Logo
Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

Genomic Characterization and Antimicrobial Resistance of Four Mcr-1 Escherichia coli Strains Isolated from Human and Environment Sources, Hainan Province, Tropical China

Author(s):
Tianjiao LiTianjiao Li1, Yi GaoYi Gao2, Yu ZhangYu Zhang2, Xiaojie PengXiaojie Peng2, Haimei YeHaimei Ye3, Wenfang LongWenfang LongWenfang Long ORCID2, 4,*
1Hainan General Hospital, Hainan Medical University, Haikou, China
2School of Public Health, Hainan Medical University, Haikou, China
3Center for Disease Control and Prevention of Hainan, Haikou, China
4Heinz Mehlhorn Academician Workstation, Hainan Medical University, Haikou, China

Jundishapur Journal of Microbiology:Vol. 17, issue 5; e144735
Published online:Jul 10, 2024
Article type:Research Article
Received:Jan 06, 2024
Accepted:Jun 06, 2024
How to Cite:Tianjiao Li, Yi Gao, Yu Zhang, Xiaojie Peng, Haimei Ye, et al. Genomic Characterization and Antimicrobial Resistance of Four Mcr-1 Escherichia coli Strains Isolated from Human and Environment Sources, Hainan Province, Tropical China.Jundishapur J Microbiol.2024;17(5):e144735.https://doi.org/10.5812/jjm-144735.

Abstract

Background:

The rapid spread of multidrug-resistant Gram-negative bacteria, particularly the increase in carbapenem-resistant strains, has led to a critical level of resistance in clinical settings. Colistin is considered to be the last line of defense against these Gram-negative bacteria.

Objectives:

This study aims to investigate the genetic characteristics and antimicrobial resistance (AMR) patterns of four mcr-1 (mobile colistin resistance) Escherichia coli isolates from various sources in Hainan Province, tropical China, and to determine their genetic relationships with both domestic and global strains.

Methods:

Samples were collected from swimming pools, marine beaches, and beach personnel in Haikou and Sanya, Hainan Province, China. Escherichia coli isolates were obtained, multilocus sequence typing was performed, and the mcr family resistance genes were amplified by polymerase chain reaction. The mobile sequences, AMR genes, phenotypes, and virulence genotypes of the mcr-1 strains were analyzed. Phylogenetic analyses were conducted to investigate the relationships between the mcr-1E. coli strains and those in the NCBI database.

Results:

In the current study, the mcr-1 resistance gene was detected in 4 strains, accounting for 2.94% (4/136) of the total. The 4 strains of E. coli were isolated from a freshwater swimming pool, a pool wall, seawater, and a human body. Among the four strains, the minimum inhibitory concentration of polymyxin was 8 mg/L, except for one strain, which showed low-level resistance at 4 mg/L. All four strains showed complete resistance to ampicillin, three were resistant to compound sulfamethoxazole and chloramphenicol, and all strains were sensitive to other common antibiotics. The virulence genes cfaA, cfaB, cfaC, and cfaD/cfaE were detected in all E. coli strains. The insertable sequence IS3 was the most widely distributed type. Three isolates were identified as ST987, whereas the isolate from marine sources was identified as ST24. Comparison of the core genes of the strains indicated that the four strains were closely related to the Chrysomya sp. from Northern Thailand.

Conclusions:

The four mcr-1 genes can mediate low to medium levels of colistin resistance, facilitating their dissemination within the population and the environment. It is crucial to trace the source of multidrug-resistant bacteria in recreational water, which is in direct contact with humans, and to reduce the risks to human health through effective supervision.

1. Background

Antimicrobial resistance (AMR) has emerged as a global health concern, with both clinical and public environments acting as hotspots for the spread of antibiotic resistance. Water environments, in particular, are significant reservoirs for antibiotic-resistant bacteria and genes. Due to public gatherings, recreational freshwater and marine beaches face a wider range of potential health risks (1). In recent years, the rapid spread of multidrug-resistant Gram-negative bacteria, especially the increase in carbapenem-resistant Gram-negative bacteria, has led to critical levels of multidrug resistance in clinical settings. Colistin has been re-applied clinically and is considered the last line of defense against Gram-negative bacteria (2).

Researchers have found an increasing number of Gram-negative bacteria resistant to colistin in domesticated animals, the environment, and even humans (3). In 2015, a colistin resistance gene mediated by a horizontal transfer plasmid was discovered in porcine Escherichia coli plasmids (4, 5), which rapidly spread across more than 50 countries and regions worldwide (6). The epidemiological safety of recreational water has become a concern. Currently, there are few studies on the epidemic characteristics of antibiotic resistance based on the "One Health" approach in different media. From January to December 2019, our team conducted sampling at two bathing beaches, more than 30 swimming pools, and beaches in Hainan Province, as well as among practitioners.

2. Objectives

We aimed to determine the spatial distribution, genetic characteristics, and transmission of colistin-resistant bacteria in recreational freshwater and coastal beaches. In this study, after selecting strains, the antibiotic resistance and virulence characteristics of E. coli carrying the mcr-1 resistance gene were further studied through whole-genome resequencing. Multilocus sequence typing (MLST) and next-generation sequencing (NGS) data analysis were conducted with E. coli carrying the mcr-1 gene from China. The relationship of these strains to others from Asia, Europe, and the Americas was compared to construct a maximum likelihood evolutionary tree.

3. Methods

3.1. Source of Strains and Rationality

A total of 136 E. coli isolates were collected from swimming pool water and pool walls, seawater and sand samples, and anal swabs from beach staff with informed consent. The human strains used in this study underwent ethical review by the affiliated Hainan Hospital, Hainan Medical University (2019075), and informed consent was obtained from all subjects involved. IBM SPSS 22.0 was used for statistical analysis.

3.2. Isolation, Culture and Identification of Single Strains

Processing of water samples: Samples were randomly collected. 10 mL of water samples were loaded into aseptic centrifuge tubes, stored in refrigerated containers, and processed within 4 hours. The tubes were centrifuged at 3000 rpm for 5 minutes, and 200 μL of the precipitate was saved on MacConkey Agar (MAC). The precipitate was then transferred to each MAC plate and evenly spread using an inoculation ring. A sterile cotton swab was used to wipe a 5 cm × 5 cm area of the wet swimming pool wall. Following aseptic procedures, 10 mL of distilled water was added, shaken for 1 minute to mix, and left for 1 hour before being inoculated using the aforementioned water sample processing method. Human anal swab samples were collected from the staff of the two bathing beaches and inoculated on MAC plates. All inoculated MAC plates were placed in a 35°C incubator for 48 hours, with colony growth observed every 24 hours. Suspicious pink colonies were selected for MALDI-TOF MS identification and subculture, and then stored at -80°C.

3.3. Materials and Equipment

Mass spectrometer VITEK MS (France Biomerieux), polymyxin B drug sensitivity reagent (Kangtai Bio), Vitek2 automatic bacterial identification instrument (France Biomerieux), MacConkey medium (China Guangdong Huankai), serologic diagnostic serum for E. coli O157:H7 (Ningbo Tianrun, China), Tanon™ nucleic acid dye (China Shanghai Tianneng), 2 × Taq PCR master mix (Beijing Tiangen, China), Gradient PCR instrument (Eppendorf, Germany), automatic digital gel image analysis system (Tanon-4100, Tianneng, China), constant temperature shaking table (Shanghai Zhichu Instrument Co., Ltd.), and prokaryotic genome NGS sequencing were sent to Megi Biological Company.

3.4. 16S Sanger Sequencing Identification, Antibiotic Resistance and Virulence Experiment

The 16S Sanger identification method was used to identify the strains carrying mcr-1. The colistin (PB) sensitivity test was performed using the microbroth dilution method, with ATCC25922 as the quality control strain. The minimum inhibitory concentration (MIC) value interpretation standard was determined by referencing the critical values of sensitivity (S ≤ 2 mg/L) and resistance (R > 2 mg/L) set by the European Committee for Antimicrobial Susceptibility Testing (EUCAST) in 2020 (7). For other antibiotic susceptibility tests, the Vitek2 Compact automatic bacterial identification instrument from Biomerieux and the N334 card were used, with MIC values determined according to the American Clinical and Laboratory Standards Institute (CLSI) guidelines in 2019 (8). The quality control strains used were E. coli ATCC25922 and Pseudomonas aeruginosa ATCC27853.

For the O157:H7 serum slide agglutination test, one drop of O157:H7 serum was added to a clean slide. A small amount of the tested bacteria was then mixed with the serum, and the slide was gently shaken. The result was visually assessed within 1 minute, using physiological sodium chloride solution as a negative control. The results were interpreted as follows: Obvious agglutination within 1 minute was considered positive, while uniform turbidity was considered negative.

3.5. Extraction of Bacterial DNA

DNA extraction was performed according to the kit instructions. The supernatant of 70 - 80 μL was transferred to a new EP tube to obtain the DNA, and the optical density (OD) value was measured. The OD260/280 ratio ranged from 1.8 to 2.1.

3.6. PCR Amplification and Sequencing

The primers for the mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5 genes were synthesized by Shanghai Bioengineering Company (9). The reaction conditions were as follows: Pre-denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 5 min. After amplification, the product was subjected to electrophoresis on a 1.5% agarose gel at 120V for 40 minutes. The amplified product was then sent to Shanghai Shenggong Bioengineering Company for sequencing. Strains were identified using 16S Sanger sequencing with primer sequences 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The target genes, specifically the virulence genes stx and rfbE, were amplified using PCR (10).

3.7. Prokaryotic Genome Next-Generation Sequencing (NGS) Sequencing

The four strains were sent to Megi Bio-Company for genome NGS sequencing. SPAdes nucleic acid splicing software was used to assemble the FASTQ sequencing files that passed quality testing through the denovo non-reference genome assembly mode. The gene assembly quality report was generated using Quast software. The genome sketch was assembled using the reference strain K12_MG1655 (4641652 bps) genome. Based on the assembled genome sketch and scaffolds, drug resistance genes and virulence genes were identified using the CARD and VFD databases.

3.8. Mobile Components Analysis

The prediction software for insertable sequences was ISEScan_v1.7.2.1. The detection software for integrons and clustered regularly interspaced short palindromic repeats (CRISPR) were Integron_Finder_v2.0 and CRISPR Finder, respectively. Mobile elements were used to analyze foreign genomic fragments in the genome.

3.9. Multilocus Sequence Typing (MLST) Genotype

Multilocus sequence typing was performed using the Institute Pasteur typing method (11), amplifying and sequencing eight steward genes synthesized by BGI Genomics Co., Ltd: dinB, icdA, pabB, polB, putP, trpA, trpB, and uidA (Appendix 1). The resultant gene sequences for each strain were compared with the reference sequences stored on the Institute Pasteur website. Eight allele genes were obtained through this comparison, which were used to determine the sequence type (ST) of the strain.

3.10. Comparative Analysis of Pangenomic Isolates with Characteristic Genes

The NGS data of 80 E. coli strains were selected from the National Center for Biotechnology Information (NCBI) in January 2020. The mcr-1 gene of E. coli was used with the GenBank DNA sequence MG763104.1d serving as a reference. Comparative analysis was conducted using the basic local alignment search tool (BLAST). Gene annotation was performed using Prokka software. Pan-genomic analysis of protein sequences was conducted using bacteria pan genome analysis (BPGA) software, which identified the core genes, auxiliary genes, unique genes, and deletion genes of all strains (12). The phylogenetic tree of core genes was constructed based on these core genes, and an additional phylogenetic tree was constructed using all identified genes.

4. Results

A total of 136 E. coli strains were screened in this study, among which 4 mcr-1 target strains showed bands at 320 bp during PCR detection (Figure 1), accounting for 2.94% (4/136). The positive rates of mcr-1 strains from the swimming pool, bathing seawater, and anal swab samples were 2/40, 1/28, and 1/68, respectively. The statistical difference between the different sources was not significant (χ2 = 1.148, P>0.05). The corresponding strain codes were A93, A135, AD66, and ADPW66. No other mcr family genes were found.

Multiplex PCR for detection of <i>mcr-1</i> gene of Four strains <i>Escherichia coli</i> (M, marker; B, blank; N, negative control), 1,2,3,4 was 135A,93, AD66 and ADPW66 respectively.
Figure 1.

Multiplex PCR for detection of mcr-1 gene of Four strains Escherichia coli (M, marker; B, blank; N, negative control), 1,2,3,4 was 135A,93, AD66 and ADPW66 respectively.

4.1. Identification and Drug-Resistant Phenotypes of Escherichia coli

The sequencing results of 16S rRNA genes were compared with the MW082015.1 sequence in GenBank using BLAST, and the results showed 100% homology. Four target strains carrying the mcr-1 resistance gene were re-checked by 16S rRNA sequencing. The sequence showed 100% homology with the GenBank number CP100005.1, and the strains were identified as E. coli. The drug susceptibility test results were obtained using the microbroth dilution method combined with the Vitek2 Compact automatic bacterial identification instrument from France Biomerieux and the matching N334 card (Table 1).

Table 1.The Antibiotic Resistance Phenotype for 4 Isolates
Antibiotics(mg/L)NO. of Strain/Source of Strain
Sea WaterHumanSwimming Pool WellSwimming Water
No. 93135AADPW66AD66
LEV1111
SXT≥ 8/152≥ 8/152≥ 8/152≤ 0.5/9.5
TGC≤ 4≤ 4≤ 4≤ 4
AMP≥ 32≥ 32≥ 32≥ 32
AMK≤ 4≤ 4≤ 4≤ 4
GEN≤ 1≤ 1≤ 1≤ 1
CHL≤ 8≥ 32≥ 32≥ 32
IPM≤ 1≤ 1≤ 1≤ 1
AMS= 16/8≤ 2/1≤ 2/1≤ 2/1
TZP≤ 4/4≤ 4/4≤ 4/4≤ 4/4
CTX≤ 4≤ 4≤ 4≤ 4
CAZ≤ 4≤ 4≤ 4≤ 4
FEP≤ 2≤ 2≤ 2≤ 2
CXM≤ 8≤ 8≤ 8≤ 8
PB4888

The Antibiotic Resistance Phenotype for 4 Isolates

4.2. Results of Prokaryotic Genome Next-Generation Sequencing (NGS) Sequencing

SPAdes nucleic acid splicing software was used to splice FASTQ sequencing files that met the quality detection criteria for 4 strains of E. coli with the mcr-1 resistance gene through de novo non-reference genome assembly mode. The draft genome was assembled using the reference K12_MG1655 (4641652 bps) genome (Figure 2).

Plot of the draft genome of the genome for four <i>Escherichia coli</i> strains carrying <i>mcr-1</i>. Note: The reference strain K12_MG1655 (black) Scale is shown in the innermost circle. The second circle shows the G + C content (deviation from the mean), and the third circle shows the G + C skew (green, +; Purple, -). The fourth, fifth, sixth, and seventh circles indicate that the genomes numbered ADPW66 (red), 93 (green), 135A (blue), and AD66 (purple) are compared with the genomes of the reference strain K12MG1655.2.3 mobile components and resistance gene analysis.
Figure 2.

Plot of the draft genome of the genome for four Escherichia coli strains carrying mcr-1. Note: The reference strain K12_MG1655 (black) Scale is shown in the innermost circle. The second circle shows the G + C content (deviation from the mean), and the third circle shows the G + C skew (green, +; Purple, -). The fourth, fifth, sixth, and seventh circles indicate that the genomes numbered ADPW66 (red), 93 (green), 135A (blue), and AD66 (purple) are compared with the genomes of the reference strain K12MG1655.2.3 mobile components and resistance gene analysis.

4.2.1. Mobile Elements of 4 Strains Carrying Mcr Gene

As shown in Table 2, the insertable sequence IS3 was the most widely distributed type. ISKpn26 and ISEhe3 were more prevalent in A135 and ADPW66. Strain A93, isolated from the marine beach, had the highest number of unknown insertion sequences, with five detected. Additionally, the strain from a human source exhibited the highest number of antibiotic resistance genes (ARGs).

Mobile elements in the longest Scaffold52 for the isolate from marine water were identified. The human-sourced strain 135A has two categories of integrons. The longest integron is located in Scaffold52, which is 5425 bp in length and carries 6 ARGs (Figure 3). Strain 135A has unique ARGs including dfrA12, aadA2, sul3, and qacH. While mcr4.4 and mcr5.2 were identified in the further search for mcr family resistance genes, their identity was only below 40%. The following prevalent transmissible ARGs were identified: Mcr-1, QnrS1, tet(A), TEM-176, and CmlA1/floR. The CRISPR types of the four strains were classified as CRISPR1 and CRISPR2, but the number of different types varied. The A93 strain, isolated from the beach, exhibited a limited presence of CRISPR elements, as shown in Table 2.

Mobile elements in the longest scafford52 for the isolate from marine water
Figure 3.

Mobile elements in the longest scafford52 for the isolate from marine water

Table 2.Mobile Elements for 4 Isolates Carrying Mcr Gene
Strains NameIS NameIS FamilyLength (bp)CRISPR No.
135AISEc1ISAs1168418
IS30DIS301230
ISKpn26IS51197
AD66ISEhe3IS378315
IS2IS31071
-IS9185217
ADPW66ISCro3IS41033
ISKpn26IS51197
A93-ISNCY115313
-IS51144
ISCro3IS41033
ISEhe3IS3783
IS2IS31071

Mobile Elements for 4 Isolates Carrying Mcr Gene

4.3. Genotyping Results

Two typing methods were performed for bacterial genomic characterization, comparing the results with those in the database. Multilocus sequence typing utilized allelic and genotypic information from over 100 species or genus-level bacteria available in the PubMLST database (https://pubmlst.org/ ,MLST2.0). The housekeeping genes dinB, icdA, pabB, polB, putP, trpA, trpB, and uidA8 were selected from the database. The ST type of three strains (135, AD66, ADPW66) was most similar to ST987, while strain No. 93 was most similar to ST24, with the allele profile shown in Table 3. The electrophoretogram of the eight housekeeping genes is shown in Appendix 2. All gene bands were between 400 - 700 bp, and the sequencing results were identical to the BLAST results.

Table 3.The Number of Allelic Genes by Multilocus Sequence Typing
SampledinBicdApabBpolBputPtrpAtrpBuidAST
93732182582224
135A1023318142987
AD661023318142987
ADPW661023318142987

The Number of Allelic Genes by Multilocus Sequence Typing

4.4. Virulence Gene Analysis

The virulence analysis showed that all the E. coli isolates carried the ibeC virulence gene, which belongs to E. coli O157:H7 (EHEC serotype). However, the O157 and H7 specific gene Stx was not found, and the O157 serologic agglutination test was negative. The cfaA, cfaB, cfaC, and cfaD/cfaE genes were found in all strains, which are associated with E. coli O78:H11:K80 H10407 (ETEC serotype). The virulence genes fimB, fimC, fimD, and fimE were also found in all the E. coli strains. According to the five types of E. coli causing diarrhea, the target gene (as per the Standard of GB 4789.6 2016, China) was identified. The virulence gene uidA was detected in all cases, but other associated genes were not positive.

4.5. Four Target Strains of Homology Analysis

Four E. coli isolates carrying mcr-1 were compared and analyzed using pangenomic analysis. Next-generation sequencing data of E. coli from 2016 to 2019 were selected from the NCBI website, and BLAST was performed. A total of 80 other mcr-1 positive E. coli strains were obtained. The data were selected from representative regions worldwide, including the United States, Australia, Japan, Vietnam, France, and Thailand. Bacteria pan genome analysis software was used to analyze the protein sequences, obtaining the core genes, auxiliary genes, unique genes, and deletion genes of all strains. The phylogenetic tree of core genes was drawn.

In Figure 4, the closest genetic relative observed was Chrysomya sp. from Phitsanulok, Thailand. The second closest strains were obtained from chicken cloaca swabs in Shandong Province, China, but it lies outside the main branches. The two most closely related isolates were sourced from an anal swab and a swimming pool wall.

Phylogenetic analysis of core genes in target strains versus domestic and global <i>mcr-1</i><i>E. coli</i> isolate
Figure 4.

Phylogenetic analysis of core genes in target strains versus domestic and global mcr-1E. coli isolate

5. Discussion

The prevalence of drug-resistant strains can be transmitted through cloning in environments, animals, and humans. In turn, ARGs can cause local outbreaks or widespread dissemination of resistant bacteria through transformation, conjugation, and transduction (13, 14). Four colistin-resistant E. coli strains carrying the mcr-1 gene were isolated from artificial swimming pools, beaches, and related personnel in two important cities located in the south and north of Hainan Province. This finding suggests that mcr-1E. coli strains exist in close living environments of humans. The qnrS gene of these four strains did not show the phenotype of resistance to quinolones. Insertable sequences belonging to the IS5 and IS3 families were prevalent in the four strains, and human and freshwater strains also contained ISKpn26, which has been reported in selected Klebsiella pneumoniae strains (15, 16). The ST987 E. coli type harboring mcr-1 was found scattered in human feces, swimming water, and on the pool wall, revealing a widespread epidemic in tropical Hainan. The seawater isolate A93 showed a low level of resistance to colistin, while the other three target strains showed a moderate level of resistance to colistin.

The results of the prokaryotic genome sequencing were compared with the phylogenetic tree of the core genes of the mcr-1 positive E. coli isolates from China and abroad, indicating a close relationship between the mcr-1 carrying isolate from Chrysomya sp. in Thailand. This suggests that the transmission route involving travelers could not be excluded. Additionally, the mcr-1 positive strain also carried various ARGs, which led to its resistance to ampicillin, cotrimoxazole, and chloramphenicol. Phylogenetic analysis of the genome can be used to understand the transmission mode of pathogens or antibiotic-resistant bacteria. The use of public databases helps to trace the most likely source of transmission. Common methods for constructing phylogenetic trees include constructing them based on the core genome, pan-genome, single nucleotide polymorphism, gene copy number, and non-coding conserved genes. With the application of NGS technology, the core genome is usually combined with specific sequence characteristics and offers certain advantages (17).

5.1. Conclusions

Currently, the increasing prevalence of the mcr family genes is raising concerns due to its potential risks to global health. Particular attention should be paid to genes with strong migration abilities, such as mcr-9, and the changes in drug resistance (18). Enhancing the monitoring of bacteria in recreational freshwater and coastal environments is crucial for preventing the spread of antibiotic microbial resistance in tropical tourist areas. It is necessary to trace the sources of multi-environmental antibiotic-resistant bacteria in recreational bathing pools and beaches, which are in close contact with humans.

Footnotes

References

  • 1.
    De la Cruz Barron M, Merlin C, Guilloteau H, Montarges-Pelletier E, Bellanger X. Suspended materials in river waters differentially enrich class 1 integron- and incP-1 plasmid-carrying bacteria in sediments. Front Microbiol. 2018;9:1443. [PubMed ID: 30013540]. [PubMed Central ID: PMC6036612]. https://doi.org/10.3389/fmicb.2018.01443.
  • 2.
    Yang Q, Ma X, Hu F, Zhang J, Sun T, Chen B, et al. Expert consensus on polymyxin antimicrobial susceptibility testingand clinical interpretation. Med J Peking Union Med Coll Hosp. 2020;11(5):559-70.
  • 3.
    Nang SC, Li J, Velkov T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit Rev Microbiol. 2019;45(2):131-61. [PubMed ID: 31122100]. [PubMed Central ID: PMC6625916]. https://doi.org/10.1080/1040841X.2018.1492902.
  • 4.
    Mei C, Ma Q, Wang Y, Zhou Y, Li Y, Shen P, et al. Characterization of an mcr-1-positive multidrug-resistant Escherichia coli isolate from a supermarket vegetable. Chin J Zoonoses. 2021;37(7).
  • 5.
    Liu Y, Wang Y, Walsh TR, Yi L, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infec Dis. 2016;16(2):161-8.
  • 6.
    Shen Y, Zhou H, Xu J, Wang Y, Zhang Q, Walsh TR, et al. Anthropogenic and environmental factors associated with high incidence of mcr-1 carriage in humans across China. Nat Microbiol. 2018;3(9):1054-62. [PubMed ID: 30038311]. [PubMed Central ID: PMC6198934]. https://doi.org/10.1038/s41564-018-0205-8.
  • 7.
    The European Committee on Antimicrobial Susceptibility Testing. Breaakpoint tables for interpretation of MICs and zone diameters. Sweden: The European Committee on Antimicrobial Susceptibility Testing; 2020, [cited 2023]. Available from: https://www.eucast.org/.
  • 8.
    Clinical and Laboratory Standards Institute. Performance stndards for antimicrobial susceptibility testing. Pennsylvania, United States: Clinical and Laboratory Standards Institute; 2022, [cited 2023]. Available from: https://clsi.org/media/pjfbviql/m100ed34e_sample.pdf.
  • 9.
    Rebelo AR, Bortolaia V, Kjeldgaard JS, Pedersen SK, Leekitcharoenphon P, Hansen IM, et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 2018;23(6). [PubMed ID: 29439754]. [PubMed Central ID: PMC5824125]. https://doi.org/10.2807/1560-7917.ES.2018.23.6.17-00672.
  • 10.
    Rani A, Ravindran VB, Surapaneni A, Shahsavari E, Haleyur N, Mantri N, et al. Evaluation and comparison of recombinase polymerase amplification coupled with lateral-flow bioassay for Escherichia coli O157:H7 detection using diifeerent genes. Sci Rep. 2021;11(1):1881. [PubMed ID: 33479307]. [PubMed Central ID: PMC7820579]. https://doi.org/10.1038/s41598-021-81312-6.
  • 11.
    Clermont O, Gordon D, Denamur E. Guide to the various phylogenetic classification schemes for Escherichia coli and the correspondence among schemes. Microbiol(Reading). 2015;161(Pt 5):980-8. [PubMed ID: 25714816]. https://doi.org/10.1099/mic.0.000063.
  • 12.
    Chaudhari NM, Gupta VK, Dutta C. BPGA- an ultra-fast pan-genome analysis pipeline. Sci Rep. 2016;6:24373. [PubMed ID: 27071527]. [PubMed Central ID: PMC4829868]. https://doi.org/10.1038/srep24373.
  • 13.
    McGann P, Snesrud E, Maybank R, Corey B, Ong AC, Clifford R, et al. Erratum for McGann et al., Escherichia coli Harboring mcr-1 and blaCTX-M on a Novel IncF Plasmid: First Report of mcr-1 in the United States. Antimicrob Agents Chemother. 2016;60(8):5107. [PubMed ID: 27451440]. [PubMed Central ID: PMC4958159]. https://doi.org/10.1128/AAC.01353-16.
  • 14.
    Long W, Li T, Yi G, Liang F, Hu G, Wu J, et al. Prevalence, phenotype and genotype characteristics of antibiotic resistance in coastal beach practitioners of tropical China. One Health Bulletin. 2022;2(1):2. https://doi.org/10.4103/2773-0344.343630.
  • 15.
    Matamoros S, van Hattem JM, Arcilla MS, Willemse N, Melles DC, Penders J, et al. Global phylogenetic analysis of Escherichia coli and plasmids carrying the mcr-1 gene indicates bacterial diversity but plasmid restriction. Sci Rep. 2017;7(1):15364. [PubMed ID: 29127343]. [PubMed Central ID: PMC5681592]. https://doi.org/10.1038/s41598-017-15539-7.
  • 16.
    Fordham SME, Mantzouratou A, Sheridan E. Prevalence of insertion sequence elements in plasmids relating to mgrB gene disruption causing colistin resistance in Klebsiella pneumoniae. Microbiol. 2022;11(1). e1262. [PubMed ID: 35212479]. [PubMed Central ID: PMC8796155]. https://doi.org/10.1002/mbo3.1262.
  • 17.
    Gaba S, Kumari A, Medema M, Kaushik R. Pan-genome analysis and ancestral state reconstruction of class halobacteria: probability of a new super-order. Sci Rep. 2020;10(1):21205. [PubMed ID: 33273480]. [PubMed Central ID: PMC7713125]. https://doi.org/10.1038/s41598-020-77723-6.
  • 18.
    Long W, Li M, Gao Y, Zhang Y, Yuan X, Ye H, et al. Microbial community, pathogenic bacteria and high-risk anti-biotic resistance genes at two tropical coastal beaches adjacent to villages in Hainan, China. Ann Agric Environ Med. 2023;30(4):645-53. [PubMed ID: 38153067]. https://doi.org/10.26444/aaem/176090.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles