Jundishapur J Microbiol

Image Credit:Jundishapur J Microbiol

An Evaluation of Extended-Spectrum and CMY-2-Type Ampc Β-Lactamase-Producing Uropathogenic Escherichia coli Isolates in a Tertiary Care Hospital in Babylon Province, Iraq

Author(s):
Mourouge Saadi AlwashMourouge Saadi Alwash1,*, Fatima Abbas Nasser HusseinFatima Abbas Nasser Hussein1
1Department of Biology, College of Science, University of Babylon, Hillah, Iraq

Jundishapur Journal of Microbiology:Vol. 18, issue 8; e159751
Published online:Aug 18, 2025
Article type:Research Article
Received:Jan 20, 2025
Accepted:Aug 07, 2025
How to Cite:Saadi Alwash M, Abbas Nasser Hussein F. An Evaluation of Extended-Spectrum and CMY-2-Type Ampc Β-Lactamase-Producing Uropathogenic Escherichia coli Isolates in a Tertiary Care Hospital in Babylon Province, Iraq. Jundishapur J Microbiol. 2025;18(8):e159751. doi: https://doi.org/10.5812/jjm-159751

Abstract

Background:

Urinary tract infections (UTIs) have become a serious epidemiological threat due to the emergence of β-lactamase-producing Escherichia coli isolates, which complicate the treatment and control of severe infections.

Objectives:

This study aimed to investigate the prevalence of extended-spectrum β-lactamases (ESBLs) and CMY-2-type plasmid-mediated AmpC β-lactamase (pAmpC) AmpC β-lactamase-producing uropathogenic Escherichia coli (pUPEC) isolates, and to identify the predominant phylogenetic group among these isolates.

Methods:

In this cross-sectional study, 150 uropathogenic Escherichia coli (UPEC) isolates with reduced susceptibility to third-generation cephalosporins (3GCs) and cephamycin were collected from a tertiary care hospital in Babylon province, Iraq, between November 2022 and March 2023. One hundred isolates exhibiting ESBL and/or AmpC phenotypes were selected for molecular analysis.

Results:

Genotypic characterization of ESBL and CMY-2-type AmpC β-lactamase-encoding genes revealed that 92% of the isolates carried β-lactamase genes. Among them, CTX-M was the most common genotype (76%), with CTX-M-15 being the most prevalent variant, followed by TEM (75%), SHV (73%), and CMY-2 (60%). Phylogenetic analysis showed that the extraintestinal group B2 (91.3%) was the most prevalent among the isolates, followed by group D (6.5%), which is also associated with extraintestinal infections.

Conclusions:

The high prevalence of ESBL/CMY-2-type pUPEC isolates associated with virulent extraintestinal infections underscores the urgent need for ongoing surveillance and the implementation of appropriate guidelines in public healthcare settings. To our knowledge, this study is the first to report the presence of CMY-2-type AmpC β-lactamase-producing pUPEC isolates in Iraq.

1. Background

Escherichia coli, a member of the Enterobacteriaceae family, is one of the main causative agents of various infections in humans (1). Although E. coli is a normal component of the commensal human gut microbiota, several variants have evolved specialized pathogenic mechanisms that enable them to cause disease, either in the intestinal tract (diarrheagenic E. coli) or at extraintestinal sites (2, 3). Uropathogenic Escherichia coli (UPEC) is a subtype of extraintestinal pathogenic Escherichia coli (ExPEC) that originates from the commensal intestinal flora, colonizes the urinary tract, and causes urinary tract infections (UTIs) through a variety of virulence mechanisms (4-6).
β-lactam antibiotics are widely used to treat infections caused by E. coli (7-9). However, one of the main mechanisms of resistance to β-lactams is the production of β-lactamase enzymes, which hydrolyze the β-lactam ring, thereby inactivating the antibiotic (10). The most common β-lactamase enzymes include extended-spectrum β-lactamases (ESBLs) such as CTX-M, TEM, and SHV, which belong to Ambler class A, and plasmid-mediated AmpC β-lactamases (pAmpCs) such as CMY, DHA, and ACT, which belong to Ambler class C (11, 12). Among these, the CMY-type, particularly the CMY-2 variant, is the most prevalent pAmpC β-lactamase reported globally in Enterobacteriaceae, including E. coli (13-19).
The spread of ESBL and pAmpC β-lactamase-producing strains is largely due to the horizontal transfer of mobile genetic elements between pathogenic and non-pathogenic bacteria (20). Extended-spectrum β-lactamase-producing strains are resistant to third-generation cephalosporins (3GCs), such as ceftazidime and ceftriaxone (21, 22). In contrast, AmpC β-lactamases confer high-level resistance to 3GCs and cephamycins (e.g., cefoxitin and cefotetan), and are not inhibited by traditional β-lactamase inhibitors, thus limiting therapeutic options (23). To date, local studies in Iraq have largely ignored the prevalence of E. coli strains producing ESBL and CMY-2-type AmpC β-lactamases. Most recent reports have focused primarily on ESBL-producing E. coli isolates (24-26).

2. Objectives

This study aims to characterize the phenotypic and molecular features of ESBL-/CMY-2-type producing uropathogenic E. coli (pUPEC) isolates and to assign them to phylogenetic groups.

3. Methods

3.1. Isolation and Identification of Uropathogenic Escherichia coli Isolates

A cross-sectional study was conducted between November 2022 and March 2023 at the tertiary care unit of Al-Hillah Teaching Hospital in Al-Hillah, Babylon province, Iraq. A total of 150 non-duplicate E. coli isolates were recovered from both male and female inpatients diagnosed with UTIs (bacterial count ≥ 105 CFU/mL and white blood cell count ≥ 104 leukocytes/mL of urine). Escherichia coli isolates were detected by colony morphology on eosin methylene blue and MacConkey agar (HiMedia, India) after incubation at 37°C. The isolates were further confirmed as presumptive E. coli via VITEK® 2 Compact (bioMerieux, France) and biochemical tests (e.g., catalase, oxidase, methyl red/Voges-Proskauer, citrate and urease, triple sugar iron agar, and sulfide indole motility). The E. coli isolates were stored in brain heart infusion broth (HiMedia, India) with 30% glycerol at -20°C for further analysis (27).

3.2. Phenotypic Detection of Extended-Spectrum β-Lactamase and AmpC Production

Antibiotic susceptibility to cephalosporins, including ceftazidime (30 μg, 3GC), cefotaxime (30 μg, 3GC), and cefoxitin (30 μg, cephamycin) (Biomaxima, Poland), was detected via the disk diffusion method in accordance with the CLSI (28). All 3GC-resistant isolates were investigated for ESBL production via the combination disk test (CDT). Cefotaxime and ceftazidime (30 µg) disks, with and without clavulanic acid (10 µg) (Biomaxima, Poland), were used. Compared with antibiotics alone, UPEC isolates with ≥ 5 mm in diameter in the inhibition zones in the presence of cefotaxime/clavulanic acid and ceftazidime/clavulanic acid were considered indicative of ESBL-pUPEC isolates. A CDT, as described by Peter-Getzlaff et al. (29), was performed on all UPEC isolates presumed to be AmpC producers. In this test, a cefoxitin disk (30 µg) alone or in combination with cloxacillin (230 μg) (Biomaxima, Poland) was used. An increase of ≥ 4 mm in the inhibition zones of the cefoxitin/cloxacillin and cefoxitin disks was considered positive for AmpC production.

3.3. DNA Extraction and Detection of the Extended-Spectrum β-Lactamase and AmpC Genes

Total genomic DNA was extracted using the FavorPrep Genomic DNA Mini Kit (Favorgen, Taiwan) following the manufacturer's instructions. The DNA was used as a template for polymerase chain reaction (PCR) analysis. Uniplex-PCR was subsequently performed using previously described primers for blaCTX-M, blaSHV, blaTEM, and blaCMY-2 (Table 1) (30, 31). The total reaction mixture (20 μL) consisted of 8 μL of master mix, 7.5 μL of MgCl2, 0.5 μL of DNase/RNase-free sterile water, 2 μL of DNA template (50 ng), and 1 μL of each primer (Cyntol, Russia).
Table 1.Sequences of Primers Used for This Study
Gene; PrimerSequence (5′-3′)PCR ConditionsAmplicon Size (bp)Reference
blaCTX-M95°C, 1 min; 50°C, 1.5 min; 72°C, 1.5 min599(31)
CTX-FACAGCAGATAATTCGCAA
CTX-RAACCAGATCACCGCGATA
blaTEM95°C, 1 min; 60°C, 1.5 min; 72°C, 1.5 min500(31)
TEM-FTCAACAGCGGTAAGATCCTTGA
TEM-RTGCAACTTTATCCGCCTCCA
blaSHV95°C, 1 min; 60°C, 1.5 min; 72°C, 1.5 min481(31)
SHV-FAAATGGATCTGGCCAGCG
SHV-RAGCAGCTGCCGTTGCGAA
blaCMY95°C, 1 min; 55°C, 1.5 min; 72°C, 1.5 min1226(30)
CMY-FAACACACTGATTGCGTCTGAC
CMY-RCTGGGCCTCATCGTCAGTTA

Abbreviation: PCR, polymerase chain reaction.

3.4. Phylogenetic Group Analysis

The phylogenetic group of each UPEC isolate was detected according to the method described by Clermont et al. (32) using triplex PCR of the genes chuA and yjaA and the DNA fragment TSPE4.C2.

3.5. Sequencing

The amplified targets were sequenced via an automatic sequencer (Bioneer Corporation, South Korea). Nucleotide sequence alignment and analyses were performed online via the Basic Local Alignment Search Tool (BLASTn) program, which is available through the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST).

4. Results

4.1. Isolation and Identification of Extended-Spectrum β-Lactamase-/AmpC-Producing Uropathogenic Escherichia coli Isolates

In this study, a total of 150 non-duplicate UPEC isolates were purified and identified using standard bacteriological methods. The CDTs for phenotypic detection of ESBL and AmpC production revealed that 134 isolates (89.3%) exhibited an ESBL phenotype, 103 isolates (68%) exhibited an AmpC phenotype, and 103 isolates (68%) showed a mixed ESBL/AmpC coproduction phenotype (Appendix 1 in Supplementary File). A total of 100 ESBL- and/or AmpC-positive isolates were selected for genotypic analysis.

4.2. Molecular Detection of Extended-Spectrum β-Lactamase- and CMY-2-Encoding Genes

Approximately 84% (84/100) of the UPEC isolates were positive for ESBL-encoding genes. Among these, 76% (76/100), 75% (75/100), and 73% (73/100) were positive for the blaCTX-M, blaTEM, and blaSHV genes, respectively (Appendices 2 and 3 in Supplementary File). The PCR results revealed a prevalence of 60% for blaCMY-2 among the 100 isolates identified as AmpC-positive by the CDT method (Appendices 3 and 4 in Supplementary File). The PCR analysis of the 100 isolates demonstrated that 92% of UPEC isolates were positive for ESBL- and ESBL-/or CMY-2-type AmpC β-lactamase-encoding genes. Among the 92 isolates, 81 (88%) harbored more than one ESBL- and ESBL-/or CMY-2-type encoding gene, whereas only 11 (12%) of the isolates harbored only a single ESBL- or CMY-2-type encoding gene (Figure 1).
Distribution of extended-spectrum β-lactamase (ESBL) (<i>blaCTX-M</i>, <i>blaTEM</i>, <i>blaSHV)</i> and AmpC β-lactamase (<i>blaCMY-2</i>)-producing <i>Escherichia coli</i> isolates (n = 92)
Figure 1.

Distribution of extended-spectrum β-lactamase (ESBL) (blaCTX-M, blaTEM, blaSHV) and AmpC β-lactamase (blaCMY-2)-producing Escherichia coli isolates (n = 92)

4.3. Distribution of Phylogroups Among the Extended-Spectrum β-Lactamase- and Extended-Spectrum β-Lactamase/CMY-2 Isolates

A total of 92 genotypically confirmed ESBL- and ESBL-/or CMY-2-positive isolates were assigned to phylogenetic groups. Most of the isolates were in group B2 (91.3%; 84/92), followed by group D (6.5%; 6/92) and group B1 (2.2%; 2/92), whereas none of the ESBL- and ESBL-/or CMY-2-type-pUPEC isolates were affiliated with group A (Table 2). The blaCTX-M (75%; 69/92), blaTEM (73.9%; 68/92), blaSHV (71.7%; 66/92), and blaCMY-2 (58.7%; 54/92) genes were most frequently detected in the extraintestinal phylogenetic group B2 (Figure 2).
Table 2.Distribution of Extended-Spectrum β-Lactamase- and Extended-Spectrum β-Lactamase-/or CMY-2-types Among Escherichia coli Isolates (N = 92) on the Basis of Their Phylogenetic Groups a
Phylogenetic GroupESBLCMY-2ESBL/CMY-2No. of Isolates
A0000
B11 (3.1)1 (1.9)2 (2.2)
B230 (93.8)8 (100)46 (88.5)84 (91.3)
D1 (3.1)5 (9.6)6 (6.5)
Total No. of isolates3285292

Abbreviation: ESBL, extended-spectrum β-lactamase.

a Values are expressed as No. (%).

Distribution of the <i>blaCTX-M</i>, <i>blaTEM</i>, <i>blaSHV</i>, and <i>blaCMY-2</i> genes among <i>Escherichia coli</i> isolates according to their phylogenetic groups
Figure 2.

Distribution of the blaCTX-M, blaTEM, blaSHV, and blaCMY-2 genes among Escherichia coli isolates according to their phylogenetic groups

5. Discussion

The UTIs have become a serious epidemiological threat, particularly in the treatment and control of severe infections caused by β-lactamase-producing E. coli isolates. This cross-sectional study describes the phenotypic and molecular characterization of UPEC isolates with reduced susceptibility to 3GCs and cefoxitin. Among the 150 UPEC isolates, 86.7% and 68.7% exhibited ESBL and AmpC phenotypes, respectively, which aligns closely with data reported from Wasit province, Iraq, where the prevalence of ESBL and AmpC phenotypes was 80.2% and 77%, respectively (33). The spread of these resistant strains is likely driven by poor antibiotic stewardship, misuse of antibiotics, and unregulated antimicrobial sales. Additionally, the influx of refugees may have increased selection pressure, facilitating the spread of multidrug resistance genes.
Confirmatory nucleic acid amplification remains essential for detecting ESBL- and CMY-2-type AmpC producers. In this study, 84% (84/100) of UPEC isolates carried at least one ESBL gene. blaCTX-M was most prevalent (90.5%; 76/84), followed by blaTEM (89.3%; 75/84) and blaSHV (86.9%; 73/84). Sequencing of three PCR amplicons identified blaCTX-M-15 (GenBank AY044436) as the dominant variant. Globally, CTX-M-15 is one of the most prevalent ESBL genotypes and is widely detected in E. coli isolates. This genotype has been reported in various systemic infections, including UTIs (34-36). Our findings are consistent with previous studies conducted in countries such as Lebanon, Saudi Arabia, Thailand, and China, which highlight CTX-M genes as the predominant ESBL determinants (37-40).
Chromosomal AmpC β-lactamase is not typically associated with increased enzyme production (29, 41). Therefore, the AmpC phenotype observed in cefoxitin-resistant UPEC isolates likely resulted from plasmid-mediated AmpC production, confirmed by PCR detection of the blaCMY-2 gene in 60% (60/100) of isolates (Appendix 4 in Supplementary File) Consistent with our findings, studies from Iran (42), Egypt (43), and New Zealand (44) reported CMY-2 prevalence rates of 72.4%, 86.9%, and 88%, respectively. The blaCMY-2 gene often coexists with other resistance genes on mobile genetic elements, contributing to multidrug resistance (18). In this study, co-occurrence of ESBL and CMY-2 genes was detected in 56.5% (52/92) of isolates, with 41 (44.6%) harboring blaCTX-M+blaTEM+blaSHV+blaCMY-2. Co-production of ESBL and CMY-2 β-lactamases has also been widely reported in countries such as Mexico, Europe, Iran, Sri Lanka, and Pakistan (45-49).
Escherichia coli isolates are classified into four phylogenetic groups: A, B1, B2, and D (32). The ExPEC strains causing UTIs are primarily found in groups B2 and D, while commensal strains are linked to A and B1 (2). In this study, blaCTX-M, blaTEM, blaSHV, and blaCMY-2 genes were most frequently detected in group B2, which accounted for 91.3% (84/92) of ESBL and/or CMY-2-pUPEC isolates, followed by group D (6.5%; 6/92). This high prevalence in B2 suggests an enhanced ability of ExPEC strains to acquire resistance genes via plasmid-mediated horizontal transfer, contributing to their spread (38, 50). Implementing proper infection control measures is essential to limit transmission. Routine susceptibility testing for 3GCs and cephamycins may support early detection and guide effective treatment.
This study was limited by its single-center design, small sample size, and focus on selected resistance genes without q-RT-PCR validation. Future research should involve larger, multicenter cohorts and broader molecular analysis to better understand resistance mechanisms in ESBL- and AmpC-producing E. coli.

5.1. Conclusions

The ESBL- and CMY-2-type isolates were highly prevalent in phylogroup B2, which includes ExPEC strains. These strains may cause UTIs and spread resistance genes via plasmid-mediated transfer. The findings underscore the urgent need for surveillance and resistance profiling in Iraqi hospitals to control dissemination and guide effective treatment strategies.

Acknowledgments

Footnotes

References

  • 1.
    Zhou Y, Zhou Z, Zheng L, Gong Z, Li Y, Jin Y, et al. Urinary tract infections caused by uropathogenic escherichia coli: Mechanisms of infection and treatment options. Int J Mol Sci. 2023;24(13). [PubMed ID: 37445714]. [PubMed Central ID: PMC10341809]. https://doi.org/10.3390/ijms241310537.
  • 2.
    Clements A, Young JC, Constantinou N, Frankel G. Infection strategies of enteric pathogenic Escherichia coli. Gut Microbes. 2012;3(2):71-87. [PubMed ID: 22555463]. [PubMed Central ID: PMC3370951]. https://doi.org/10.4161/gmic.19182.
  • 3.
    Martinson JNV, Walk ST. Escherichia coli residency in the gut of healthy human adults. EcoSal Plus. 2020;9(1). [PubMed ID: 32978935]. [PubMed Central ID: PMC7523338]. https://doi.org/10.1128/ecosalplus.ESP-0003-2020.
  • 4.
    Shah C, Baral R, Bartaula B, Shrestha LB. Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance. BMC Microbiol. 2019;19(1):204. [PubMed ID: 31477018]. [PubMed Central ID: PMC6720075]. https://doi.org/10.1186/s12866-019-1587-3.
  • 5.
    Pitout JD. Extraintestinal pathogenic Escherichia coli: A combination of virulence with antibiotic resistance. Front Microbiol. 2012;3:9. [PubMed ID: 22294983]. [PubMed Central ID: PMC3261549]. https://doi.org/10.3389/fmicb.2012.00009.
  • 6.
    Sarowska J, Futoma-Koloch B, Jama-Kmiecik A, Frej-Madrzak M, Ksiazczyk M, Bugla-Ploskonska G, et al. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: recent reports. Gut Pathog. 2019;11:10. [PubMed ID: 30828388]. [PubMed Central ID: PMC6383261]. https://doi.org/10.1186/s13099-019-0290-0.
  • 7.
    Bajaj P, Singh NS, Virdi JS. Escherichia coli beta-Lactamases: What Really Matters. Front Microbiol. 2016;7:417. [PubMed ID: 27065978]. [PubMed Central ID: PMC4811930]. https://doi.org/10.3389/fmicb.2016.00417.
  • 8.
    Saad S, Mina N, Lee C, Afra K. Oral beta-lactam step down in bacteremic E. coli urinary tract infections. BMC Infect Dis. 2020;20(1):785. [PubMed ID: 33087051]. [PubMed Central ID: PMC7576740]. https://doi.org/10.1186/s12879-020-05498-2.
  • 9.
    Nasrollahian S, Graham JP, Halaji M. A review of the mechanisms that confer antibiotic resistance in pathotypes of E. coli. Front Cell Infect Microbiol. 2024;14:1387497. [PubMed ID: 38638826]. [PubMed Central ID: PMC11024256]. https://doi.org/10.3389/fcimb.2024.1387497.
  • 10.
    Richelsen R, Smit J, Schonheyder HC, Laxsen Anru P, Gutierrez-Gutierrez B, Rodriguez-Bano J, et al. Outcome of community-onset ESBL-producing Escherichia coli and Klebsiella pneumoniae bacteraemia and urinary tract infection: a population-based cohort study in Denmark. J Antimicrob Chemother. 2020;75(12):3656-64. [PubMed ID: 32862220]. https://doi.org/10.1093/jac/dkaa361.
  • 11.
    Bush K. Past and present perspectives on beta-Lactamases. Antimicrob Agents Chemother. 2018;62(10). [PubMed ID: 30061284]. [PubMed Central ID: PMC6153792]. https://doi.org/10.1128/AAC.01076-18.
  • 12.
    Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob Agents Chemother. 2010;54(3):969-76. [PubMed ID: 19995920]. [PubMed Central ID: PMC2825993]. https://doi.org/10.1128/AAC.01009-09.
  • 13.
    Hirsch EB, Brigman HV, Zucchi PC, Chen A, Anderson JC, Eliopoulos GM, et al. Ceftolozane-tazobactam and ceftazidime-avibactam activity against beta-lactam-resistant Pseudomonas aeruginosa and extended-spectrum beta-lactamase-producing Enterobacterales clinical isolates from U.S. medical centres. J Glob Antimicrob Resist. 2020;22:689-94. [PubMed ID: 32353524]. https://doi.org/10.1016/j.jgar.2020.04.017.
  • 14.
    Merida-Vieyra J, De Colsa-Ranero A, Calderon-Castaneda Y, Aquino-Andrade A. Detection of CMY-type beta-lactamases in Escherichia coli isolates from paediatric patients in a tertiary care hospital in Mexico. Antimicrob Resist Infect Control. 2020;9(1):168. [PubMed ID: 33121527]. [PubMed Central ID: PMC7596940]. https://doi.org/10.1186/s13756-020-00840-4.
  • 15.
    Miro E, Aguero J, Larrosa MN, Fernandez A, Conejo MC, Bou G, et al. Prevalence and molecular epidemiology of acquired AmpC beta-lactamases and carbapenemases in Enterobacteriaceae isolates from 35 hospitals in Spain. Eur J Clin Microbiol Infect Dis. 2013;32(2):253-9. [PubMed ID: 22956023]. https://doi.org/10.1007/s10096-012-1737-0.
  • 16.
    Oteo J, Cercenado E, Cuevas O, Bautista V, Delgado-Iribarren A, Orden B, et al. AmpC beta-lactamases in Escherichia coli: emergence of CMY-2-producing virulent phylogroup D isolates belonging mainly to STs 57, 115, 354, 393, and 420, and phylogroup B2 isolates belonging to the international clone O25b-ST131. Diagn Microbiol Infect Dis. 2010;67(3):270-6. [PubMed ID: 20462723]. https://doi.org/10.1016/j.diagmicrobio.2010.02.008.
  • 17.
    San N, Aung MS, Urushibara N, San T, Maw WW, Lwin MM, et al. Genetic diversity of CMY beta-Lactamase genes in clinical isolates of Escherichia coli in Myanmar: Identification of three novel types and updated phylogenetic classification of bla(CMY). Microb Drug Resist. 2020;26(5):497-504. [PubMed ID: 31738628]. https://doi.org/10.1089/mdr.2019.0234.
  • 18.
    Seo KW, Do KH, Shin MK, Lee WK, Lee WK. Comparative genetic characterization of CMY-2-type beta-lactamase producing pathogenic Escherichia coli isolated from humans and pigs suffering from diarrhea in Korea. Ann Clin Microbiol Antimicrob. 2023;22(1):7. [PubMed ID: 36658572]. [PubMed Central ID: PMC9854124]. https://doi.org/10.1186/s12941-023-00559-1.
  • 19.
    Suwantarat N, Logan LK, Carroll KC, Bonomo RA, Simner PJ, Rudin SD, et al. The prevalence and molecular epidemiology of multidrug-resistant Enterobacteriaceae colonization in a pediatric intensive care unit. Infect Control Hosp Epidemiol. 2016;37(5):535-43. [PubMed ID: 26856439]. [PubMed Central ID: PMC4833541]. https://doi.org/10.1017/ice.2016.16.
  • 20.
    Gazal LES, Medeiros LP, Dibo M, Nishio EK, Koga VL, Goncalves BC, et al. Detection of ESBL/AmpC-producing and fosfomycin-resistant Escherichia coli From different sources in poultry production in Southern Brazil. Front Microbiol. 2020;11:604544. [PubMed ID: 33505374]. [PubMed Central ID: PMC7829455]. https://doi.org/10.3389/fmicb.2020.604544.
  • 21.
    Belley A, Morrissey I, Hawser S, Kothari N, Knechtle P. Third-generation cephalosporin resistance in clinical isolates of Enterobacterales collected between 2016-2018 from USA and Europe: genotypic analysis of beta-lactamases and comparative in vitro activity of cefepime/enmetazobactam. J Glob Antimicrob Resist. 2021;25:93-101. [PubMed ID: 33746112]. https://doi.org/10.1016/j.jgar.2021.02.031.
  • 22.
    Pitout JD, Laupland KB. Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008;8(3):159-66. [PubMed ID: 18291338]. https://doi.org/10.1016/S1473-3099(08)70041-0.
  • 23.
    Reuland EA, Hays JP, de Jongh DM, Abdelrehim E, Willemsen I, Kluytmans JA, et al. Detection and occurrence of plasmid-mediated AmpC in highly resistant gram-negative rods. PLoS One. 2014;9(3). e91396. [PubMed ID: 24642853]. [PubMed Central ID: PMC3958353]. https://doi.org/10.1371/journal.pone.0091396.
  • 24.
    Majeed HT, Aljanaby AAJ. Antibiotic susceptibility patterns and prevalence of some extended spectrum beta-lactamases genes in gram-negative bacteria isolated from patients infected with urinary tract infections in Al-Najaf city, Iraq. Avicenna J Med Biotechnol. 2019;11(2):192-201. [PubMed ID: 31057723]. [PubMed Central ID: PMC6490404].
  • 25.
    Alkhudhairy MK, Alshammari MMM. Extended spectrum β-lactamase-producing Escherichia coli isolated from pregnant women with asymptomatic UTI in Iraq. EurAsian J BioSci. 2019;(13):1881-9.
  • 26.
    Hasan DL, Khalid HM, Mero WMS. Phenotypic and molecular study of extended-spectrum β-lactamases producing Enterobacteriaceae from urinary tract infection in Zakho city, Kurdistan Region/Iraq. Acad J Nawroz Univ. 2022;11(3):305-13. https://doi.org/10.25007/ajnu.v11n3a1447.
  • 27.
    Le Bouguenec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol. 1992;30(5):1189-93. [PubMed ID: 1349900]. [PubMed Central ID: PMC265248]. https://doi.org/10.1128/jcm.30.5.1189-1193.1992.
  • 28.
    Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed. Wayne, PA: Clinical and Laboratory Standards Institute; 2020.
  • 29.
    Peter-Getzlaff S, Polsfuss S, Poledica M, Hombach M, Giger J, Bottger EC, et al. Detection of AmpC beta-lactamase in Escherichia coli: Comparison of three phenotypic confirmation assays and genetic analysis. J Clin Microbiol. 2011;49(8):2924-32. [PubMed ID: 21653764]. [PubMed Central ID: PMC3147754]. https://doi.org/10.1128/JCM.00091-11.
  • 30.
    Perez-Perez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002;40(6):2153-62. [PubMed ID: 12037080]. [PubMed Central ID: PMC130804]. https://doi.org/10.1128/JCM.40.6.2153-2162.2002.
  • 31.
    Bajaj P, Singh NS, Kanaujia PK, Virdi JS. Distribution and molecular characterization of genes encoding CTX-M and AmpC beta-lactamases in Escherichia coli isolated from an Indian urban aquatic environment. Sci Total Environ. 2015;505:350-6. [PubMed ID: 25461036]. https://doi.org/10.1016/j.scitotenv.2014.09.084.
  • 32.
    Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000;66(10):4555-8. [PubMed ID: 11010916]. [PubMed Central ID: PMC92342]. https://doi.org/10.1128/AEM.66.10.4555-4558.2000.
  • 33.
    Al-Mayahie S, Al Kuriashy JJ. Distribution of ESBLs among Escherichia coli isolates from outpatients with recurrent UTIs and their antimicrobial resistance. J Infect Dev Ctries. 2016;10(6):575-83. [PubMed ID: 27367005]. https://doi.org/10.3855/jidc.6661.
  • 34.
    Yu K, Huang Z, Xiao Y, Bai X, Gao H, Wang D. Epidemiology and molecular characterization of CTX-M-type ESBLs producing Escherichia coli isolated from clinical settings. J Glob Antimicrob Resist. 2024;36:181-7. [PubMed ID: 38072240]. https://doi.org/10.1016/j.jgar.2023.11.013.
  • 35.
    Choi HJ, Jeong SH, Shin KS, Kim YA, Kim YR, Kim HS, et al. Characteristics of Escherichia coli Urine Isolates and Risk Factors for Secondary Bloodstream Infections in Patients with Urinary Tract Infections. Microbiol Spectr. 2022;10(4). e0166022. [PubMed ID: 35862950]. [PubMed Central ID: PMC9430824]. https://doi.org/10.1128/spectrum.01660-22.
  • 36.
    Hassuna NA, Khairalla AS, Farahat EM, Hammad AM, Abdel-Fattah M. Molecular characterization of Extended-spectrum beta lactamase- producing E. coli recovered from community-acquired urinary tract infections in Upper Egypt. Sci Rep. 2020;10(1):2772. [PubMed ID: 32066805]. [PubMed Central ID: PMC7026060]. https://doi.org/10.1038/s41598-020-59772-z.
  • 37.
    Ghaddar N, Anastasiadis E, Halimeh R, Ghaddar A, Matar GM, Abou Fayad A, et al. Phenotypic and Genotypic Characterization of Extended-Spectrum Beta-Lactamases Produced by Escherichia coli Colonizing Pregnant Women. Infect Dis Obstet Gynecol. 2020;2020:4190306. [PubMed ID: 32327921]. [PubMed Central ID: PMC7168714]. https://doi.org/10.1155/2020/4190306.
  • 38.
    Ullah N, Assawakongkarat T, Akeda Y, Chaichanawongsaroj N. Detection of Extended-spectrum beta-lactamase-producing Escherichia coli isolates by isothermal amplification and association of their virulence genes and phylogroups with extraintestinal infection. Sci Rep. 2023;13(1):12022. [PubMed ID: 37491387]. [PubMed Central ID: PMC10368679]. https://doi.org/10.1038/s41598-023-39228-w.
  • 39.
    Alyamani EJ, Khiyami AM, Booq RY, Majrashi MA, Bahwerth FS, Rechkina E. The occurrence of ESBL-producing Escherichia coli carrying aminoglycoside resistance genes in urinary tract infections in Saudi Arabia. Ann Clin Microbiol Antimicrob. 2017;16(1):1. [PubMed ID: 28061852]. [PubMed Central ID: PMC5219782]. https://doi.org/10.1186/s12941-016-0177-6.
  • 40.
    Zhao R, Shi J, Shen Y, Li Y, Han Q, Zhang X, et al. Phylogenetic distribution of virulence genes among ESBL-producing uropathogenic Escherichia coli isolated from long-term hospitalized patients. J Clin Diagn Res. 2015;9(7):DC01-4. [PubMed ID: 26393125]. [PubMed Central ID: PMC4572956]. https://doi.org/10.7860/JCDR/2015/13234.6157.
  • 41.
    Black JA, Moland ES, Thomson KS. AmpC disk test for detection of plasmid-mediated AmpC beta-lactamases in Enterobacteriaceae lacking chromosomal AmpC beta-lactamases. J Clin Microbiol. 2005;43(7):3110-3. [PubMed ID: 16000421]. [PubMed Central ID: PMC1169113]. https://doi.org/10.1128/JCM.43.7.3110-3113.2005.
  • 42.
    Bahramian A, Khoshnood S, Hashemi N, Moradi M, Karimi-Yazdi M, Jalallou N, et al. Identification of metallo-beta-lactamases and AmpC production among Escherichia coli strains isolated from hemodialysis patients with urinary tract infection. Mol Biol Rep. 2021;48(12):7883-92. [PubMed ID: 34657270]. [PubMed Central ID: PMC8520576]. https://doi.org/10.1007/s11033-021-06814-y.
  • 43.
    Helmy MM, Wasfi R. Phenotypic and molecular characterization of plasmid mediated AmpC beta-lactamases among Escherichia coli, Klebsiella spp., and Proteus mirabilis isolated from urinary tract infections in Egyptian hospitals. Biomed Res Int. 2014;2014:171548. [PubMed ID: 25003107]. [PubMed Central ID: PMC4070535]. https://doi.org/10.1155/2014/171548.
  • 44.
    Drinkovic D, Morris AJ, Dyet K, Bakker S, Heffernan H. Plasmid-mediated AmpC beta-lactamase-producing Escherichia coli causing urinary tract infection in the Auckland community likely to be resistant to commonly prescribed antimicrobials. N Z Med J. 2015;128(1410):50-9. [PubMed ID: 25829039].
  • 45.
    Perera P, Gamage S, De Silva HSM, Jayatilleke SK, de Silva N, Aydin A, et al. Phenotypic and genotypic distribution of ESBL, AmpC beta-lactamase and carbapenemase-producing Enterobacteriaceae in community-acquired and hospital-acquired urinary tract infections in Sri Lanka. J Glob Antimicrob Resist. 2022;30:115-22. [PubMed ID: 35667644]. https://doi.org/10.1016/j.jgar.2022.05.024.
  • 46.
    Ramirez-Castillo FY, Moreno-Flores AC, Avelar-Gonzalez FJ, Marquez-Diaz F, Harel J, Guerrero-Barrera AL. An evaluation of multidrug-resistant Escherichia coli isolates in urinary tract infections from Aguascalientes, Mexico: cross-sectional study. Ann Clin Microbiol Antimicrob. 2018;17(1):34. [PubMed ID: 30041652]. [PubMed Central ID: PMC6057003]. https://doi.org/10.1186/s12941-018-0286-5.
  • 47.
    Rizi KS, Mosavat A, Youssefi M, Jamehdar SA, Ghazvini K, Safdari H, et al. High prevalence of bla(CMY) AmpC beta-lactamase in ESBL co-producing Escherichia coli and Klebsiella spp. clinical isolates in the northeast of Iran. J Glob Antimicrob Resist. 2020;22:477-82. [PubMed ID: 32247080]. https://doi.org/10.1016/j.jgar.2020.03.011.
  • 48.
    Sepp E, Andreson R, Balode A, Bilozor A, Brauer A, Egorova S, et al. Phenotypic and molecular epidemiology of ESBL-, AmpC-, and carbapenemase-producing Escherichia coli in Northern and Eastern Europe. Front Microbiol. 2019;10:2465. [PubMed ID: 31824436]. [PubMed Central ID: PMC6882919]. https://doi.org/10.3389/fmicb.2019.02465.
  • 49.
    Ehsan B, Haque A, Qasim M, Ali A, Sarwar Y. High prevalence of extensively drug resistant and extended spectrum beta lactamases (ESBLs) producing uropathogenic Escherichia coli isolated from Faisalabad, Pakistan. World J Microbiol Biotechnol. 2023;39(5):132. [PubMed ID: 36959469]. [PubMed Central ID: PMC10036249]. https://doi.org/10.1007/s11274-023-03565-9.
  • 50.
    Bortolami A, Zendri F, Maciuca EI, Wattret A, Ellis C, Schmidt V, et al. Diversity, virulence, and clinical significance of extended-spectrum beta-Lactamase- and pAmpC-producing Escherichia coli from companion animals. Front Microbiol. 2019;10:1260. [PubMed ID: 31231344]. [PubMed Central ID: PMC6560200]. https://doi.org/10.3389/fmicb.2019.01260.

Similar Articles

15
Feb
2025
Jundishapur J Microbiol

Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran

Mehdi Bozorgi Mazandarani,
Mohammad Kargar,
Farshid Kafilzadeh

Bozorgi Mazandarani M, Kargar M, Kafilzadeh F. Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran. Jundishapur J Microbiol. 2025;18(2):e156768. doi: https://doi.org/10.5812/jjm-156768

6
Aug
2016

Identification of Extended-Spectrum β-Lactamase Genes and AmpC-β-Lactamase in Clinical Isolates of Escherichia coli Recovered from Patients with Urinary Tract Infections in Kerman, Iran

Maryam Koshesh,
Shahla Mansouri,
Zahra Hashemizadeh,
Davood Kalantar-Neyestanaki

Koshesh M, Mansouri S, Hashemizadeh Z, Kalantar-Neyestanaki D. Identification of Extended-Spectrum β-Lactamase Genes and AmpC-β-Lactamase in Clinical Isolates of Escherichia coli Recovered from Patients with Urinary Tract Infections in Kerman, Iran. Arch Pediatr Infect Dis. 2017;5(2):e37968. doi: https://doi.org/10.5812/pedinfect.37968

1
May
2017

Quinolone Resistance Determinants qnr, qep, and aac(6’)-Ib-cr in Extended-Spectrum Β-Lactamase Producing Escherichia coli Isolated From Urinary Tract Infections in Tehran, Iran

Mehdi Goudarzi,
Maryam Fazeli

Goudarzi M, Fazeli M. Quinolone Resistance Determinants qnr, qep, and aac(6’)-Ib-cr in Extended-Spectrum Β-Lactamase Producing Escherichia coli Isolated From Urinary Tract Infections in Tehran, Iran. Shiraz E-Med J. 2017;18(5):e13186. doi: https://doi.org/10.5812/semj.44498

12
Apr
2016

High Frequency of Extended-Spectrum β-Lactamase-Producing Klebsiella pneumoniae and Escherichia coli Isolates From Male Patients’ Urine

Shahin Najar Peerayeh,
Elham Rostami,
Majid Eslami,
Mohammad Ahangarzadeh Rezaee

Najar Peerayeh S, Rostami E, Eslami M, Ahangarzadeh Rezaee M. High Frequency of Extended-Spectrum β-Lactamase-Producing Klebsiella pneumoniae and Escherichia coli Isolates From Male Patients’ Urine. Arch Clin Infect Dis. 2016;11(2):e60127. doi: https://doi.org/10.5812/archcid.32696

27
Mar
2017

CTX-M-15 Type β-lactamases From Clinical Isolates of Escherichia coli by Polymerase Chain Reaction and DNA Sequencing

Mahboobeh Nakhaei Moghaddam,
Mohammad Reza Zolfaghari,
Niloofar Tavakoli‐Hoseini

Nakhaei Moghaddam M, Zolfaghari MR, Tavakoli‐Hoseini N. CTX-M-15 Type β-lactamases From Clinical Isolates of Escherichia coli by Polymerase Chain Reaction and DNA Sequencing. Zahedan J Res Med Sci. 2017;19(3):e5814. doi: https://doi.org/10.5812/zjrms.5814


Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Ordering Reprints

Articles are published under the Creative Commons license stated on each article. No permission or royalty fee is required for uses permitted by that license. CCC handles optional bulk and customized reprint orders. Any quotation covers production and delivery services only, not copyright permission. > Request Reprints from CCC 

Search Relations

Author(s):

Related Articles