Relationship Between Drug Resistance and cagA Gene in Helicobacter pylori

Author(s):
Reza GhotaslouReza Ghotaslou1, 2, Morteza MilaniMorteza Milani1, 3,*, Mohammad Taghi AkhiMohammad Taghi Akhi2, Mohammad Saeid HejaziMohammad Saeid Hejazi4, Mohammad Reza NahaeiMohammad Reza Nahaei5, Alka HasaniAlka Hasani2, Yaeghob SharifiYaeghob Sharifi6
1Liver and Gastroenterology Diseases Research Center, Tabriz University of Medical Sciences, Tabriz, IR Iran
2Department of Microbiology, School of Medicine, Tabriz University of Medical Sciences, Tabriz, IR Iran
3School of Advanced Medicine, Tabriz University of Medical Sciences, Tabriz, IR Iran
4Department of Pharmaceutical Biotechnology, School of Pharmacy, Tabriz University of Medical Sciences, Tabriz, IR Iran
5Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, IR Iran
6Department of Microbiology, Faculty of Medicine, Urmia University of Medical Sciences, Urmia, IR Iran

Jundishapur Journal of Microbiology:Vol. 6, issue 10; e8480
Published online:Dec 01, 2013
Article type:Research Article
Received:Oct 08, 2012
Accepted:Feb 17, 2013
How to Cite:Ghotaslou R, Milani M, Akhi MT, Hejazi MS, Nahaei MR, et al. Relationship Between Drug Resistance and cagA Gene in Helicobacter pylori. Jundishapur J Microbiol. 2013;6(10):e8480. doi: https://doi.org/10.5812/jjm.8480

Abstract

Background:

Currently, there are evidences for the existence of diverse strains of Helicobacter pylori with different levels of virulence. In other way, the most important reason of therapeutic failure is resistance to the antibiotics.

Objectives:

The aim of this study was to evaluate the relationship between H. pylori drug resistance and the presence of cagA gene.

Patients and Methods:

Gastric biopsy specimens were cultured for H. pylori isolation. Resistance to antimicrobial agents, including clarithromycin, metronidazole, and amoxicillin were detected by modified disk agar diffusion tests. The cagA gene was detected using PCR, and the results were analyzed by χ2 and Fishers exact tests using SPSS software version 16.

Results:

A total of 123 H. pylori-positive patients (68 males, 55 females, mean age 35 ± 18 years old) were studied. The rate of resistance to clarithromycin, metronidazole and amoxicillin were 17.07, 78.86 and 27.64%, respectively. In this study, the cagA was detected in 84 of 123 strains (68.3%). The frequency of resistance to clarithromycin, metronidazole and amoxicillin in cagA positive confirmed microorganisms were, 16 (13.01%), 67 (54.47%) and 24 (19.51%), respectively. While the results for cagA negative ones were 5 (4.06%), 30 (24.39%) and 10 (8.13%), respectively.

Conclusions:

Our results indicated that the overall antibiotic resistance of H. pylori was high, and the relationship between drug resistance and cagA status was not statistically significant. Therefore, different treatment regimens are not recommended for patients with H. pylori- cagA positive infections.

1. Background

Helicobacter pylori (H. pylori) is a microaerophilic spiral-shaped Gram-negative bacterium, which is found in the gastric mucous layer or adherent to the epithelial lining of the stomach (1). The prevalence of H. pylori infection is reported as approximately 50%, worldwide, which is as high as 80%-90% in developing countries (2). Although most infected persons remain asymptomatic, but 15-20% of H. pylori- positive individuals will develop the associated diseases. The occurrence of diverse diseases as peptic ulcer, gastric cancer and MALT lymphoma with H. pylori depends on specific features of the organism, host genetic and environmental factors (3).
H. pylori express the virulence factors that augment the risk of clinical disease outcomes. The virulence factor that has attracted most of the interests is the cytotoxin-associated gene A (cagA), which encodes the CagA protein and the cellular effects of CagA may clarify why patients infected with cagA strains, usually have higher inflammatory responses and level of proinflammatory cytokines. Thus, these gastric mucosal responses induce the peptic ulcer diseases, precancerous lesions, and cancer in adults (4). Approximately 60% of H. pylori strains isolated in Western countries carry cag pathogenesity island (cag PAI), whereas almost all of the isolates from East Asia are cag PAI-positive (5).
The Maastricht Ⅲ consensus advised that proton pump inhibitors (PPI), plus clarithromycin, amoxicillin or metronidazole therapy for 7 to 14 days as the first choice for H. pylori infection management (6). Recently, several large clinical trials and meta-analyses have shown that the eradication of the standard triple therapy has generally declined to unacceptable levels (i.e., 80% or less) (7). Resistance to antibiotics is the chief factor for treatment failure (2). In other way, results of some studies have suggested that the eradication rate in patients with gastritis is lower than that the patients with peptic ulcer diseases (8). Since the worldwide increase of the drug resistance rates represents a problem of relevance, some researches have been conducted on antibiotic resistance relationship with bacterial genetic factors (9, 10). If harboring cagA affects the response rate of therapy, then it may be possible to anticipate H. pylori eradication rates.

2. Objectives

The aim of this research was to analyze the relationship between the antibiotic resistance and cagA presence in H. pylori isolates

3. Patients and Methods

3.1. Patients

One hundred and twenty three H. pylori isolates were recovered from gastric biopsy samples of patients with gastritis, peptic ulcer and gastroesophageal reflux diseases underwent endoscopy in Azerbaijan, Iran. At least 1 week prior to endoscopy the patients had stopped receiving antimicrobial agent.

3.2. Bacterial Isolates

For bacterial culture, the gastric biopsy samples were homogenized and cultured onto the Brucella agar (Pronadisa Co, Spain) containing 5% sheep blood and antibiotics supplement (vancomycin 6 µg/mL, amphotricin B 2.5 µg/mL and trimethoprim 20 µg/mL). The cultured plates were incubated under microaerophilic condition (Mart, Anoxomat, Lichtenvoorde, Netherlands O2 5%, CO2 10%) at 37°C with high humidity for 5 - 7 days. H. pylori was detected based on colony morphology, by Gram staining and positive oxidase, catalase and urease tests.

3.3. Antibiotic Susceptibility Tests

Antimicrobial susceptibility of H. pylori isolates were determined by modified disk agar diffusion test. Suspensions of 3-day old cultures were prepared in sterile normal saline to match with No. 4 McFarland standard (11). The disks of antibiotics (MAST Co., England) including clarithromycin (15 µg), amoxicillin (25 µg), and metronidazole (5 µg) were placed on the inoculated plates and incubated for 72 hours. The inhibition zones were interpreted as previously reported (12).

3.4. DNA Extraction

Genomic DNA was extracted with the CTAB reagent method (13). The extracted DNA eluted in 50 μL of 1 × TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) and stored at -20°C until use.

3.5. Assessment of cagA and glmM Genes by Multiplex PCR

Primer sequences (Table 1) and conditions of PCR amplifications of the glmM gene for the detection and confirmation of H. pylori and the cagA virulent gene were designed based on previous studies ( 14 , 15 ). Briefly, each PCR was performed in a total volume of 50 µL containing 100 ng H. pylori genomic DNA, 0.2 µL of dNTP (10mM), 0.2 µL PCR buffer (1X), 0.1µL mgcl2 (1.5 mM), 0.2 µL of each primer and 1.5 µL of Taq polymerase (500U). The PCR was carried out in an automated thermal cycler (Eppendorf, Germany). After amplification, 10 µL of PCR product was electrophoresed onto 1.5% agarose gel stained with ethidium bromide and later visualized under UV illuminator.
Table 1.The Primer Sequences Used in the Study
GenePrimerNucleotide SequenceSize (bp)
ureC (glmM)HP-FGGATAAGCTTTTAGGGGTGTTAGGGG294
HP-RGCTTACTTTCTAACACTAACGCGC
cagAcagA-FmAGGGATAACAGGCAAGCTTTTGA352
cagA-RmCTGCAAAAGATTGTTTGGCAGA

3.6. Statistical Analysis

The correlations between the H. pylori-cagA genotype and antibiotic susceptibilities were analyzed using χ 2 test or Fishers exact test. A P value less than 0.05 was considered as statistically significant.

4. Results

The mean age of the patients was 35 ± 18 years. Out of 123 H. pylori isolates, 99 isolates were collected from adults, and 24 isolates from children. Overall, the rate of resistance to clarithromycin, metronidazole and amoxicillin were 17.07, 78.86 and 27.64%, respectively. Resistance to both metronidazole and clarithromycin were detected in 13% (n = 16). Of interest, 10 isolates (8.13%) were resistant to all antibiotics (clarithromycin, metronidazole and amoxicillin). The cagA gene was detected in 84 strains (68.3%) (Figure 1). The distribution of the cagA gene was the same in both genders and age groups (73% children and 68% adults, 68.6% male and 68.8% female).
Lanes 1 and 2: patients 2 and 3 that were glmM and cagA positive, Lane 3: a patient sample with cagA negative and glmM positive, Lane 4: positive control, Lane 5: negative control, Lane 6: 100 bp DNA ladder.
Figure 1.

Lanes 1 and 2: patients 2 and 3 that were glmM and cagA positive, Lane 3: a patient sample with cagA negative and glmM positive, Lane 4: positive control, Lane 5: negative control, Lane 6: 100 bp DNA ladder.

The presence of cagA observed more likely in patients with peptic ulcer diseases (80%) than in non-ulcer dyspepsia ones (65%), and the difference was statistically significant (P value ≤ 0.05). The frequency of resistance to clarithromycin, metronidazole and amoxicillin in H. pylori - cagA positive were, 16 (13.01%), 67 (54.47%) and 24 (19.51%), respectively. While the frequency of resistance to these antibiotics in H. pylori - cagA negative were 5 (4.06%), 30 (24.39%) and 10 (8.13%), respectively. The distribution of cagA in different groups of gastroduodenal diseases and antibiotic resistance are demonstrated in Table 2.
Table 2.Distribution of cagA in 123 H. pylori Strains Based on Diseases and Antibiotics Susceptibility Patterns
 cagA- Positive, No. (%)cagA- Negative, No. (%)Total, No.
Peptic ulcer diseases16 (80)4 (20)20
Non ulcer dyspepsia 54 (65)29 (34.9)83
Am Resistancea24 (19.51)10 (8.13)34
Cl Resistancea16 (13.01)5 (4.06)21
Met Resistancea67 (54.47)30 (24.39)97

a Abbreviations: Am, amoxicillin; Cl, clarithromycin; Met, metronidazole

5. Discussion

The three main antibiotics that are used as first-line eradication regimens against H. pylori are clarithromycin, metronidazole and amoxicillin (16, 17). However, H. pylori resistance to antimicrobials agents is the main cause of treatment failure (18). The level of resistance varies between different geographical regions and unfortunately, which is increasing worldwide. This study showed that the rate of resistance to metronidazole is high (78.86%). In developed countries, metronidazole resistance ranges from 10 to 50% while in developing counties, higher rate of resistance are reported (19). This is may be related to the greater consumption of this drug (2). In the case of clarithromycin, the second most commonly used antibiotic in H. pylori management, we found resistance rate as 17.07%. However, in Asian countries, a higher clarithromycin resistance rate has been reported in Japan (40.7%) while, the lowest value has been observed in Malaysia (2.1 %) (18). In North America, clarithromycin resistance ranges from 2.5 - 12.2 % (20).
In this research, the amoxicillin resistance was found in 27.64% of isolates. Until now, the resistance to amoxicillin in H. pylori was reported to be very rare; but have now been reported in USA (21), Italy (22), Brazil (23) and Iran (2, 24). Multiple drug resistance is a major problem worldwide. In the present study, we remarkably observed double resistance to clarithromycin and metronidazole and triple resistance to clarithromycin, metronidazole and amoxicillin. Pretreatment H. pylori antibiotic resistance has been reported to compromise the efficacy of management. For example, therapy regimens containing metronidazole and clarithromycin fail in as many as 38% and 55% of cases, respectively, when used to treat infection with an organism non-susceptible to one of these antimicrobial agents (17).
There are new facts about the existence of various strains of H. pylori with different levels of virulence (1, 3, 8, 25-27). The cagA gene is located at one end of a 40-kilobase DNA section called cag pathogenicity island (cag PAI) (28, 29). The clinical relevance of the putative virulence- associated genes of H. pylori and geographical region is still a subject of controversy (28). The prevalence of cagA-positive H. pylori strains varies from one geographic region to another (29). In this research such as the study from Isfahan- Iran (30), the prevalence of cagA-positive H. pylori strains was 68.3% which is more similar to the findings reported from Western countries (18, 27) and Brazil (31) than those reported from East or Southeast Asia (14, 28, 32). The presence of the cagA gene is thought to be associated with a further severe clinical outcome of the disease (3, 27, 33-35). The current study demonstrated the high prevalence of H. pylori infection containing cag A‏ in patients from Azerbaijan with peptic ulcer disease than non-ulcer dyspepsia (Pv 0.02). Reports from Turkey (3) and Iraq (36) have shown similar results to our findings. Due to the allelic variation in cagA the H. pylori subtypes can circulate in different regions, the differences in cagA subtype might be a marker for different virulence among cagA positive H. pylori strains (32).
Furthermore, the severity of gastric inflammation and the pathology also affect the outcome of therapy (8, 9). There is now increasing evidences that cagA-positive strains induce an enhanced inflammatory response, mucosal damage and significantly delays healing of ulcers (1, 8). In this study, the rate of resistance to antibiotics in H. pylori- cagA positive were higher than cagA negative ones, however no statistically significant difference was found (P value > 0.05). Similarly, some studies also failed to find any general association between virulence markers and antibiotic resistance (18, 22, 37). This result is inconsistent with other studies that suggesting the statistically relation between drug resistance and cagA-positive strains (27, 31, 38, 39). There is little information about the relation between the variability of the strain and any outcome on the drug resistance rates of H. pylori. At the molecular level, there is no hypothetical basis for predicting an association between drug resistance and genotype; as such loci show to be neither physically nor functionally linked by genome organization (40).
Our research had some limitations. The studied population was not large enough, and our results need to be confirmed by studies on great number of patients. This study only tested the hypothesis that the cagA gene is related to antibiotic resistance. We think additional genetic or environmental factors might influence the interaction of H. pylori and antibiotics. In conclusion, the prevalence of H. pylori resistance is high in this area. Our results indicated that the relationship between drug resistance and the availability of cagA gene was not statistically significant. So, different treatment regimens are not recommended for patients with H. pylori- cagA positive infection.

Acknowledgments

Footnotes

References

  • 1.
    Algood HM, Cover TL. Helicobacter pylori persistence: an overview of interactions between H. pylori and host immune defenses. Clin Microbiol Rev. 2006;19(4):597-613. [PubMed ID: 17041136]. https://doi.org/10.1128/CMR.00006-06.
  • 2.
    Rafeey M, Ghotaslou R, Nikvash S, Hafez AA. Primary resistance in Helicobacter pylori isolated in children from Iran. J Infect Chemother. 2007;13(5):291-5. [PubMed ID: 17982716]. https://doi.org/10.1007/s10156-007-0543-6.
  • 3.
    Erzin Y, Koksal V, Altun S, Dobrucali A, Aslan M, Erdamar S, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2 genotypes and correlation with clinical outcome in Turkish patients with dyspepsia. Helicobacter. 2006;11(6):574-80. [PubMed ID: 17083380]. https://doi.org/10.1111/j.1523-5378.2006.00461.x.
  • 4.
    Rick JR, Goldman M, Semino-Mora C, Liu H, Olsen C, Rueda-Pedraza E, et al. In situ expression of cagA and risk of gastroduodenal disease in Helicobacter pylori-infected children. J Pediatr Gastroenterol Nutr. 2010;50(2):167-72. [PubMed ID: 20038850]. https://doi.org/10.1097/MPG.0b013e3181bab326.
  • 5.
    Hatakeyama M, Higashi H. Helicobacter pylori CagA: a new paradigm for bacterial carcinogenesis. Cancer Sci. 2005;96(12):835-43. [PubMed ID: 16367902]. https://doi.org/10.1111/j.1349-7006.2005.00130.x.
  • 6.
    Malfertheiner P, Megraud F, O'Morain C, Bazzoli F, El-Omar E, Graham D, et al. Current concepts in the management of Helicobacter pylori infection: the Maastricht III Consensus Report. Gut. 2007;56(6):772-81. [PubMed ID: 17170018]. https://doi.org/10.1136/gut.2006.101634.
  • 7.
    Chuah SK, Tsay FW, Hsu PI, Wu DC. A new look at anti-Helicobacter pylori therapy. World J Gastroenterol. 2011;17(35):3971-5. [PubMed ID: 22046084]. https://doi.org/10.3748/wjg.v17.i35.3971.
  • 8.
    van Doorn LJ, Schneeberger PM, Nouhan N, Plaisier AP, Quint WG, de Boer WA. Importance of Helicobacter pylori cagA and vacA status for the efficacy of antibiotic treatment. Gut. 2000;46(3):321-6. [PubMed ID: 10673291].
  • 9.
    Agudo S, Perez-Perez G, Alarcon T, Lopez-Brea M. High prevalence of clarithromycin-resistant Helicobacter pylori strains and risk factors associated with resistance in Madrid, Spain. J Clin Microbiol. 2010;48(10):3703-7. [PubMed ID: 20668128]. https://doi.org/10.1128/JCM.00144-10.
  • 10.
    Ryan KA, van Doorn LJ, Moran AP, Glennon M, Smith T, Maher M. Evaluation of clarithromycin resistance and cagA and vacA genotyping of Helicobacter pylori strains from the west of Ireland using line probe assays. J Clin Microbiol. 2001;39(5):1978-80. [PubMed ID: 11326028]. https://doi.org/10.1128/JCM.39.5.1978-1980.2001.
  • 11.
    McNulty C, Owen R, Tompkins D, Hawtin P, McColl K, Price A, et al. Helicobacter pylori susceptibility testing by disc diffusion. J Antimicrob Chemother. 2002;49(4):601-9. [PubMed ID: 11909833].
  • 12.
    Boyanova L, Stancheva I, Spassova Z, Katzarov N, Mitov I, Koumanova R. Primary and combined resistance to four antimicrobial agents in Helicobacter pylori in Sofia, Bulgaria. J Med Microbiol. 2000;49(5):415-8. [PubMed ID: 10798553].
  • 13.
    Sambrook Joseph, Russell David W, Russell David W. Molecular cloning: a laboratory manual (3-volume set). 2001.
  • 14.
    Ko JS, Kim KM, Oh YL, Seo JK. cagA, vacA, and iceA genotypes of Helicobacter pylori in Korean children. Pediatr Int. 2008;50(5):628-31. [PubMed ID: 19261108]. https://doi.org/10.1111/j.1442-200X.2008.02641.x.
  • 15.
    Podzorski Raymond P, Podzorski Diane S, Wuerth Ann, Tolia Vasundhara. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagnos Microbiol Infect Dis. 2003;46(2):83-88. https://doi.org/10.1016/s0732-8893(03)00034-8.
  • 16.
    Basset C, Holton J, Gatta L, Ricci C, Bernabucci V, Liuzzi G, et al. Helicobacter pylori infection: anything new should we know? Aliment Pharmacol Ther. 2004;20 Suppl 2:31-41. [PubMed ID: 15335411]. https://doi.org/10.1111/j.1365-2036.2004.02040.x.
  • 17.
    Duck WM, Sobel J, Pruckler JM, Song Q, Swerdlow D, Friedman C, et al. Antimicrobial resistance incidence and risk factors among Helicobacter pylori-infected persons, United States. Emerg Infect Dis. 2004;10(6):1088-94. [PubMed ID: 15207062]. https://doi.org/10.3201/eid1006.030744.
  • 18.
    De Francesco V, Margiotta M, Zullo A, Hassan C, Valle ND, Burattini O, et al. Claritromycin resistance and Helicobacter pylori genotypes in Italy. J Microbiol. 2006;44(6):660-4. [PubMed ID: 17205045].
  • 19.
    Prazeres Magalhaes P, De Magalhaes Queiroz DM, Campos Barbosa DV, Aguiar Rocha G, Nogueira Mendes E, Santos A, et al. Helicobacter pylori primary resistance to metronidazole and clarithromycin in Brazil. Antimicrob Agents Chemother. 2002;46(6):2021-3. [PubMed ID: 12019131].
  • 20.
    Megraud F. H pylori antibiotic resistance: prevalence, importance, and advances in testing. Gut. 2004;53(9):1374-84. [PubMed ID: 15306603]. https://doi.org/10.1136/gut.2003.022111.
  • 21.
    Dore MP, Piana A, Carta M, Atzei A, Are BM, Mura I, et al. Amoxycillin resistance is one reason for failure of amoxycillin-omeprazole treatment of Helicobacter pylori infection. Aliment Pharmacol Ther. 1998;12(7):635-9. [PubMed ID: 9701526].
  • 22.
    Godoy AP, Ribeiro ML, Benvengo YH, Vitiello L, Miranda Mde C, Mendonca S, et al. Analysis of antimicrobial susceptibility and virulence factors in Helicobacter pylori clinical isolates. BMC Gastroenterol. 2003;3:20. [PubMed ID: 12911839]. https://doi.org/10.1186/1471-230X-3-20.
  • 23.
    Mendonca S, Ecclissato C, Sartori MS, Godoy AP, Guerzoni RA, Degger M, et al. Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxicillin, tetracycline, and furazolidone in Brazil. Helicobacter. 2000;5(2):79-83. [PubMed ID: 10849055].
  • 24.
    Milani Morteza, Ghotaslou Reza, Akhi Mohammad T, Nahaei Mohammad R, Hasani Alka, Somi Mohammad H, et al. The status of antimicrobial resistance of Helicobacter pylori in Eastern Azerbaijan, Iran: comparative study according to demographics. J Infect Chemother. 2012;18(6):848-852.
  • 25.
    Agudo S, Alarcon T, Cibrelus L, Urruzuno P, Martinez MJ, Lopez-Brea M. [High percentage of clarithromycin and metronidazole resistance in Helicobacter pylori clinical isolates obtained from Spanish children]. Rev Esp Quimioter. 2009;22(2):88-92. [PubMed ID: 19544100].
  • 26.
    Lobo Gatti L, Agostinho Jn F, De Labio R, Balbo Piason F, Carlos Da Silva L, Fagundez De Queiroz V, et al. Helicobacter pylori and cagA and vacA gene status in children from Brazil with chronic gastritis. Clin Exp Med. 2003;3(3):166-72. [PubMed ID: 14648232]. https://doi.org/10.1007/s10238-003-0021-0.
  • 27.
    Taneike I, Nami A, O'Connor A, Fitzgerald N, Murphy P, Qasim A, et al. Analysis of drug resistance and virulence-factor genotype of Irish Helicobacter pylori strains: is there any relationship between resistance to metronidazole and cagA status? Aliment Pharmacol Ther. 2009;30(7):784-90. [PubMed ID: 19604178]. https://doi.org/10.1111/j.1365-2036.2009.04095.x.
  • 28.
    Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(1):30-6. [PubMed ID: 17548220]. https://doi.org/10.1016/j.ijid.2007.03.012.
  • 29.
    Ortiz-Princz Diana, Guariglia-Oropeza Verónica, Ávila Maira, Correnti María, Perrone Marianella, Gutierrez Beatriz, et al. Helicobacter pylori cagA and vacA genotypes in Cuban and Venezuelan populations. Memórias do Instituto Oswaldo Cruz. 2010;105(3):331-335. https://doi.org/10.1590/s0074-02762010000300016.
  • 30.
    Ghasemian SH, Tavakoli H, Mojtahed JF, Salehi Rasoul SB, Pishva E. Correlation of cagA positive Helicobacter pylori Infection with clinical outcomes in Alzahra hospital, Isfahan, Iran. J Res Med Sci. 2008;13(4):196-201.
  • 31.
    Garcia Gabriella T, Aranda Katia RS, Gonçalves Manoel EP, Cardoso Silvia R, Iriya Kiyoshi, Silva Neusa P, et al. High prevalence of clarithromycin resistance and cagA, vacA, iceA2, and babA2 genotypes of Helicobacter pylori in Brazilian children. J Clin Microbiol. 2010;48(11):4266-4268.
  • 32.
    Tao R, Fang PC, Liu HY, Jiang YS, Chen J. A new subtype of 3' region of cagA gene in Helicobacter pylori strains isolated from Zhejiang Province in China. World J Gastroenterol. 2004;10(22):3284-8. [PubMed ID: 15484301].
  • 33.
    Basso D, Zambon CF, Letley DP, Stranges A, Marchet A, Rhead JL, et al. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology. 2008;135(1):91-9. [PubMed ID: 18474244]. https://doi.org/10.1053/j.gastro.2008.03.041.
  • 34.
    Broutet N, Marais A, Lamouliatte H, de Mascarel A, Samoyeau R, Salamon R, et al. cagA Status and eradication treatment outcome of anti-Helicobacter pylori triple therapies in patients with nonulcer dyspepsia. J Clin Microbiol. 2001;39(4):1319-22. [PubMed ID: 11283049]. https://doi.org/10.1128/JCM.39.4.1319-1322.2001.
  • 35.
    Karhukorpi J, Yan Y, Kolho KL, Rautelin H, Lahti M, Sirvio A, et al. cagA, vacA and iceA virulence genes of Helicobacter pylori isolates of children in Finland. Eur J Clin Microbiol Infect Dis. 2000;19(10):790-3. [PubMed ID: 11117646].
  • 36.
    Hussein NR, Mohammadi M, Talebkhan Y, Doraghi M, Letley DP, Muhammad MK, et al. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J Clin Microbiol. 2008;46(5):1774-9. [PubMed ID: 18353934]. https://doi.org/10.1128/JCM.01737-07.
  • 37.
    Elviss NC, Owen RJ, Breathnach A, Palmer C, Shetty N. Helicobacter pylori antibiotic-resistance patterns and risk factors in adult dyspeptic patients from ethnically diverse populations in central and south London during 2000. J Med Microbiol. 2005;54(Pt 6):567-74. [PubMed ID: 15888466]. https://doi.org/10.1099/jmm.0.45896-0.
  • 38.
    Mirodzhov GK, Ishankulova DM, Dustov AD. [The frequency and resistance of cytotoxin-associated (CAG-A) Helicobacter pylori strains to antibacterial agents in chronic gastritis and duodenal ulcer]. Clin Med (Mosk). 2006;84(5):51-4.
  • 39.
    Saruc M, Goksel G, Ozkaya S, Guclu F, Ozbakkaloglu B, Yuceyar H. The effect of CagA status on response to Helicobacter pylori eradication therapy in Western Turkey. Braz J Med Biol Res. 2001;34(11):1435-9. [PubMed ID: 11668353].
  • 40.
    Elviss NC, Owen RJ, Xerry J, Walker AM, Davies K. Helicobacter pylori antibiotic resistance patterns and genotypes in adult dyspeptic patients from a regional population in North Wales. J Antimicrob Chemother. 2004;54(2):435-40. [PubMed ID: 15243025]. https://doi.org/10.1093/jac/dkh343.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles