiGholamreza Rafiei DehbidiGholamreza  Rafiei Dehbidi ORCID1, Farzaneh ZarghampoorFarzaneh ZarghampoorFarzaneh Zarghampoor ORCID1, Ehsan FarzanfarEhsan Farzanfar1, Sepide NamdariSepide Namdari1, Abbas Behzad BehbahaniAbbas Behzad BehbahaniAbbas Behzad Behbahani ORCID1,*
1Diagnostic Laboratory Sciences and Technology Research Center, School of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran
2School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
3Shiraz Mycobacteriology Regional Reference Laboratory, Shiraz University of Medical Sciences, Shiraz, Iran

Jundishapur Journal of Microbiology:Vol. 16, issue 6; e134575
Published online:Jul 30, 2023
Article type:Research Article
Received:Dec 29, 2022
Accepted:Jul 07, 2023
How to Cite:Yarmohammadi F, Farhadi A, Hassanaghaei N, Rafiei Dehbidi G, Zarghampoor F, et al. Detection of Mycobacterium tuberculosis in Peripheral Blood Mononuclear Cells from Patients with Pulmonary Tuberculosis. Jundishapur J Microbiol. 2023;16(6):e134575. doi: https://doi.org/10.5812/jjm-134575

Abstract

Background:

Pulmonary tuberculosis is currently diagnosed using traditional techniques, such as smear production from sputum samples, to detect acid-fast bacilli (AFB) and bacteriological culture. The detection of Mycobacterium tuberculosis DNA in peripheral blood samples could potentially aid in tuberculosis diagnosis.

Objectives:

This study aimed to compare the effectiveness of polymerase chain reaction (PCR) assay on peripheral blood mononuclear cells (PBMCs) with established diagnostic techniques for detecting M. tuberculosis.

Methods:

We collected peripheral blood and sputum samples from 45 patients with smear-positive pulmonary tuberculosis. Standard microscopy and culture techniques were performed on both sputum and PBMC samples. The PCR was conducted on PBMC and sputum specimens using primers specific for the M. tuberculosis complex insertion sequence IS6110.

Results:

Thirty-nine sputum samples and 2 PBMC samples were determined to contain M. tuberculosis based on bacterial culture and biochemical tests. PCR results were positive for 32 (82%) sputum samples and 29 (75%) PBMC samples. None of the PBMCs tested positive through AFB staining.

Conclusions:

The M. tuberculosis PCR assay on PBMCs using IS6110 primers demonstrated high sensitivity and specificity in detecting M. tuberculosis DNA. However, the implementation of real-time PCR with a specific probe may further enhance the detection of M. tuberculosis DNA in peripheral blood.

1. Background

Tuberculosis is an infectious disease, the cause of one of the world’s major illnesses, and a leading cause of death. Before COVID-19 became a pandemic, tuberculosis had been the leading cause of death caused by a single infectious pathogen and preceded HIV/AIDS (1-3). Tuberculosis is caused by Mycobacterium tuberculosis, which is transmitted when a tuberculosis patient releases the bacterium into the air (such as a cough). The disease usually affects the lungs (pulmonary tuberculosis), but it can also affect other organs. Most people (about 90%) who develop the disease are adults, with more men than women. The World Health Organization (WHO) estimates that almost a quarter of the world’s population is infected with M. tuberculosis (4).
The latest WHO global health report shows that tuberculosis is still the most common cause of death from infectious diseases worldwide. Approximately 10 million people developed tuberculosis in 2020, and there were 1.3 million deaths from tuberculosis among HIV-negative people in that year (5). As a result of the emergence of multi-drug resistant (MDR) and extensive drug-resistant (XDR) tuberculosis, global efforts are being made to end the tuberculosis epidemic by 2030 (6, 7). Tuberculosis is mainly detected and diagnosed using smear microscopy for acid-fast bacilli (AFB), yet mycobacterial cultures remain the gold standard for the laboratory confirmation of tuberculosis disease. In many developing countries, tuberculosis diagnosis is based on clinical findings, chest radiography, and AFB detection in smears and sputum cultures. Although highly effective, these methods do not provide sufficiently rapid results for clinicians, making the rapid diagnosis of tuberculosis still a challenging task (8). Scientists have looked for alternatives that do not rely on cultures to replace old-fashioned cultural techniques (9, 10).
There are advances in molecular diagnostic methods, which are superior to culture-based tests for tuberculosis. For example, polymerase chain reaction (PCR)-based Xpert MTB/RIF assay can increase the diagnosis speed and clinical sensitivity in multibacillary tuberculosis, but it still requires sputum or invasive biopsy specimens (11-14). Active and latent tuberculosis infection diagnosis can also be made through a tuberculin skin test (TST) and interferon-gamma release assay (IGRA). However, TSTs are not specific because BCG vaccination and exposure to non-tuberculous mycobacteria (NTM) lead to reactions that mimic the genuine M. tuberculosis infection (8). Due to insufficient specimen material and a lack of bacteria in specimens, the diagnosis of extrapulmonary and infant tuberculosis is particularly difficult. Therefore, it is imperative to develop an accurate and sensitive method for identifying active pulmonary, extrapulmonary, and infant tuberculosis.
Sputum is the most commonly used material for diagnosing pulmonary tuberculosis, but it poses transmission risks and cannot be collected from all patients, especially children. Therefore, there is a need to explore alternative materials for cases where sample collection is difficult. The detection of M. tuberculosis DNA in peripheral blood samples may be helpful for the diagnosis of tuberculosis in patients with pulmonary tuberculosis who cannot produce sputum and patients with extra-pulmonary tuberculosis (15-17). However, studies concerning the diagnostic effectiveness of this method are limited.

2. Objectives

This study aimed to compare the effectiveness of PCR assay on DNA specimens extracted from peripheral blood leukocytes with the conventional methods of M. tuberculosis detection in patients suspected of pulmonary tuberculosis.

3. Methods

3.1. Patients and Samples

The study included 45 new cases of smear-positive patients who visited the Shiraz Mycobacteriology Regional Reference Laboratory between January and December 2019 and had not received any previous anti-tuberculosis therapy. All cases of pulmonary tuberculosis with at least 2 positive sputum AFB tests and no history of prior treatment with anti-tuberculosis drugs were considered new cases. Among the patients, there were 17 females aged between 22 and 79 (mean, 48 years) and 25 males aged between 22 and 86 years (mean, 52 years). Peripheral blood samples (2 mL) were collected into EDTA vacutainer tubes to isolate mononuclear cells. Peripheral blood mononuclear cells (PBMCs) were separated from the whole blood using a density gradient centrifugation method. The collected blood samples were diluted 1: 1 with phosphate-buffered saline and then used to obtain PBMCs by density-gradient centrifugation with Ficoll-Paque Plus (1.077 g/mL; Cytiva Life Sciences, Uppsala, Sweden) according to the manufacturer’s instructions.
The isolated cells were distributed into 2 fractions. After adding 300 μL of Tris buffer, a fraction of the cells were stored at - 80°C for molecular experiments. In addition, 105 - 106 viable cells were isolated from another fraction of the cells and immediately stained to detect AFB and were also cultured for the initial isolation of Mycobacterium strains using the Petroff decontamination method and Lowenstein-Jensen (LJ) culture medium.

3.2. Bacterial Culture

According to the standard protocol and after performing the Petroff decontamination method, the patients’ sputum samples and the isolated mononuclear cells were cultured on the LJ medium (17). Microscopic examination of the PBMCs treated with the Petroff decontamination method indicated that all the PBMCs were lysed, which was necessary to release intracellular bacteria for further propagation in the culture medium.

3.3. Acid-Fast Staining

In order to detect AFB, the Ziehl-Neelsen carbol-fuchsin staining method and its modification without heating the dye (Kinyoun cold staining) was performed on both sputum and PBMC samples (18).

3.4. DNA Extraction from PBMCs

DNA extraction was performed on PBMCs using a Blood DNA Isolation Mini Kit (Norgen Biotek Corp, Ontario, Canada) according to the manufacturer’s protocol. Genomic DNA from M. tuberculosis strain H37Rv (ATCC 25618) was used as a positive control. In addition to a positive control, a negative control (PCR mix without template DNA) was included in each independent PCR assay.

3.5. DNA Extraction from Sputum Samples

Total DNA was extracted from the sputum samples by the phenol-chloroform method, as previously reported (19).

3.6. Detection of the Mycobacterium tuberculosis-specific IS6110 Sequence Using the PCR Assay

The detection of M. tuberculosis was done using a specific pair of primers designed to amplify an insertion sequence IS6110 in the M. tuberculosis complex, and the expected band size was 168 bp (Table 1). PCR was carried out in an ASTEC gradient thermal cycler (PC-818S; Astec Co, Japan). The amplification reactions were performed in a final volume of 25 µL containing 1x PCR buffer (10 mmol/L Tris–HCl [pH = 9]), 50 mmol/L KCl,), 1.5 mM MgCl2, 0.2 mM dNTPs, primers TB1 and TB2 (10 pmol/µL each), 1 unit/µL Taq DNA polymerase, and 2 µL of extracted DNA. Amplification was performed as follows: First, denaturation step at 95°C for 5 minutes, followed by 30 cycles of 20-second denaturation at 94°C, 1-minute annealing at 65°C, and 20-second extension at 72°C. The final extension was carried out at 72°C for 10 minutes. Amplified DNA fragments were then electrophoresed on a 1.5% agarose gel and 1x TBE buffer and stained with 1x GelRed Nucleic Acid Gel Stain (Biotium Inc, Hayward, CA, USA).
Table 1.The Sequence of Primers Used for the Amplification of the IS6110 Mycobacteriuma
Primer NameSequences (5’ to 3’)Nucleotide Positions *Product Size (bp)
TB1 (forward)ATCCTGCGAGCGTAGGCGTCGG3850242 - 3850263168
TB2 (reverse) CAGGACCACGATCGCTGATCCGG3850409 - 3850387

a The numbers refer to the position of the nucleotides according to the reference sequence (GenBank accession number CP095023).

3.7. Sensitivity and Specificity of the PCR Assay

To find out the limit of detection (LOD) of the PCR assay, negative samples were spiked with 10-fold dilutions of the M. tuberculosis reference strain H37Rv. The Primer-BLAST program was used to verify the target specificity of the primers. In addition, to validate the specificity of the PCR assays, extracted DNA from atypical Mycobacterium strains was used.

4. Results

The lowest detection limit of agarose gel electrophoresis using primer pairs for the IS6110 gene was 0.75 pg/reaction. There was no cross-reaction between atypical Mycobacterium strains and the primers specific for M. tuberculosis. Also, 100% specificity was determined when the Primer-BLAST program aligned the primers.

4.1. Mycobacterium tuberculosis Isolation

Of the 45 AFB-positive sputum samples, 45 (100%) were culture-positive. However, 6 (13.3%) were diagnosed as NTM strains by confirmatory tests. On the other hand, of the 45 PBMC samples, only 2 (4.5%) were culture-positive. In addition, the sputum culture from one of those patients was negative. All sputum and PBMC samples were stained by the Ziehl-Neelsen staining method. While all sputum samples were positive, none of the patients’ blood samples tested positive for AFB.

4.2. Molecular Detection of Mycobacterium tuberculosis in Blood Samples

As a part of our study to determine the sensitivity and specificity of PCR assays for detecting M. tuberculosis DNA in blood and sputum samples, the technique was compared with the conventional bacterial culture as the gold standard method. Using primers amplifying a 168-bp fragment of the IS6110 sequence, M. tuberculosis DNA was detected in 32 out of 39 (82%) sputum samples from culture-positive patients. When the blood samples from the same patients were examined for the presence of M. tuberculosis DNA, 29 out of 39 (75%) were positive. DNA extracted from blood samples of patients with negative PCR results on their sputum samples was also negative (Figure 1). Based on the results obtained from the PCR assay, the sensitivity of PCR for the detection of M. tuberculosis DNA in sputum samples was found to be 85% in comparison to the 80% sensitivity of the PCR assay on blood samples, indicating no statistically significant difference (Figure 2).
Agarose gel electrophoresis of polymerase chain reaction (PCR) products from peripheral blood mononuclear cells (PBMCs) of patients with pulmonary tuberculosis. Lane 1: 100-bp DNA ladder; Lane 2: Positive control (<i>H37Rv</i> DNA); Lane 3 - 19: Patient samples; Lane 20: Negative control
Figure 1.

Agarose gel electrophoresis of polymerase chain reaction (PCR) products from peripheral blood mononuclear cells (PBMCs) of patients with pulmonary tuberculosis. Lane 1: 100-bp DNA ladder; Lane 2: Positive control (H37Rv DNA); Lane 3 - 19: Patient samples; Lane 20: Negative control

Bacterial culture, polymerase chain reaction (PCR) assay, and acid-fast bacilli (AFB) staining results of sputum and blood specimens
Figure 2.

Bacterial culture, polymerase chain reaction (PCR) assay, and acid-fast bacilli (AFB) staining results of sputum and blood specimens

5. Discussion

We report the presence of M. tuberculosis complex DNA in PBMCs of sputum smear-positive adult patients suspected of pulmonary tuberculosis. Mycobacterium tuberculosis DNA was found in PBMCs of more than three-quarters of culture-positive sputum samples collected from the patients. Additionally, 90% of sputum samples that tested positive for M. tuberculosis DNA by PCR also tested positive in blood samples. For rapid diagnosis, this project aimed to use the molecular method and blood samples for people suspected of having pulmonary tuberculosis but cannot provide sputum samples. While all the patients in this study were adults, the results may also be applied to patients who are younger (19). Additionally, these patients were all newly diagnosed cases, and patients receiving treatment were not included in this group.
Currently, the MDR-TB GeneXpert MTB/RIF assay is the only molecular test recommended by the WHO for the rapid diagnosis of tuberculosis and resistance to rifampicin within approximately 2 hours (20, 21). The major disadvantage of the assay is the lowest sensitivity and specificity in respiratory or other samples in children (22). It is also expensive and needs sophisticated instruments. However, conventional culture methods remain the gold standard for confirming active tuberculosis infections. Nucleic acid amplification tests are a good alternative for the primary diagnosis of M. tuberculosis infection since cultivation is time-consuming and laborious. Usually, for diagnosing pulmonary tuberculosis, the correct sample type is sputum. Nevertheless, in some cases, M. tuberculosis may not enter the sputum but be present at a low concentration in blood. Therefore, it is possible to find low levels of M. tuberculosis DNA in the blood.
In the present study, we chose IS6110 as the target of detection because it is found exclusively within the members of the M. tuberculosis complex and has long been used to detect M. tuberculosis-specific DNA sequences as a sensitive and fast diagnostic target. Also, there are multiple copies of the IS6110 element in the M. tuberculosis genome, which is believed to lead to higher sensitivity (23). All 45 sputum samples, which tested positive for AFB strains, were culture-positive on the LJ medium. However, 6 were diagnosed as NTM using confirmation tests. No amplification was obtained when the PCR assay was performed on the DNA extracted from sputum samples of the patients with NTM. The reason for this was the specific performance of the primers selected for M. tuberculosis. When the PBMCs were isolated, processed for decontamination, and cultured, M. tuberculosis was grown on the LJ medium from 2 samples, and no growth was observed for the other samples. This may be due to the limited number of bacteria in the small volume of the blood samples collected from the patients. However, due to the high sensitivity of the PCR assay, the detection of nucleic acids in blood samples is possible. In addition, the loss of some bacteria during decontamination can be another reason for the negative culture results of processed PBMC samples. It has been reported that 4% NaOH resulted in the minimum recovery of pure cultures, while 2% NaOH showed a significant recovery of M. tuberculosis in the culture medium (23).
Moreover, conventional smear microscopy with Ziehl-Neelsen staining was performed on blood and sputum samples to diagnose tuberculosis bacteria. While all sputum samples tested positive for tuberculosis bacteria, this method did not detect bacilli in any blood samples. Studies have shown that 10000 organisms per milliliter of sputum are required to allow the detection of bacteria in stained smears (24). As a result, acid-fast staining on blood samples is also expected to be negative due to the low volume of blood collected and the small number of bacteria in the samples. On the other hand, because the M. tuberculosis genome contains a significant number of IS6110 elements, PCR tests can still be used if the number of bacteria in a patient’s blood sample is low. Although diagnosing M. tuberculosis in a patient sample is very important, determining drug resistance is equally important (25-27). GeneXpert technology has eased the assessment of drug resistance to rifampin to some extent. However, it is still necessary to perform drug susceptibility testing on colonies isolated from the culture medium.

5.1. Conclusions

The PCR assay on PBMC samples using IS6110 primers has high sensitivity and specificity to detect M. tuberculosis DNA. Therefore, it could develop into a minimally invasive, sensitive, and timely diagnostic approach. In addition, PCR on blood samples could be practical for children or patients who cannot produce sputum for examination. However, adapting real-time PCR on blood samples using probes specific for M. tuberculosis and rifampin-resistant strains seems to be more helpful to increase the sensitivity and specificity of the detection.

Acknowledgments

Footnotes

References

  • 1.
    McQuaid CF, Vassall A, Cohen T, Fiekert K, White RG. The impact of COVID-19 on TB: A review of the data. Int J Tuberc Lung Dis. 2021;25(6):436-46. [PubMed ID: 34049605]. [PubMed Central ID: PMC8171247]. https://doi.org/10.5588/ijtld.21.0148.
  • 2.
    Togun T, Kampmann B, Stoker NG, Lipman M. Anticipating the impact of the COVID-19 pandemic on TB patients and TB control programmes. Ann Clin Microbiol Antimicrob. 2020;19(1):21. [PubMed ID: 32446305]. [PubMed Central ID: PMC7245173]. https://doi.org/10.1186/s12941-020-00363-1.
  • 3.
    McQuaid CF, McCreesh N, Read JM, Sumner T, Cmmid Covid- Working Group, Houben R, et al. The potential impact of COVID-19-related disruption on tuberculosis burden. Eur Respir J. 2020;56(2). [PubMed ID: 32513784]. [PubMed Central ID: PMC7278504]. https://doi.org/10.1183/13993003.01718-2020.
  • 4.
    Chakaya J, Khan M, Ntoumi F, Aklillu E, Fatima R, Mwaba P, et al. Global Tuberculosis Report 2020 - Reflections on the Global TB burden, treatment and prevention efforts. Int J Infect Dis. 2021;113 Suppl 1(Suppl 1):S7-S12. [PubMed ID: 33716195]. [PubMed Central ID: PMC8433257]. https://doi.org/10.1016/j.ijid.2021.02.107.
  • 5.
    Glaziou P. Predicted impact of the COVID-19 pandemic on global tuberculosis deaths in 2020. MedRxiv. 2021. https://doi.org/10.1101/2020.04.28.20079582.
  • 6.
    Petersen E, Blumberg L, Wilson ME, Zumla A. Ending the global tuberculosis epidemic by 2030 - the moscow declaration and achieving a major translational change in delivery of TB healthcare. Int J Infect Dis. 2017;65:156-8. [PubMed ID: 29203390]. https://doi.org/10.1016/j.ijid.2017.11.029.
  • 7.
    Granich R. Is the global tuberculosis control strategy too big to fail? Lancet. 2018;392(10160):2165. [PubMed ID: 30392902]. https://doi.org/10.1016/S0140-6736(18)32751-X.
  • 8.
    Elhassan MM, Elmekki MA, Osman AL, Hamid ME. Challenges in diagnosing tuberculosis in children: A comparative study from Sudan. Int J Infect Dis. 2016;43:25-9. [PubMed ID: 26701818]. https://doi.org/10.1016/j.ijid.2015.12.006.
  • 9.
    Nurwidya F, Handayani D, Burhan E, Yunus F. Molecular diagnosis of tuberculosis. Chonnam Med J. 2018;54(1):1-9. [PubMed ID: 29399559]. [PubMed Central ID: PMC5794472]. https://doi.org/10.4068/cmj.2018.54.1.1.
  • 10.
    Luo RF, Banaei N. Molecular approaches and biomarkers for detection of Mycobacterium tuberculosis. Clin Lab Med. 2013;33(3):553-66. [PubMed ID: 23931838]. https://doi.org/10.1016/j.cll.2013.03.012.
  • 11.
    Evans CA. GeneXpert--a game-changer for tuberculosis control? PLoS Med. 2011;8(7). e1001064. [PubMed ID: 21814497]. [PubMed Central ID: PMC3144196]. https://doi.org/10.1371/journal.pmed.1001064.
  • 12.
    Pai M, Schito M. Tuberculosis diagnostics in 2015: landscape, priorities, needs, and prospects. J Infect Dis. 2015;211 Suppl 2(Suppl 2):S21-8. [PubMed ID: 25765103]. [PubMed Central ID: PMC4366576]. https://doi.org/10.1093/infdis/jiu803.
  • 13.
    Boehme CC, Nabeta P, Hillemann D, Nicol MP, Shenai S, Krapp F, et al. Rapid molecular detection of tuberculosis and rifampin resistance. N Engl J Med. 2010;363(11):1005-15. [PubMed ID: 20825313]. [PubMed Central ID: PMC2947799]. https://doi.org/10.1056/NEJMoa0907847.
  • 14.
    Cowan JF, Chandler AS, Kracen E, Park DR, Wallis CK, Liu E, et al. Clinical Impact and Cost-effectiveness of Xpert MTB/RIF testing in hospitalized patients with presumptive pulmonary tuberculosis in the united states. Clin Infect Dis. 2017;64(4):482-9. [PubMed ID: 28172666]. [PubMed Central ID: PMC5399932]. https://doi.org/10.1093/cid/ciw803.
  • 15.
    Click ES, Murithi W, Ouma GS, McCarthy K, Willby M, Musau S, et al. Detection of apparent Cell-free M. tuberculosis DNA from plasma. Sci Rep. 2018;8(1):645. [PubMed ID: 29330384]. [PubMed Central ID: PMC5766485]. https://doi.org/10.1038/s41598-017-17683-6.
  • 16.
    Acharya B, Acharya A, Gautam S, Ghimire SP, Mishra G, Parajuli N, et al. Advances in diagnosis of Tuberculosis: an update into molecular diagnosis of Mycobacterium tuberculosis. Mol Biol Rep. 2020;47(5):4065-75. [PubMed ID: 32248381]. https://doi.org/10.1007/s11033-020-05413-7.
  • 17.
    Theron G, Peter J, Calligaro G, Meldau R, Hanrahan C, Khalfey H, et al. Determinants of PCR performance (Xpert MTB/RIF), including bacterial load and inhibition, for TB diagnosis using specimens from different body compartments. Sci Rep. 2014;4:5658. [PubMed ID: 25014250]. [PubMed Central ID: PMC5375978]. https://doi.org/10.1038/srep05658.
  • 18.
    Ködmön C. Handbook on TB laboratory diagnostic methods for the European Union. ECDC; 2016.
  • 19.
    Amita J, Vandana T, Guleria RS, Verma RK. Qualitative evaluation of mycobacterial DNA extraction protocols for polymerase chain reaction. Mol Biol Today. 2002;3(2):43-9.
  • 20.
    Kabir S, Parash MTH, Emran NA, Hossain A, Shimmi SC. Diagnostic challenges and Gene-Xpert utility in detecting Mycobacterium tuberculosis among suspected cases of Pulmonary tuberculosis. PLoS One. 2021;16(5). e0251858. [PubMed ID: 34015016]. [PubMed Central ID: PMC8136641]. https://doi.org/10.1371/journal.pone.0251858.
  • 21.
    World Health Organization. Meeting report of the WHO expert consultation on the definition of extensively drug-resistant tuberculosis. 2020. Available from: https://www.who.int/publications/i/item/9789240018662.
  • 22.
    Orikiriza P, Nansumba M, Nyehangane D, Bastard M, Mugisha IT, Nansera D, et al. Xpert MTB/RIF diagnosis of childhood tuberculosis from sputum and stool samples in a high TB-HIV-prevalent setting. Eur J Clin Microbiol Infect Dis. 2018;37(8):1465-73. [PubMed ID: 29740714]. https://doi.org/10.1007/s10096-018-3272-0.
  • 23.
    Lemaitre N, Armand S, Vachee A, Capilliez O, Dumoulin C, Courcol RJ. Comparison of the real-time PCR method and the Gen-Probe amplified Mycobacterium tuberculosis direct test for detection of Mycobacterium tuberculosis in pulmonary and nonpulmonary specimens. J Clin Microbiol. 2004;42(9):4307-9. [PubMed ID: 15365029]. [PubMed Central ID: PMC516309]. https://doi.org/10.1128/JCM.42.9.4307-4309.2004.
  • 24.
    Rasool G, Khan AM, Mohy-Ud-Din R, Riaz M. Detection of Mycobacterium tuberculosis in AFB smear-negative sputum specimens through MTB culture and GeneXpert((R)) MTB/RIF assay. Int J Immunopathol Pharmacol. 2019;33:2058738419827170. [PubMed ID: 30791749]. [PubMed Central ID: PMC6360468]. https://doi.org/10.1177/2058738419827174.
  • 25.
    Cheraghzadeh M, Nezhad SRK, Zarghampoor F. The basic of bacterial resistance to antimicrobial drugs. Health Biotech Biopharma (HBB). 2018;2:56-68.
  • 26.
    Jaktaji RP, Zargampoor F. Expression of tolC and organic solvent tolerance of Escherichia coli ciprofloxacin resistant mutants. Iran J Pharmaceutical Res. 2017;16(3):1185.
  • 27.
    Naidoo K, Dookie N. Can the GeneXpert MTB/XDR deliver on the promise of expanded, near-patient tuberculosis drug-susceptibility testing? Lancet Infect Dis. 2022;22(4):e121-7. [PubMed ID: 35227392]. https://doi.org/10.1016/S1473-3099(21)00613-7.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles