1. Background
2. Objectives
3. Methods
3.1. Bacterial Strains and Phylogenetic Grouping
| Target Gene | Primer | Primer Sequence (5' - 3') | Product Size, bp | Ta, °C | Reference |
|---|---|---|---|---|---|
| uspA | uspA-F | ccgatacgctgccaatcagt | 884 | 52 | (19) |
| uspA-R | acgcagaccgtaggccagat | ||||
| gadA | gadA-F | gatgaaatggcgttggcgcaag | 373 | 53 | (20) |
| gadA-R | ggcggaagtcccagacgatatcc | ||||
| chuA | chuA-F | atgatcatcgcggcgtgctg | 281 | ||
| chuA-R | aaacgcgctcgcgcctaat | ||||
| yjaA | yjaA-F | tgttcgcgatcttgaaagcaaacgt | 216 | ||
| yjaA-R | acctgtgacaaaccgccctca | ||||
| TspE4.C2 | tspE4.C2-F | gcgggtgagacagaaacgcg | 152 | ||
| tspE4.C2-R | ttgtcgtgagttgcgaacccg | ||||
| acrA | acrA-F | ggtcgttctgatgctctca | 1078 | 52 | (18) |
| acrA-R | ggcttgctggttattatcag | ||||
| acrB | acrB-F | cgtctaacagtgactccacgg | 2730 | 52 | |
| acrB-R | ttcaatcagacctttaccttc | ||||
| tolC | tolC-F | atgcaaatgaagaaa | 100 | 49 | (21) |
| tolC-R | ttaatgacggaacggatt |
Abbreviation: Ta, PCR annealing temperature.
3.2. Antibiotic Susceptibility Test
3.3. Phenotypic Detection of Efflux Pump-Mediated Resistance
3.4. Detection of the Presence of AcrAB-TolC Main Efflux Genes
3.5. Detection of In-Vitro Biofilm Formation and the Phenotypic Detection of Curli Production
3.6. Statistical Analysis
4. Results
4.1. Molecular Identification and Phylogenetic Grouping of UPEC Clinical Isolates
A, Agarose gel of the Polymerase Chain Reaction amplification product of uspA where Lane 1: One Mark 100 DNA Ladder (100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1500 bp, 3000 bp) (GeneDireX, USA) Lane 2, 3: uspA band of the exact size of 884 bp in E. coli ATCC 25922 and a UPEC isolate, respectively; B, Agarose gel of the phylogenetic multiplex Polymerase Chain Reaction amplification products where: Lane 1, 6: Phylogenetic group A showing specific bands of gadA (373 bp) and yjaA (216 bp). Lane 2: Phylogenetic group D showing specific bands of gadA (373 bp) and chuA (281 bp). Lane 3, 5: Phylogenetic group B2 showing specific bands of gadA (373 bp), chuA (281 bp) and yjaA (216 bp) and DNA fragment TspE4.C2 (152 bp). Lane 4: HyperLadder™ 100bp (100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1013bp) (Bioline, UK). Lane 7, 9: Phylogenetic group D showing specific bands of gadA (373 bp), chuA (281 bp) and DNA fragment TspE4.C2 (152 bp). Lane 8: Phylogenetic group B1 of E. coli ATCC 25922 showing specific bands of gadA (373 bp) and DNA fragment TspE4.C2 (152 bp); C, Agarose gel of the Polymerase Chain Reaction amplification product of acrA where: Lane 1: GeneRuler 1 kb DNA Ladder (250 bp, 500 bp, 750 bp, 1000 bp, 1500 bp, 2000 bp, 2500 bp, 3000 bp, 3500 bp, 4000 bp, 5000 bp, 6000 bp, 8000 bp, 10000 bp). Lane 2 - 3: acrA band of the exact size of 1078 bp. D, Agarose gel of the Polymerase Chain Reaction amplification product of acrB where: Lane 1 - 2: acrB band of the exact size of 2730 bp. Lane 3: HyperLadder™ 1 Kb (200 bp, 400 bp, 600 bp, 1000 bp, 1500 bp, 2000 bp, 2500 bp, 3000 bp, 4000 bp, 5000 bp, 6000 bp, 8000 bp,10037bp) (Bioline, UK); E, Agarose gel of the Polymerase Chain Reaction amplification product of tolC where: Lane 1: One Mark 100 DNA Ladder (100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp, 1500 bp, 3000 bp) (GeneDireX, USA). Lane 2 - 3: tolC PCR band of the exact size of 100 bp.
4.2. Antibiotic Susceptibility of UPEC Clinical Isolates
| Antibiotics | B2 | D | A | B1 | Total No of Resistant Isolates |
|---|---|---|---|---|---|
| Amikacin | 14 | 0 | 0 | 1 | 15 |
| Gentamicin | 53 | 17 | 7 | 5 | 82 |
| Imipenem | 27 | 7 | 7 | 5 | 46 |
| Meropenem | 53 | 12 | 8 | 6 | 79 |
| Cefuroxime | 103 | 30 | 16 | 9 | 158 |
| Cefixime | 80 | 27 | 15 | 8 | 130 |
| Cefotaxim | 78 | 22 | 15 | 9 | 124 |
| Ceftazidime | 75 | 24 | 14 | 8 | 121 |
| Co-Trimoxazole | 82 | 23 | 12 | 7 | 124 |
| Ciprofloxacin | 71 | 22 | 7 | 5 | 105 |
| Norfloxacin | 71 | 22 | 7 | 5 | 105 |
| Levofloxacin | 69 | 19 | 9 | 5 | 102 |
| Nalidixic acid | 81 | 23 | 15 | 8 | 127 |
| Nitrofurantoin | 40 | 12 | 8 | 2 | 62 |
| Ampicillin | 104 | 29 | 17 | 10 | 160 |
| Amoxicillin/Clavulanic acid | 94 | 29 | 16 | 9 | 148 |
| Ampicillin/Sulbactam | 83 | 28 | 14 | 8 | 133 |
| Piperacillin/Tazobactam | 57 | 25 | 12 | 4 | 98 |
| Aztreonam | 70 | 21 | 14 | 7 | 112 |
| Tetracycline | 79 | 24 | 13 | 9 | 125 |
4.3. Phenotypic Detection of Efflux Pump-Mediated Resistance
Change in the antibiotic resistance of Uropathogenic Escherichia coli in the presence of an efflux pump inhibitor CPZ where: Ampicillin (AMP), Ampicillin/Sulbactam (A/S), Amoxicillin/Clavulanic acid (AMC), Co-Trimoxazole (COT), Piperacillin/Tazobactam (TZP), Tetracycline (TE), Nalidixic Acid (NA), Norfloxacin (NX), Ciprofloxacin (CIP), Levofloxacin (LE), Ceftazidime (CAZ), Cefotaxime (CTX), Cefuroxime (CXM), Cefixime (CFM), Meropenem (MEM), Imipenem (IMP), Gentamicin (GEN), Aztreonam (ATM), and Nitrofurantoin (NIT)



