Prevalence and Genotyping of Helicobacter pylori Isolated From Meat, Milk and Vegetable in Iran

Author(s):
Ali TalimkhaniAli Talimkhani1, Zohreh MashakZohreh MashakZohreh Mashak ORCID2,*
1Student of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran
2Department of Food Hygiene, Karaj Branch, Islamic Azad University, Karaj, Iran

Jundishapur Journal of Microbiology:Vol. 10, issue 11; e14240
Published online:Oct 21, 2017
Article type:Research Article
Received:May 29, 2017
Accepted:Aug 16, 2017
How to Cite:Talimkhani A, Mashak Z. Prevalence and Genotyping of Helicobacter pylori Isolated From Meat, Milk and Vegetable in Iran. Jundishapur J Microbiol. 2017;10(11):e14240. doi: https://doi.org/10.5812/jjm.14240

Abstract

Background:

Despite the considerable clinical role of Helicobacter pylori, its certain routes of transmission and origin have not been reported. Based on the argumentative hypothesis, foods play an imperative role in the spread of H. pylori to humans.

Objectives:

The current research was done to investigate the prevalence rate and distribution of Vacuolating Cytotoxin A and Cytotoxin Associated Gene A genotypes in the H. pylori strains isolated from meat, milk, and vegetables.

Methods:

A total of 340 food samples were collected and directly moved to the laboratory. Samples were cultured and H. pylori colonies were approved using the gram staining, urease test, and 16s rRNA-based polymerase chain reaction (PCR) amplification. Positive strains were tested for distribution of vacA and cagA genotypes using the multiplex-PCR.

Results:

Out of 340 samples, 40 (11.76%) harbored H. pylori. Prevalence of H. pylori in meat, milk, and vegetable samples were 7.33%, 16%, and 12.50%, respectively. Ovine milk (26%) was the most commonly contaminated sample. The most commonly detected genotypes were vacA s1a (87.50%), vacA m1a (87.50%), vacA s2 (82.50%), cagA (80%), and vacA m2 (62.50%). Genotypes of S1am1a (62.50%), s2m1a (55%), s1am2 (50%), s2m2 (45%), and m1am2 (42.50%) were the most commonly detected combined genotypes.

Conclusions:

Milk, vegetables, and meat, are latent sources of H. pylori. Similarity in the genotyping pattern of H. pylori strains of various samples represents their similar sources of infection. Further studies are required for finding the exact sources of H. pylori strains.

1. Background

Vegetable, meat, and milk are the most commonly consumed foods all around the world. High nutritional values of these foods for vitamins, mineral, fat, carbohydrate, protein, and other types of nutritional factors make them suitable for nutrition of children, youth, middle-aged, and elderly (1). Vegetables are in close contact with polluted soil, which is a source of many pathogenic agents. They are also irrigated with polluted non-drinking water and are mainly strengthened with human- and animal-based manures. Animal meat is mainly processed in a contaminated environment of slaughterhouses and are in close contact with blood, contents of the gastrointestinal tract, wool of animal, and also infected hands of butchers and meat inspectors. Animal milk is mainly achieved by traditional milking using hands and kept as well as transported in contaminated dishes. These options increase the possibility of their contamination with many types of pathogenic agents (2-4).
Helicobacter pylori is a microaerophilic and gram-negative bacterium, which is known as the causative agent of gastritis, peptic ulcer, adenocarcinoma, and lymphoma especially in the gastrointestinal tract (5). Documented data revealed that 20% to 90% of hospitalized patients with gastrointestinal disorders were infected with H. pylori strains (5, 6). In keeping with this, there were no previously recorded data regarding the main sources and also route of transmission of H. pylori into human (7). Several previously published data revealed that H. pylori had a significant prevalence in various types of foods, especially milk, meat, salad, vegetables, and ready to eat foods, which may show the food-borne route of this bacterium (8-10).
To evaluate the epidemiology of H. pylori, assessment of genotypes is important. Vacuolating Cytotoxin A (vacA) and Cytotoxin Associated Gene A (cagA) are the most important virulence markers detected in the H. pylori strains isolated from the cases of gastrointestinal disorders and also foods (11). Vacuolating Cytotoxin A gene is polymorphic and has variable structures. This gene is including mutable signal regions (s1 and s2) and mid-regions (m1 and m2). The s1 region is additionally subtyped into s1a, s1b, as well as s1c, and the m1 into m1a and m1b subtypes. Cytotoxin associated gene A is mainly associated with occurrence of ulceration, inflammation and carcinoma (11, 12). It has also been detected in the samples taken from foods and also clinical gastrointestinal disorders (11, 12).

2. Objectives

According to the uncertain role of foods in the transmission of H. pylori to humans, as well as based on the lack of epidemiological and microbiological researches in this field in Iran, the present study was done in order to assess the prevalence rate and genotyping of vacA and cagA alleles of H. pylori strains isolated from raw meat, milk, and vegetable samples in Iran.

3. Methods

3.1. Ethics Statement

The study was approved by the ethical committee of research of the faculty of veterinary Medicine of the Islamic Azad University of Karaj, Iran (Consent Ref Number 95 - 210). Verification of this research project and the licenses related to the sampling process were approved by Dr. Zohreh Mashak (Approval Ref Number FST-95-210).

3.2. Sample Collection

From May 2016 to December 2016, a total of 340 food samples, including bovine raw meat (n = 50), ovine raw meat (n = 50), caprine raw meat (n = 50), bovine raw milk (n = 50), ovine raw milk (n = 50), caprine raw milk (n = 50), and raw vegetables (n = 40) were collected from the shopping centers of the Alborz province, Iran. Samples (200 g) were directly transported to the laboratory at 4 0C. All samples were kept under refrigeration in plastic bags.

3.3. Isolation of Helicobacter pylori

Twenty-five milligrams of each homogenized sample were added to 225 mL of Wilkins Chalgren anaerobe broth (Oxoid, UK) supplemented with 5% of horse serum (Sigma, St. Louis, MO, USA), colistin methanesulfonate (30 mg/L) (Oxoid, UK) and several types of antibiotic agents including nalidixic acid (Oxoid, UK), and trimethoprim (30 mg/L) (Oxoid, UK), cycloheximide (100 mg/L) (Oxoid, UK), and vancomycin (10 mg/L) (Oxoid, UK). All media were then incubated on microaerophilic conditions at 37°C for 7 days. Then, 0.1 mL of media was transmitted onto Wilkins Chalgren anaerobe agar (Oxoid, UK) supplemented with above mentioned materials. All media were then incubated on microaerophilic conditions at 37°C for 7 days. Colonies were then approved using the gram staining, urease test, as well as PCR based amplification of 16S rRNA specific gene of the H. pylori (HP-F: 5’-CTGGAGAGACTAAGCCCTCC-3’ and HP-R: 5’-ATTACTGACGCTGATTGTGC-3) (110 bp) (Bioneer, South Korea) (13).

3.4. Genotyping of vacA and cagA Genotypes

DNA was extracted from the bacterial colonies using the DNA extraction and purification kit (Fermentas, Germany). Protocol was done according to the manufacture’s instruction. Multiplex PCR was used to study the distribution of vacA (s1a, s1b, s1c, s2, m1a, m1b and m2) and cagA genotypes. List of primers and PCR condition is shown in Table 1 (14, 15). All runs were done using a programmable thermal cycler (Eppendorf-Netheler-Hinz GmbH, Germany) PCR device. Amplified PCR products (15 μL) were subjected to electrophoresis in 1.5% agarose gel in 1X TBE buffer at 80 V for 30 minutes, stained with CYBR Green (Fermentas, Germany). UVIdoc gel documentation system (UVIDoc, UK) was used for gel analysis. All runs comprised PCR grade water (Fermentas, Germany) as a negative control and also positive control (26695, J99, SS1, Tx30, 88-23 and 84-183) (Razi, Iran).
Table 1.Oligonucleotide Primers, Volume, and Programs of PCR Reactions is Used for Genotyping of vacA and cagA Alleles of Helicobacter pylori Strains of Milk, Meat, and Vegetable Samples (14, 15)
GenesPrimer Sequence (5’ - 3’)Size of Product, bpVolume of PCR Reaction, 50 µLPCR Programs
vacA s1aF: CTCTCGCTTTAGTAGGAGC2135 µL PCR buffer 10X, 1.5 mM Mgcl2, 200 µM dNTP (Fermentas), 0.5 µM of each primers F and R, 1.25 U Taq DNA polymerase (Fermentas), 2.5 µL DNA template1 cycle: 95°C - 1 min. 32 cycle: 95°C - 45 s,64°C - 50 s, 72°C - 70 s. 1 cycle: 72°C - 5 min.
R: CTGCTTGAATGCGCCAAAC
vacA s1bF: AGCGCCATACCGCAAGAG187
CTGCTTGAATGCGCCAAAC
vacA s1cF: CTCTCGCTTTAGTGGGGYT213
R: CTGCTTGAATGCGCCAAAC
vacA s2F: GCTAACACGCCAAATGATCC199
R: CTGCTTGAATGCGCCAAAC
vacA m1aF: GGTCAAAATGCGGTCATGG290
R: CCATTGGTACCTGTAGAAAC
vacA m1bF: GGCCCCAATGCAGTCATGGA291
R: GCTGTTAGTGCCTAAAGAAGCAT
vacA m2F: GGAGCCCCAGGAAACATTG352
R: CATAACTAGCGCCTTGCA
cag AF: GATAACAGCCAAGCTTTTGAGG3005 µL PCR buffer 10X, 2 mM Mgcl2, 150 µM dNTP (Fermentas), 0.75 µM of each primers F and R, 1.5 U Taq DNA polymerase (Fermentas), 3 µL DNA template1 cycle: 94°C - 1 min. 32 cycle: 95°C - 60 s, 56°C - 60 s, 72°C - 60 s. 1 cycle: 72°C - 10 min.
R: CTGCAAAAGATTGTTTGGCAGA

3.5. Statistical Analysis

Microsoft Excel software (Microsoft Corp., Redmond, WA, USA) was used for data analysis. Statistical analysis was done using the SPSS 21.0 statistical software (SPSS Inc., Chicago, IL, USA). Chi-square test and Fisher’s exact 2-tailed tests were used to assess any significant relationship between prevalence of H. pylori strains and their genotypes. P value < 0.05 was considered as statistical significant level.

4. Results

Table 2 represents the total distribution of H. pylori in various types of food samples. We found that the total prevalence of H. pylori in various types of food samples was 11.76%. Prevalence of H. pylori in raw meat, milk, and vegetable samples were 7.33%, 16%, and 12.50%, respectively. Ovine milk had the highest prevalence of H. pylori (26%), while bovine meat had the lowest (4%). Statistically significant difference was seen between the types of samples and prevalence of H. pylori (P < 0.05).
Table 2.Total Distribution of Helicobacter pylori in Various Types of Food Samples
Types of SamplesNo. Samples CollectedPositive Results for H. pylori (%)
Meat
Bovine502 (4)
Ovine505 (10)
Caprine504 (8)
Total15011 (7.33)
Milk
Bovine504 (8)
Ovine5013 (26)
Caprine507 (14)
Total15024 (16)
Vegetable405 (12.50)
Total34040 (11.76)
Table 3 represents the distribution of various genotypes in the H. pylori strains of various types of food samples. We found that vacA s1a (87.50%), vacA m1a (87.50%), vacA s2 (82.50%), cagA (80%), and vacA m2 (62.50%) were the most commonly detected genotypes in H. pylori strains. Ovine samples had the most variables and also the highest prevalence of all studied genotypes. A statistically significant difference was seen between the source of samples and distribution of genotypes (P < 0.05).
Table 3.Distribution of Various Genotypes in Helicobacter Pylori Strains of Food Samples
Types of Samples (No. Positive)Distribution of Genotypes (%)
S1aS1bS1cS2M1aM1bM2CagA
Meat
Bovine (2)1 (50)--1 (50)1 (50)-1 (50)1 (50)
Ovine (5)5 (100)2 (40)1 (20)5 (100)5 (100)2 (40)3 (60)4 (80)
Caprine (4)3 (75)1 (25)-3 (75)3 (75)1 (25)2 (50)3 (75)
Total (11)9 (81.81)3 (27.27)1 (9.09)9 (81.81)9 (81.81)3 (27.27)6 (54.54)8 (72.72)
Milk
Bovine (4)2 (50)--2 (50)2 (50)-1 (25)2 (50)
Ovine (13)13 (100)5 (38.46)3 (23.07)13 (100)13 (100)7 (53.84)10 (76.92)12 (92.30)
Caprine (7)6 (85.71)1 (14.28)1 (14.28)5 (71.42)6 (85.71)1 (14.28)4 (57.14)6 (85.71)
Total (24)21 (87.50)6 (25)4 (16.66)20 (83.33)21 (87.50)8 (33.33)15 (62.50)20 (83.33)
Vegetable (5)5 (100)3 (60)1 (20)4 (80)5 (100)1 (20)4 (80)4 (80)
Total (40)35 (87.50)12 (30)6 (15)33 (82.50)35 (87.50)12 (30)25 (62.50)32 (80)
Table 4 represents the total distribution of combined genotypes in the H. pylori isolates of food samples. We found that s1am1a (62.50%), s2m1a (55%), s1am2 (50%), s2m2 (45%), and m1am2 (42.50%) were the most commonly detected combined genotypes. Genotypes of s1cm1a (2.50%), s1cm1b (2.50%), and s1cm2 (2.50%) had the lowest distribution among the H. pylori isolates of food samples.
Table 4.Distribution of Combined Genotypes of Helicobacter Pylori Isolated from Various Types of Food Samples
GenotypesPrevalence (%)a
S1am1a25 (62.50)
S1am1b5 (12.50)
S1am220 (50)
S1bm1a4 (10)
S1bm1b2 (5)
S1bm24 (10)
S1cm1a1 (2.50)
S1cm1b1 (2.50)
S1cm21 (2.50)
S2m1a22 (55)
S2m1b5 (12.50)
S2m218 (45)
M1am217 (42.50)
M1bm24 (10)
CagA+32 (80)
CagA-8 (20)

aFrom a total of 40 positive strains of H. pylori.

5. Discussion

Results of the present study showed that H. pylori had a considerable prevalence in milk, vegetable, and meat samples. Results also indicated the high distribution of putative genotypes in H. pylori isolates of milk, meat, and vegetables. Total prevalence of H. pylori was 11.76%. This levels of prevalence of H. pylori in food samples was higher than that of Rahimi and Kheirabadi (2012) (16) (Iran, 0.67% in milk samples), Gilani et al. (2017) (17) (Iran, 5% in meat samples) and Atapoor et al. (2014) (4) (9.56% in vegetable), while was lower than that of Talaei et al. (2015) (18) (Iran, 4.76% - 20% in milk samples), Safaei et al. (2011) (19) (Iran, 16% in milk samples), Fujimura et al. (2002) (20) (Japan, 72.20% in milk samples), Esmaeiligoudarzi et al. (2015) (21) (Iran, 13.75% in milk samples and dairy products), El-Gohary et al. (2015) (22) (Egypt, 21.70% in milk samples), Saeidi and Sheikhshahrokh (2016) (23) (Iran, 21.90% in milk and 26.25% in meat samples), Mousavi et al. (2014) (24) (Iran, 19.80% in milk samples and 19.20% in dairy products) and Yahaghi et al. (2014) (25) (Iran, 14% in salad and 13.68% in vegetable).
Ghorbani et al. (2016) (26) reported that the prevalence of H. pylori in food items were 20%. They showed that vegetable sandwiches (45%), minced meat (32%), and meat sandwiches (20%) were the most commonly contaminated samples. Our results showed that ovine-based samples had the highest prevalence of H. pylori. This matter has been approved by other researchers (16-18, 23, 24). It may be due to the high ability of sheep stomach to keep H. pylori and its transmission into the environment. We found that milk samples had a higher prevalence of H. pylori than meat and vegetables. The main reason for the high prevalence of H. pylori in milk samples is the fact that milk has appropriate conditions, especially pH and activated water (aw), which support the growth and survival of H. pylori strains. On the other hand, bad conditions of meat and vegetables and maybe presence of antimicrobial agents in these foods make them unsuitable for growth and survival of H. pylori strains. High prevalence of H. pylori in vegetable samples is their close contact with polluted soil, water, and human-and animal-based manure. In addition, vegetables are not washed sufficiently in the shopping center and therefore, polluted materials remain even after washing. In addition, vegetables had so many structural wrinkles, which are considered as a shelter for pathogenic bacteria like H. pylori.
Another part of our study focused on the genotyping of bacterial strains. We found that vacAs1a, m1a, s2 and m2, as well as cagA genotypes had a considerable prevalence in H. pylori strains. Similar findings have been reported previously in milk (16, 23, 24), meat (17, 23, 25), vegetables (25) and ready to eat foods (26). Hemmatinezhad et al. (2016) (27) reported that the prevalence of H. pylori in various types of ready to eat food samples were 13.45%. They showed that olvie salad (36%), restaurant salad (30%), fruit salad (28%), and soup (22%) had the highest prevalence rate. Their findings reported that the most commonly detected combined genotypes were s1am2 (70.27%), s1am1a (39.18%), and m1am2 (31.08%), which was similar to our findings. Yahaghi et al. (2014) (25) revealed that cagA (57.62 %), vacA s1a (37.28 %), and vacAm1a (30.50 %) had the highest prevalence among the H. pylori strains of vegetables. High prevalence of vacA and cagA genotypes among clinical isolates and cases of gastrointestinal disorders have been reported from Iran (28), United States (29), Australia (30), United Kingdom (31), and China (32). Adjacent connotation of cagA and vacA genotypes with production of interleukin 8 (IL-8) and cytotoxins, adhesion to gastric epithelial cells, occurrence of inflammation, vacuolization, necrosis, and apoptosis of epithelial cells has been reported in previously published data (33, 34). High prevalence of these genotypes in milk, vegetables, and meat samples of our investigation showed their high pathogenic nature.

6. Conclusions

Iranian milk, meat, and vegetable samples harbor H. pylori strains with considerable distribution of vacA and cagA genotypes. Considerable incidence of H. pylori proposes that contaminated milk, vegetable, and meat may be the sources of H. pylori and their pathogenic genotypes. Similarity in the genotyping pattern of H. pylori strains of various samples represents their similar sources of infection. Simultaneous presence of these genotypes together in some of our strains showed their high pathogenicity. Regarding the high prevalence rate of pathogenic H. pylori beside the high consumption rate of milk, meat, and vegetables among Iranian people represent an important public health issue, which should be addressed before the vast spread of the H. pylori infection.

Acknowledgments

Footnotes

References

  • 1.
    Kearney J. Food consumption trends and drivers. Philos Trans R Soc Lond B Biol Sci. 2010;365(1554):2793-807. [PubMed ID: 20713385]. https://doi.org/10.1098/rstb.2010.0149.
  • 2.
    Dehkordi FS, Yazdani F, Mozafari J, Valizadeh Y. Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products. BMC Res Notes. 2014;7:217. [PubMed ID: 24708594]. https://doi.org/10.1186/1756-0500-7-217.
  • 3.
    Momtaz H, Safarpoor Dehkordi F, Rahimi E, Ezadi H, Arab R. Incidence of Shiga toxin-producing Escherichia coli serogroups in ruminant's meat. Meat Sci. 2013;95(2):381-8. [PubMed ID: 23747633]. https://doi.org/10.1016/j.meatsci.2013.04.051.
  • 4.
    Atapoor S, Safarpoor Dehkordi F, Rahimi E. Detection of Helicobacter pylori in Various Types of Vegetables and Salads. Jundishapur J Microbiol. 2014;7(5):10013. [PubMed ID: 25147709]. https://doi.org/10.5812/jjm.10013.
  • 5.
    Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev. 1997;10(4):720-41. [PubMed ID: 9336670].
  • 6.
    Goh KL, Chan WK, Shiota S, Yamaoka Y. Epidemiology of Helicobacter pylori infection and public health implications. Helicobacter. 2011;16 Suppl 1:1-9. [PubMed ID: 21896079]. https://doi.org/10.1111/j.1523-5378.2011.00874.x.
  • 7.
    Holubiuk L, Imiela J. Diet and Helicobacter pylori infection. Prz Gastroenterol. 2016;11(3):150-4. [PubMed ID: 27713775]. https://doi.org/10.5114/pg.2016.61487.
  • 8.
    Herrera AG. Helicobacter pylori and food products: a public health problem. Methods Mol Biol. 2004;268:297-301. [PubMed ID: 15156039]. https://doi.org/10.1385/1-59259-766-1:297.
  • 9.
    van Duynhoven YT, de Jonge R. Transmission of Helicobacter pylori: a role for food? Bull World Health Organ. 2001;79(5):455-60. [PubMed ID: 11417041].
  • 10.
    Keenan JI, Salm N, Hampton MB, Wallace AJ. Individual and combined effects of foods on Helicobacter pylori growth. Phytother Res. 2010;24(8):1229-33. [PubMed ID: 20658571]. https://doi.org/10.1002/ptr.3167.
  • 11.
    Proenca-Modena JL, Acrani GO, Brocchi M. Helicobacter pylori: phenotypes, genotypes and virulence genes. Future Microbiol. 2009;4(2):223-40. [PubMed ID: 19257848]. https://doi.org/10.2217/17460913.4.2.223.
  • 12.
    Roesler BM, Rabelo-Goncalves EM, Zeitune JM. Virulence Factors of Helicobacter pylori: A Review. Clin Med Insights Gastroenterol. 2014;7:9-17. [PubMed ID: 24833944]. https://doi.org/10.4137/CGast.S13760.
  • 13.
    Ho SA, Hoyle JA, Lewis FA, Secker AD, Cross D, Mapstone NP, et al. Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals. J Clin Microbiol. 1991;29(11):2543-9. [PubMed ID: 1723072].
  • 14.
    Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(1):30-6. [PubMed ID: 17548220]. https://doi.org/10.1016/j.ijid.2007.03.012.
  • 15.
    Ben Mansour K, Fendri C, Zribi M, Masmoudi A, Labbene M, Fillali A, et al. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Ann Clin Microbiol Antimicrob. 2010;9:10. [PubMed ID: 20302630]. https://doi.org/10.1186/1476-0711-9-10.
  • 16.
    Rahimi E, Kheirabadi EK. Detection of Helicobacter pylori in bovine, buffalo, camel, ovine, and caprine milk in Iran. Foodborne Pathog Dis. 2012;9(5):453-6. [PubMed ID: 22458716]. https://doi.org/10.1089/fpd.2011.1060.
  • 17.
    Gilani A, Razavilar V, Rokni N, Rahimi E. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran. Vet Res Forum. 2017;8(1):75-80. [PubMed ID: 28473901].
  • 18.
    Talaei R, Souod N, Momtaz H, Dabiri H. Milk of livestock as a possible transmission route of Helicobacter pylori infection. Gastroenterol Hepatol Bed Bench. 2015;8(Suppl 1):S30-6. [PubMed ID: 26171135].
  • 19.
    Safaei HG, Rahimi E, Zandi A, Rashidipour A. Helicobacter pylori as a zoonotic infection: the detection of H. pylori antigens in the milk and faeces of cows. J Res Med Sci. 2011;16(2):184-7. [PubMed ID: 22091229].
  • 20.
    Fujimura S, Kawamura T, Kato S, Tateno H, Watanabe A. Detection of Helicobacter pylori in cow's milk. Lett Appl Microbiol. 2002;35(6):504-7. [PubMed ID: 12460433].
  • 21.
    Esmaeiligoudarzi D, Tameshkel FS, Ajdarkosh H, Arsalani M, Sohani MH, Behnod V. Prevalence of helicobacter pylori in Iranian milk and dairy products using culture and ureC based-PCR techniques. Biomed Pharmacol J. 2015;8(1):179-83. https://doi.org/10.13005/bpj/597.
  • 22.
    El-Gohary AH, Yousef MA, Mohamed AA, El-Amaiem WEA, Abdel-Kareem LM. Epidemiological study on H. Pylori in cattle and its milk with special reference to its zoonotic importance. Biol Med. 2015;7(5):1. https://doi.org/10.4172/0974-8369.1000251.
  • 23.
    Saeidi E, Sheikhshahrokh A. vacA Genotype Status of Helicobacter pylori Isolated from Foods with Animal Origin. Biomed Res Int. 2016;2016:8701067. [PubMed ID: 27088092]. https://doi.org/10.1155/2016/8701067.
  • 24.
    Mousavi S, Dehkordi FS, Rahimi E. Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J Venom Anim Toxins Incl Trop Dis. 2014;20:51. [PubMed ID: 25873940]. https://doi.org/10.1186/1678-9199-20-51.
  • 25.
    Yahaghi E, Khamesipour F, Mashayekhi F, Safarpoor Dehkordi F, Sakhaei MH, Masoudimanesh M, et al. Helicobacter pylori in vegetables and salads: genotyping and antimicrobial resistance properties. Biomed Res Int. 2014;2014:757941. [PubMed ID: 25184146]. https://doi.org/10.1155/2014/757941.
  • 26.
    Ghorbani F, Gheisari E, Dehkordi FS. Genotyping of vacA alleles of Helicobacter pylori strains recovered from some iranian food items. Trop J Pharm Res. 2016;15(8):1631-6. https://doi.org/10.4314/tjpr.v15i8.5.
  • 27.
    Hemmatinezhad B, Momtaz H, Rahimi E. VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods. Ann Clin Microbiol Antimicrob. 2016;15:2. [PubMed ID: 26792758]. https://doi.org/10.1186/s12941-015-0115-z.
  • 28.
    Jafari F, Shokrzadeh L, Dabiri H, Baghaei K, Yamaoka Y, Zojaji H, et al. vacA genotypes of Helicobacter pylori in relation to cagA status and clinical outcomes in Iranian populations. Jpn J Infect Dis. 2008;61(4):290-3. [PubMed ID: 18653971].
  • 29.
    Sicinschi LA, Correa P, Bravo LE, Peek RJ, Wilson KT, Loh JT, et al. Non-invasive genotyping of Helicobacter pylori cagA, vacA, and hopQ from asymptomatic children. Helicobacter. 2012;17(2):96-106. [PubMed ID: 22404439]. https://doi.org/10.1111/j.1523-5378.2011.00919.x.
  • 30.
    Lu W, Wise MJ, Tay CY, Windsor HM, Marshall BJ, Peacock C, et al. Comparative analysis of the full genome of Helicobacter pylori isolate Sahul64 identifies genes of high divergence. J Bacteriol. 2014;196(5):1073-83. [PubMed ID: 24375107]. https://doi.org/10.1128/JB.01021-13.
  • 31.
    Memon AA, Hussein NR, Miendje Deyi VY, Burette A, Atherton JC. Vacuolating cytotoxin genotypes are strong markers of gastric cancer and duodenal ulcer-associated Helicobacter pylori strains: a matched case-control study. J Clin Microbiol. 2014;52(8):2984-9. [PubMed ID: 24920772]. https://doi.org/10.1128/JCM.00551-14.
  • 32.
    Wei GC, Chen J, Liu AY, Zhang M, Liu XJ, Liu D, et al. Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes and correlation with clinical outcome. Exp Ther Med. 2012;4(6):1039-44. [PubMed ID: 23226771]. https://doi.org/10.3892/etm.2012.704.
  • 33.
    Siddique I, Al-Qabandi A, Al-Ali J, Alazmi W, Memon A, Mustafa AS, et al. Association between Helicobacter pylori genotypes and severity of chronic gastritis, peptic ulcer disease and gastric mucosal interleukin-8 levels: Evidence from a study in the Middle East. Gut Pathog. 2014;6(1):41. [PubMed ID: 25279005]. https://doi.org/10.1186/s13099-014-0041-1.
  • 34.
    Yamaoka Y, Reddy R, Graham DY. Helicobacter pylori virulence factor genotypes in children in the United States: clues about genotype and outcome relationships. J Clin Microbiol. 2010;48(7):2550-1. [PubMed ID: 20421443]. https://doi.org/10.1128/JCM.00114-10.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.