Logo

A Study of The Genetic Variability of Blastocystis hominis Isolates in Hamadan, West of Iran

Author(s):
Khosro SardarianKhosro Sardarian1,*, Mehrdad HajilooiMehrdad Hajilooi2, Amirhosein MaghsoodAmirhosein Maghsood1, Abbas MoghimbeigiAbbas Moghimbeigi3, Mohamadyusef AlikhaniMohamadyusef Alikhani4
1Department of Parasitology and Mycology, Hamadan University of Medical Sciences, Hamadan, IR Iran
2Department of Immunology, Hamadan University of Medical Sciences, Hamadan, IR Iran
3Department of Epidemiology and Biostatistics, Hamadan University of Medical Sciences, Hamadan, IR Iran
4Department of Microbiology, School of Medicine, Hamadan University of Medical Sciences, Hamadan, IR Iran

Jundishapur Journal of Microbiology:Vol. 5, issue 4; 555-559
Published online:Sep 09, 2012
Article type:Research Article
Received:Jan 07, 2011
Accepted:Apr 04, 2012
How to Cite:Sardarian K, Hajilooi M, Maghsood A, Moghimbeigi A, Alikhani M, A Study of The Genetic Variability of Blastocystis hominis Isolates in Hamadan, West of Iran.Jundishapur J Microbiol.2012;5(4):555-559.https://doi.org/10.5812/jjm.4071.

Abstract

Background:

Blastocystis is a common protozoan parasite in mammals, birds, amphibians,reptiles, fish, arthropods, and annelids. This parasite has some subtypes, which pathogenicity status of them still remained controversial. Some of Blastocystis subtypes are potentially pathogenic to human.

Objectives:

This study has identified the Blastocystis hominis subtypes and their prevalence rates in Hamadan.

Materials and Methods:

During two months of summer 2011, a total number of 250 human fecal samples referred for parasitology examination to Beasat Hospital and a few clinical laboratories of Hamadan city were collected. The samples were examined by direct method and formalin-ether. 41 samples exhibited positive results for B. hominis thereby were cultured in Locke-egg medium. After the growth and in order to genotype identification, B. hominis isolates were amplified by PCR, using seven pairs of sequences-tagged site primers.

Results:

In this study, three subtypes of B. hominis consisted of one [SB83], two [SB340] and three [SB227] were identified. . The most dominant genotype was SB83 with 56.1 % frequency. The prevalence rate of genotype SB227 and SB340 were 22 % and 7.3 %, respectively. Coexistence of genotypes SB83 and SB227 was detected in 14.6 % of positive cases.

Conclusions:

This is the first study in Hamadan on genotyping of B. hominis, which may trigger other epidemiologic and zoonotic studies on different subtypes and hence control clinical manifestations of infection.

1. Background

Blastocystis hominis is the most common intestinal parasite in humans and many other animals (1). Infections with the organism are spread worldwide and it is often the most frequently isolated protozoan in parasitological surveys (2-4). In developing countries, B. hominis has higher prevalence (30-50 %) in comparison with developed countries (1.5-10 %) (5, 6). The pathogenicity of B. hominis still has been debated. There are some reports supporting the pathogenic potential of this parasite (7). Clinical features related to B. hominis include nausea, anorexia, abdominal pain, flatulence, and acute or chronic diarrhea (8). However other studies state an opponent view point and it is believed that other factors probably are the causing agents of these symptoms (7, 9-11).

The studies have shown that B. hominis isolates of humans and animals display considerable genetic heterogeneity and have a few subtypes (12). It is supposed that the parasite has 13 subtypes (13), however, to date nine distinct subtypes have been identified (9), which some zoonotic subtypes have found in humans (14, 15). Based on morphologic and pathogenic potentials, there are nine different subtypes, each of them exhibits different features (16-18). Probably each subtype demonstrate its own pathogenicity (19); therefore it is necessary to know specific subtypes of each region.

2. Objectives

The aim of this study was to determine subtypes of B.hominis and relevant prevalence of each in Hamadan city,west of Iran.

3. Materials and Methods

3.1. Samples

Simple random sampling was applied in this study. Forty one samples of B. hominis were detected as positive that was on the basis of an expected prevalence of 37.1 % (20), with a maximum sampling error of 0.15 and a confidence interval (CI) of 95 %. During two months of summer 2011, a total number of 250 fecal samples were collected from the people referred for parasitological examination to Beasat Hospital and a few clinical laboratories of Hamadan city . The samples were transferred to the Parasitology Laboratory of Faculty of Medicine, Hamadan University of Medical Sciences. They were tested for the presence of B. hominis by formalin-ether method. To increase the accuracy, the samples were stained by iodine and trichrome techniques.

3.2. Culture of Blastocystis Isolates

After microscopic observation of the parasite in fecal samples, any debris was removed from positive samples by the use of centrifugation. The positive samples were cultured in Locke-egg (LE) medium and incubated at 37°C for 48-72 hours according to Clark and Diamond (21).

3.3. Extraction of Genomic DNA

Genomic DNA of each isolate was extracted by genomic DNA purification kit (Sinagen Co, Iran) according to the manufacturer’s protocol.

3.4. Genotyping

To identify B. hominis genotypes, seven pairs of Sequences-tagged site (STS) primers [SB83, SB340, SB227, SB337, SB336, SB332, and SB155] were used with PCR technique (22) (Table 1). PCR was performed as following: DNA of 41 isolates was amplified by specific primers. The reaction was carried out within 50 μL final volumes including the following materials: 10 μL DNA, 5 PG of each pair primers, 2.5 mM Cl2Mg, 5 μl PCR buffer pH = 8.3, and 0.5 UI Taq DNA polymerase [Bioprobe]. This combination was entered the cycle described as follows: denaturation at 94˚C for three minutes, and 30 Cycles denaturation at 94˚C for 30 sec, annealing at 56˚C for 30 sec, extension at 72˚C for 30sec, and final extension at 72˚C for five min. The product of PCR was flowed on 1.5 % agarose gel containing ethidium bromide with 100 bp DNA ladder.

Table 1Primer Sequences Used in The Study
SB83 Sub I 351 F:GAAGGACTCTCTGACGATGA AF166086
R:GTCCAAATGAAAGGCAGC
SB340 Sub II 704 F:TGTTCTTGTGTCTTCTCAGCTC AY048752
R:TTCTTTCACACTCCCGTCAT
SB227 Sub III 526 F:TAGGATTTGGTGTTTGGAGA AF166088
R:TTAGAAGTGAAGGAGATGGAAG
SB337 Sub IV 487 F:GTCTTTCCCTGTCTATTCTTGCA AY048750
R:AATTCGGTCTGCTTCTTCTG
SB336 Sub V 317 F:GTGGGTAGAGGAAGGAAAACA AY048751
R:AGAACAAGTCGATGAAGTGAGAT
SB332 Sub VI 338 F:GCATCCAGACTACTATCAACATT AF166091
R:CCATTTTCAGACAACCACTTA
SB155 Sub VII 650 F:ATCAGCCTACAATCTCCTC AF166087
R:ATCGCCACTTCTCCAAT

Primer Sequences Used in The Study

4. Results

According to table 2, the genotype SB83 was the most identified genotype representing 56.1 % of isolates, followed by genotype SB227 [22 %], mixture of SB83 and SB227 genotypes [14.6 %], and genotype SB340 [7.3 %]. Other genotypes were not detected in this study. In serial order, subtypes SB83 and SB227 were the most frequent isolates in this research. The PCR amplification of B. hominis isolates with the primers SB83 [351 bp], SB340 [704 bp], and SB227 [526 bp] were shown in Figures 1,2,3.

The PCR Amplification of Sb83 Genotype
Figure 1

The PCR Amplification of Sb83 Genotype

The PCR Amplification of Sb340 Genotype
Figure 2

The PCR Amplification of Sb340 Genotype

The PCR Amplification of Sb227 Genotype
Figure 3

The PCR Amplification of Sb227 Genotype

Table 2Frequency of Different Genotypes of 41 Blastocystis Hominis Isolates
1 [SB83] 23(56.1)
2 [SB340] 3(7.3)
3 [SB227] 9(22)
1 [SB83] and 3 [SB227] 6(14.6)
Other genotypes 0(0)
Total 41(100)

Frequency of Different Genotypes of 41 Blastocystis Hominis Isolates

5. Discussion

Some studies have been conducted on prevalence and pathogenesis of B. hominis in Iran. Prevalence rates of B.hominis have been reported from 0.08 % to 54.5 % (23-29). However, there are few studies with focus on the pathogenesis aspect of B. hominis (25, 27, 30). In this study, the pathogenesis of B. hominis subtypes is not investigated but some differences in virulence between Blastocystis subtypes was shown (9, 20, 31, 32). In many studies, pathogenic potential of subtype 3 has been reported (16, 31, 33-35). Also, some investigations have demonstrated that other subtypes such as subtype 1 were associated with symptoms (20, 31, 34, 36).

Three genotypes were detected in this study including SB83, SB340, and SB227. The results are similar to some other studies performed worldwide (14, 15, 21, 36-38). The frequency of subtype SB83 was more than subtypes SB227 and SB340 that is similar to some other researches (5, 17, 20). The subtypes SB337, SB336, SB332 and SB155 were not detected. In the current study, the most frequent subtype was SB83 that conforms to some other investigations (15, 27, 39). In human isolates, the highest prevalence has been related to subtype SB227 and other subtypes have shown different prevalence rates (9, 20, 21, 37, 39, 40). In human studies, mixed infections with subtypes SB227 and SB83, and with subtypes SB340 and SB337 were reported (41).

This study showed that similar to some other studies (13), the subtype of SB227 exhibits the lowest prevalence rate in this region of Iran [3.7 %]. Furthermore, 14.6 % of the persons were infected by genotypes SB83 and SB227, simultaneously. In some studies, the rate of mixed infections has been observed from 1.1 to 14.3 (5, 19, 21, 39). The frequency of mixed infections with subtypes SB83 and SB340 (5), with SB340 and SB227 (5), and with SB227 and SB336 (39) was low. Because of different growth rates of B. hominis subtypes in culture media, we may have ignored some mixed subtypes in infected patients. Thus, this could be a limitation for current research. Direct PCR method application on DNA obtained from stool samples is suggested (19).

This is a novel study in this region of Iran, which can help the researchers to be aware of epidemiological patterns of this parasite. These data would trigger other epidemiologic and zoonotic studies on different subtypes and hence control clinical manifestations of infection.

Acknowledgments

Footnotes

References

  • 1.
    Windsor JJ, Macfarlane L, Hughes-Thapa G, Jones SK, Whiteside TM. Incidence of Blastocystis hominis in faecal samples submitted for routine microbiological analysis. Br J Biomed Sci. 2002;59(3):154-7. [PubMed ID: 12371057].
  • 2.
    Boorom KF, Smith H, Nimri L, Viscogliosi E, Spanakos G, Parkar U, et al. Oh my aching gut: irritable bowel syndrome, Blastocystis, and asymptomatic infection. Parasit Vectors. 2008;1(1):40. https://doi.org/10.1186/1756-3305-1-40.
  • 3.
    Chandramathi S, Suresh K, Kuppusamy UR. Elevated levels of urinary hyaluronidase in humans infected with intestinal parasites. Ann Trop Med Parasitol. 2010;104(5):449-52. [PubMed ID: 20819313]. https://doi.org/10.1179/136485910X12743554760423.
  • 4.
    Roldan WH, Espinoza YA, Huapaya PE, Huiza AF, Sevilla CR, Jimenez S. Frequency of human toxocariasis in a rural population from Cajamarca, Peru determined by DOT-ELISA test. Rev Inst Med Trop Sao Paulo. 2009;51(2):67-71. https://doi.org/10.1590/S0036-46652009000200002.
  • 5.
    Li LH, Zhou XN, Du ZW, Wang XZ, Wang LB, Jiang JY, et al. Molecular epidemiology of human Blastocystis in a village in Yunnan province, China. Parasitol Int. 2007;56(4):281-6. [PubMed ID: 17627869]. https://doi.org/10.1016/j.parint.2007.06.001.
  • 6.
    Vogelberg C, Stensvold CR, Monecke S, Ditzen A, Stopsack K, Heinrich-Grafe U, et al. Blastocystis sp. subtype 2 detection during recurrence of gastrointestinal and urticarial symptoms. Parasitol Int. 2010;59(3):469-71. [PubMed ID: 20363362]. https://doi.org/10.1016/j.parint.2010.03.009.
  • 7.
    Ok UZ, Girginkardesler N, Balcioglu C, Ertan P, Pirildar T, Kilimcioglu AA. Effect of trimethoprim-sulfamethaxazole in Blastocystis hominis infection. Am J Gastroenterol. 1999;94(11):3245-7. [PubMed ID: 10566723]. https://doi.org/10.1111/j.1572-0241.1999.01529.x.
  • 8.
    Sohail MR, Fischer PR. Blastocystis hominis and travelers. Travel Med Infect Dis. 2005;3(1):33-8. [PubMed ID: 17292002]. https://doi.org/10.1016/j.tmaid.2004.06.001.
  • 9.
    Hussein EM, Hussein AM, Eida MM, Atwa MM. Pathophysiological variability of different genotypes of human Blastocystis hominis Egyptian isolates in experimentally infected rats. Parasitol Res. 2008;102(5):853-60. [PubMed ID: 18193282]. https://doi.org/10.1007/s00436-007-0833-z.
  • 10.
    Kaya S, Cetin ES, Aridogan BC, Arikan S, Demirci M. Pathogenicity of Blastocystis hominis, a clinical reevaluation. Turkiye Parazitol Derg. 2007;31(3):184-7. [PubMed ID: 17918055].
  • 11.
    Rossignol JF, Kabil SM, Said M, Samir H, Younis AM. Effect of nitazoxanide in persistent diarrhea and enteritis associated with Blastocystis hominis. Clin Gastroenterol Hepatol. 2005;3(10):987-91. https://doi.org/10.1016/S1542-3565(05)00427-1.
  • 12.
    Stensvold CR, Arendrup MC, Jespersgaard C, Molbak K, Nielsen HV. Detecting Blastocystis using parasitologic and DNA-based methods: a comparative study. Diagn Microbiol Infect Dis. 2007;59(3):303-7. [PubMed ID: 17913433]. https://doi.org/10.1016/j.diagmicrobio.2007.06.003.
  • 13.
    Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, et al. Terminology for Blastocystis subtypes--a consensus. Trends Parasitol. 2007;23(3):93-6. [PubMed ID: 17241816]. https://doi.org/10.1016/j.pt.2007.01.004.
  • 14.
    Noel C, Dufernez F, Gerbod D, Edgcomb VP, Delgado-Viscogliosi P, Ho LC, et al. Molecular phylogenies of Blastocystis isolates from different hosts: implications for genetic diversity, identification of species, and zoonosis. J Clin Microbiol. 2005;43(1):348-55. [PubMed ID: 15634993]. https://doi.org/10.1128/JCM.43.1.348-355.2005.
  • 15.
    Yakoob J, Jafri W, Beg MA, Abbas Z, Naz S, Islam M, et al. Irritable bowel syndrome: is it associated with genotypes of Blastocystis hominis. Parasitol Res. 2010;106(5):1033-8. [PubMed ID: 20177906]. https://doi.org/10.1007/s00436-010-1761-x.
  • 16.
    Katsarou-Katsari A, Vassalos CM, Tzanetou K, Spanakos G, Papadopoulou C, Vakalis N. Acute urticaria associated with amoeboid forms of Blastocystis sp. subtype 3. Acta Derm Venereol. 2008;88(1):80-1. [PubMed ID: 18176765]. https://doi.org/10.2340/00015555-0338.
  • 17.
    Leelayoova S, Siripattanapipong S, Thathaisong U, Naaglor T, Taamasri P, Piyaraj P. Drinking water: a possible source of Blastocystis spp. subtype 1 infection in schoolchildren of a rural community in central Thailand. Am J Trop Med Hyg. 2008;79(3):401-6. [PubMed ID: 18784233].
  • 18.
    Stensvold CR, Nielsen HV, Molbak K, Smith HV. Pursuing the clinical significance of Blastocystis--diagnostic limitations. Trends Parasitol. 2009;25(1):23-9. [PubMed ID: 19013108]. https://doi.org/10.1016/j.pt.2008.09.010.
  • 19.
    Tan KS. New insights on classification, identification, and clinical relevance of Blastocystis spp. Clin Microbiol Rev. 2008;21 (4):639-65;21(4):639-65. [PubMed ID: 18854485]. https://doi.org/10.1128/CMR.00022-08.
  • 20.
    Yan Y, Su S, Lai R, Liao H, Ye J, Li X, et al. Genetic variability of Blastocystis hominis isolates in China. Parasitol Res. 2006;99(5):597-601. [PubMed ID: 16688468]. https://doi.org/10.1007/s00436-006-0186-z.
  • 21.
    Clark CG, Diamond LS. Methods for cultivation of luminal parasitic protists of clinical importance. Clin Microbiol Rev. 2002;15(3):329-41. [PubMed ID: 12097242]. https://doi.org/10.1128/CMR.15.3.329-341.2002.
  • 22.
    Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, et al. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitol Res. 2004;92(1):22-9. [PubMed ID: 14598169]. https://doi.org/10.1007/s00436-003-0995-2.
  • 23.
    Arani AS, Alaghehbandan R, Akhlaghi L, Shahi M, Lari AR. Prevalence of intestinal parasites in a population in south of Tehran, Iran. Rev Inst Med Trop Sao Paulo. 2008;50(3):145-9. https://doi.org/10.1590/S0036-46652008000300003.
  • 24.
    Haghighi A, Khorashad AS, Nazemalhosseini Mojarad E, Kazemi B, Rostami Nejad M, Rasti S. Frequency of enteric protozoan parasites among patients with gastrointestinal complaints in medical centers of Zahedan, Iran. Trans R Soc Trop Med Hyg. 2009;103 (5):452-4;103(5):452-4. [PubMed ID: 19084249]. https://doi.org/10.1016/j.trstmh.2008.11.004.
  • 25.
    Motazedian H, Ghasemi H, Sadjjadi SM. Genomic diversity of Blastocystis hominis from patients in southern Iran. Ann Trop Med Parasitol. 2008;102(1):85-8. [PubMed ID: 18186983]. https://doi.org/10.1179/136485908X252197.
  • 26.
    Nasiri V, Esmailnia K, Karim G, Nasir M, Akhavan O. Intestinal parasitic infections among inhabitants of Karaj City, Tehran province, Iran in 2006-2008. Korean J Parasitol. 2009;47(3):265-8. [PubMed ID: 19724700]. https://doi.org/10.3347/kjp.2009.47.3.265.
  • 27.
    Rostami Nejad M, Nazemalhosseini Mojarad E, Dabiri H, Nochi Z, Pourhoseingholi MA, Sahebekhtiari N, et al. A case-control study of Blastocystis hominis among Iranian population. East Afr J Public Health. 2010;7(1):101-4. [PubMed ID: 21413584].
  • 28.
    Sharif M, Daryani A, Asgarian F, Nasrolahei M. Intestinal parasitic infections among intellectual disability children in rehabilitation centers of northern Iran. Res Dev Disabil. 2010;31(4):924-8. [PubMed ID: 20363588]. https://doi.org/10.1016/j.ridd.2010.03.001.
  • 29.
    Taherkhani H, Sardarian K, Semnani S, Roshandel G. Blastocystosis in Iran: Epidemiological characteristics and Clinical manifestations. J Clin Diagn Res. 2008;2:969-72.
  • 30.
    Sardarian K, Taherkhani H. Blastocystosis Pathogenecity With Methronidazole Effect Approach. J Guilan Univ Med Sci. 2002.
  • 31.
    Jones MS, Whipps CM, Ganac RD, Hudson NR, Boorom K. Association of Blastocystis subtype 3 and 1 with patients from an Oregon community presenting with chronic gastrointestinal illness. Parasitol Res. 2009;104 (2):341-5;104(2):341-5. [PubMed ID: 18923844]. https://doi.org/10.1007/s00436-008-1198-7.
  • 32.
    Mirza H, Tan KS. Blastocystis exhibits inter- and intra-subtype variation in cysteine protease activity. Parasitol Res. 2009;104(2):355-61. [PubMed ID: 18846388]. https://doi.org/10.1007/s00436-008-1203-1.
  • 33.
    Dogruman-Al F, Kustimur S, Yoshikawa H, Tuncer C, Simsek Z, Tanyuksel M, et al. Blastocystis subtypes in irritable bowel syndrome and inflammatory bowel disease in Ankara, Turkey. Mem Inst Oswaldo Cruz. 2009;104(5):724-7. https://doi.org/10.1590/S0074-02762009000500011.
  • 34.
    Nagel R, Cuttell L, Stensvold CR, Mills PC, Bielefeldt-Ohmann H, Traub RJ. Blastocystis Subtypes in Symptomatic and Asymptomatic Family Members and Pets and Response to Therapy. Int Med J. 2011. [PubMed ID: 22032439]. https://doi.org/10.1111/j.1445-5994.2011.02626.x.
  • 35.
    Tan TC, Suresh KG, Smith HV. Phenotypic and genotypic characterisation of Blastocystis hominis isolates implicates subtype 3 as a subtype with pathogenic potential. Parasitol Res. 2008;104(1):85-93. [PubMed ID: 18795333]. https://doi.org/10.1007/s00436-008-1163-5.
  • 36.
    Kaneda Y, Horiki N, Cheng XJ, Fujita Y, Maruyama M, Tachibana H. Ribodemes of Blastocystis hominis isolated in Japan. Am J Trop Med Hyg. 2001;65(4):393-6. [PubMed ID: 11693890].
  • 37.
    Stensvold CR, Alfellani MA, Norskov-Lauritsen S, Prip K, Victory EL, Maddox C, et al. Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. Int J Parasitol. 2009;39(4):473-9. [PubMed ID: 18755193]. https://doi.org/10.1016/j.ijpara.2008.07.006.
  • 38.
    Sun T, Katz S, Tanenbaum B, Schenone C. Questionable clinical significance of Blastocystis hominis infection. Am J Gastroenterol. 1989;84(12):1543-7. [PubMed ID: 2596457].
  • 39.
    Yoshikawa H, Wu Z, Pandey K, Pandey BD, Sherchand JB, Yanagi T, et al. Molecular characterization of Blastocystis isolates from children and rhesus monkeys in Kathmandu, Nepal. Vet Parasitol. 2009;160(3-4):295-300. [PubMed ID: 19136214]. https://doi.org/10.1016/j.vetpar.2008.11.029.
  • 40.
    Dominguez-Marquez MV, Guna R, Munoz C, Gomez-Munoz MT, Borras R. High prevalence of subtype 4 among isolates of Blastocystis hominis from symptomatic patients of a health district of Valencia (Spain). Parasitol Res. 2009;105(4):949-55. [PubMed ID: 19471964]. https://doi.org/10.1007/s00436-009-1485-y.
  • 41.
    Ozyurt M, Kurt O, Molbak K, Nielsen HV, Haznedaroglu T, Stensvold CR. Molecular epidemiology of Blastocystis infections in Turkey. Parasitol Int. 2008;57(3):300-6. [PubMed ID: 18337161]. https://doi.org/10.1016/j.parint.2008.01.004.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles