Logo

Characterization of Leptospira interrogans Serovars by Polymorphism Variable Number Tandem Repeat Analysis

Author(s):
Sama RezasoltaniSama Rezasoltani1,*, Hossein DabiriHossein Dabiri2, Pejvak KhakiPejvak Khaki3, Mohammad Rostami NejadMohammad Rostami Nejad4, Nasim KarimnasabNasim Karimnasab5, Shiva ModirroustaShiva Modirrousta6
1Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, IR Iran
2Department of Medical Microbiology, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
3Department of Microbiology, Razi Vaccine and Serum Institute, Karaj, IR Iran
4Department of Celiac Disease, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
5Department of Microbiology, Faculty of Basic Sciences, Karaj Branch, Islamic Azad University, Karaj, IR Iran
6Department of Microbiology, Faculty of Basic Sciences, Zanjan Branch, Islamic Azad University, Zanjan, IR Iran

Jundishapur Journal of Microbiology:Vol. 8, issue 10; e22819
Published online:Oct 18, 2015
Article type:Research Article
Received:Aug 16, 2014
Accepted:Feb 16, 2015
How to Cite:Sama Rezasoltani, Hossein Dabiri, Pejvak Khaki, Mohammad Rostami Nejad, Nasim Karimnasab, et al. Characterization of Leptospira interrogans Serovars by Polymorphism Variable Number Tandem Repeat Analysis.Jundishapur J Microbiol.2015;8(10):e22819.https://doi.org/10.5812/jjm.22819.

Abstract

Background:

Leptospirosis is recognized as a re-emerging infectious disease; therefore, understanding the epidemiology of the disease is vital for designing intervention programs and diminishing its transmission. Recently, Multilocus variable number tandem repeat analysis (MLVA) is used for segregating and identifying Leptospira serovars. The method has potential application in investigating the molecular epidemiology of Leptospira.

Objectives:

The propose of this study was genomic identification of pathogenic Leptospires in Iran by MLVA.

Materials and Methods:

Leptospira serovars were obtained from National Reference Laboratory of Leptospira at Razi Vaccine and Serum Research Institute, Karaj, Iran. Serovars were cultured into the liquid EMJH medium and incubated at 28˚C for 7 days. DNA of serovars was extracted using the phenol-chloroform method. PCR was performed with 5 selected variable number tandem repeat analysis (VNTR) loci. The amplified products were analyzed by agarose gel electrophoresis. The size of the amplified products was estimated by 100 bp ladder and sequencing analysis.

Results:

The saprophytic serovar showed no amplified fragments. PCR products in all pathogenic serovars were observed. The 12 reference serovars used for the development of technique displayed distinct patterns.

Conclusions:

Results showed that MLVA technique with its range of polymorphism is a good marker for identification of pathogenic serovars. Some VNTR loci are more powerful than the other ones with regard to differentiation. Serovars from the same geographical area have more genetic similarity than same serovars from different places. MLVA is a suitable technique for epidemiological survey.

1. Background

Leptospirosis occurs both in developing and industrialized countries. Wild and domestic animals are important carriers of the disease (1). Today, leptospirosis is recognized as a re-emerging infectious disease; therefore, understanding its epidemiology is a vital issue for designing intervention programs and diminishing its transmission. The disease has peak incidence during rainy seasons in warm climate regions and in summer or fall in temperate regions (2, 3). The first leptospirosis outbreak was reported in Iran by Tahbaz (4). Examination of leptospirosis in livestock around Tehran in 1992 revealed dominant serovars of Leptospira interrogans as Hardjo, Tarasovi, Grippotyphosa, Pomona, and Icterohaemorrhagia. On the other hand, the most serovars isolated from humans and cattle throughout Iran in the last 5 years were Grippotyphosa, Canicola, Hardjo, and Icterohaemorrhagia that were identified by Razi Institute Researchers (5).

Identification of Leptospira species has been conventionally performed by cultural and serological methods. These methods are tedious, time consuming, and potentially biohazardous. For example in microagglutination test, live cultures of strains must be kept for use for their antigens, therefore laboratory facilities are required. Besides, the results are difficult to standardize and need a biologist to operate the microscope. Above all, cross-reactions occur between serogroups, that makes the interpretation of the results complicated (6). Recently, other molecular methods such as pulse field gel electrophoresis (PFGE) and arbitrarily primed PCR (AP-PCR), restriction fragment length polymorphism (RFLP), multilocus variable number tandem repeat analysis (MLVA) are introduced (7-11). MLVA method provides useful tools in detection and identification of Leptospira serovars and gives information relating to both the evolutionary and functional areas of bacterial diversity. Leptospiral genomes contain multiple loci of repetitive DNA, which may be variable among serovars with respect to their individual primary structure or number of repeat units present. The variation in the number of repeats arise from slipped strand mispairing as proposed for other short sequence repeats (12).

2. Objectives

The aim of this study was genomic identification of pathogenic Leptospires in Iran by multilocus variable-number tandem-repeat analysis.

3. Materials and Methods

3.1. Bacterial Serovars and Culture Conditions

Leptospira interrogans serovars (Table 1) were obtained from Leptospira Reference laboratory of Microbiology Department, Razi Vaccine and Serum Research Institute, Karaj, Iran. These serovars were isolated from humans and cattle during last year and maintained in the institute. Leptospira serovars were grown in EMJH liquid medium (Difco) at 28˚C for up to 3 weeks to reach the stationary phase (13, 14).

Table 1.Leptospira interrogans Serovars Investigated in the Current Study a
RTCC No.SpeciesSerogroupSerovarStrainAbbreviation
2802L. inerrogansAutumnalisAutumnalisAkiyami AAut
2805L. inerrogansCanicolaCanicolaHond Utrecht IVCh1
2808L. inerrogansGrippotyphosaGrippotyphosaMoskavaG1
2810L. interrogansSejroeHardjoHardjo bovisSh1
2812L. inerrogansIcterohaemorrhagiaIcterohaemorrhagiaVerdumIct1
2815L. inerrogansPomonaPomonaPomonaPo1
2817L. inerrogansSejroeSerjae serjaeM84Ser
2819L. biflexaSemarangaPatocPatoc1Pat
2821L. interrogansSejroeHardjoHardjo-prajitnoSh2
2822L. inerrogansPomonaPomonaUT364Po2
2823L. inerrogansIcterohaemorrhagiaIcterohaemorrhagiaRGAIct2
2824L. inerrogansCanicolaCanicolaFiocruz LV133Ch2
2825L. inerrogansGrippotyphosaGrippotyphosaAndamanG2

Leptospira interrogans Serovars Investigated in the Current Study a

3.2. VNTR Primer Selection

MLVA serovar typing was performed with the VNTR4 primer designed and used by Salaun et al. (14); VNTR7 and VNTR10 described by Majed et al. (13); VNTR8 and VNTR29 defined by Slack et al. (15) (Table 2).

Table 2. PCR Primers and Their References Used in This Study
VNTR LocusSequences 5’→3’Reference
VNTR414
Forward(AAGTAAAAGCGCTCCCAAGA)
Reverse(ATAAAGGAAGCTCGGCGTTT)
VNTR 713
Forward(TCATCTGCTCCGGAGATTCG)
Reverse(TCCCTCCACAGGTTGTCTTG)
VNTR1013
Forward(TCCAAAATTCAGCCCTCAAG)
Reverse(GACGCTTGGCATTTGTATCC)
VNTR815
Forward(CAAGTGTTCGACAAGAATGAG)
Reverse(CTCACCGGTAGAACGCTTCTTTT)
VNTR2915
Forward(ATCGTTTTGGCAGTTTTTGCT)
Reverse(CTAGAAAATTCCGCGTAGGG)

PCR Primers and Their References Used in This Study

3.3. DNA Extraction and PCR

The genomic DNA of Leptospira was extracted by phenol-chloroform method (Merck, Germany). The final volume (25 µL) of each reaction mixture contained 2.5 µL of 1X PCR buffer (SinaClone, Iran), 0.5 mM of 10 mM deoxynucleoside triphosphate (SinaClone, Iran), 1 µM of 10 pmol each corresponding primer, 0.75 of 50 mM MgCl2 (SinaClone, Iran), 0.3 unit/µL of 0.5 unit Taq DNA polymerase (SinaClone, Iran) and 1 µL of 100 macro gram DNA template. Amplification was achieved under the following conditions: 1 denaturation cycle at 93˚C for 5 minutes; 35 cycles of denaturation at 93˚C for 1 minute, annealing at 54˚C for 1 minute, elongation at 72˚C for 1 minute, and a final elongation at 72˚C for 10 minutes (14). The amplified products were analyzed by 2% agarose gel electrophoresis and allelic sizes estimated by Quantity One 1-D analysis software package (Bio-Rad, USA). The size of the amplified products was estimated by comparison with a 100 bp plus ladder (15, 16). Some of the amplified products were sequenced by Macrogene Company in South Korea.

3.4. Sequence Analysis

The copy number of repeats of each VNTR locus was deduced from sequencing data and sizes of the amplified products. From 12 strains and 3 VNTRs, 36 fragments were sequenced. The ClustalX program was used to generate nucleotide sequence alignments. Then, allelic sizes were converted in to repeat copy numbers using Microsoft Excel software package by the following formula:

(1)

Next, the repeat copy numbers were rounded down to form whole numbers (Table 3). Clustering analysis was done using the categorical parameter and the ward coefficient. Nei’s diversity index of the VNTR loci was calculated from the range of alleles generated from the reference strains utilizing the formula (Table 3) (14-17):

(2)
Table 3.Characteristic of Three VNTR Loci
VNTR locusRepeat MotifRepeat Size, bpTotal Flanking RegionRepeat Range, Min - MaxTotal Length of PCR productNei’s Diversity Index
VNTR4TCGAGCGCCCATAGAAGCGAGACGCTGAGTTACT343521 - 4428 - 5260.69
VNTR10CAGTTAAATTTAGAAATGTGGGAACACACACCATTTGCGGGTTTTA46724 - 13296 - 7100.65
VNTR29GATTTTACAGTTAGACTTTGAAATTGTGGGAACTCCCACGGATTTGG47283 - 10209 - 5380.6

Characteristic of Three VNTR Loci

4. Results

Analysis of the amplified PCR products revealed size variations in most of the loci by agarose gel electrophoresis. All loci exhibited a single PCR product whose size could be determined by 2% agarose gel electrophoresis. All loci successfully amplified in all pathogenic Leptospira serovars. The saprophytic serovar showed no amplified fragments. The sizes of the amplified products displayed range of polymorphism, suggesting variation in tandem repeat copy numbers in 5 VNTR loci (Figure 1). This was confirmed by sequencing of 36 amplified products from three out of five loci (VNTR4, VNTR10, and VNTR29 out of all).

PCR Analysis of the Polymorphism of 5 Representative VNTR Loci in 13 Serovars of <i>Leptospira</i> Used in the Study
Figure 1.

PCR Analysis of the Polymorphism of 5 Representative VNTR Loci in 13 Serovars of Leptospira Used in the Study

Amplification was performed on the VNTR4 (A), VNTR7 (B), VNTR8 (C), VNTR10 (D), and VNTR29 (E) (full names of the abbreviation of the serovars are listed in Table 1). For each VNTR locus, sequence analysis of amplified products displayed a high conservation of flanking regions and repeat units among L. interrogans serovars (Table 3). For each locus, the number of tandem repeats was calculated by measuring the sizes of the amplified products. The strains were typed by the numbers of variable tandem repeats in each of 5 VNTR loci. Among VNTR sequences analyses, VNTR 4 was thoroughly differentiated between L. interrogans serovar (Grippotyphosa strain Moskava, Hardjo strain Hardjo bovis, Pomona strain UT364, and Icterohaemorrhagia strain RGA) from other serovars. In fact, VNTR 4 detected 6 alleles through 13 serovars. VNTR 10 and VNTR29 had an appropriate discrimination to differentiate 5 alleles among 13 serovars (Table 4).

Table 4. Fragment Size of VNTR4, VNTR10, and VNTR29 in 13 Serovars a
SerovarsRTCC No.VNTR4VNTR10VNTR29
Autumnalis 2802526618350
Canicola 2805460342303
Grippotyphosa 2808479296209
Hardjo 2810495710538
Icterohaemorrhagia 2812460342303
Pomona 2815460342303
Serjae serjae (2817)460342317
Patoc 2819---
Hardjo 2821460296303
Pomona 2822562618209
Icterohaemorrhagia2823526526350
Canicola 2824460342303
Grippotyphosa2825428342303

Fragment Size of VNTR4, VNTR10, and VNTR29 in 13 Serovars a

5. Discussion

Leptospirosis has a global distribution and is more prevalent in tropical regions than in temperate zone. This is due to longer survival of leptospirosis (18, 19). Currently, leptospirosis has spread from rural regions to epidemics in urban communities. Understanding the epidemiology of this phenomenon is a vital issue for designing intervention programs and subsequent diminishing its transmission. Unfortunately at present there are few prevention measures for leptospirosis (3).

Today, MLVA method is used for differentiation and identifying Leptospira serovars. The method has potential application in understanding the leptospiral molecular epidemiology with its easy, rapid, and high discriminatory power. Besides, this method is convenient for the exchange of information between laboratories (14, 15). Compared to other bacteria, L. interrogans genome displayed a larg number of tandem repeats with a total length greater than 100 bp for strains within a species or genus (14). The saprophytic serovar was used in this study showed no amplified fragments (the same results were obtained by Majed et al. (13) Slack et al. (15, 16) Salaun et al. (14) and Pavan et al. (17) for other saprophytic serovars). So maybe they are good markers for separation between pathogenic and non-pathogenic serovars and also these loci may interfere in the pathogenesis and virulence.

The combination of VNTR4, VNTR7, VNTR10, VNTR8, and VNTR29 were useful for the differentiation of L. interrogans serovars. It seems that VNTR method can provide rapid typing as well as a highly discriminatory assay to identify L. interrogans serovars in large scale for epidemiological investigation. This finding was in agreement with Majed et al. (13) study that demonstrated high range of polymorphism of VNTR7 and VNTR10 among all VNTR loci. Also, it is in line with the study of Pavan et al. (17) who claimed to set the groundwork for regional Leptospira genotype databank, and provide essential information for future molecular diagnosis and epidemiological tracing of Leptospira by MLVA.

Furthermore, some serovars for each locus displayed the same patterns (Table 4). For instance, VNTR4 has the same pattern in L. interrogans serovar Canicola, strain Hond utrecht IV; serovar Icterohaemorrhagia, strain Verdum, serovar Serjae Serjae; serovar Hardjo, strain Hardjo prajitno; and serovar Canicola, strain Fiocruz LV133. So it seems that serovars from the same geographical area could have more genetic similarity than the serovars in different places such as South America and Europe. The same results were obtained by Majed et al. (13) and Slack et al. (15, 16). They also showed strains originating from distant continents can be grouped together in the dendrogram (13).

One important point regarding MLVA is its ability to show genetic diversity within a few same serovars of the collection strains underestimating the variety of isolates in natural populations, the point that PFGE was unable to differentiate. For instance, among serovars of Hardjo St; Hardjo bovis and Hardjo prajitno and among Pomona St.; UT364, Pomona St. Pomona heterogeneity were identified by MLVA, but PFGE was unable to differentiate them. It was similar to Salaun et al. (14) results. She found among the 5 L. kirschneri strains from Guadeloupe (French West Indies islands) L. kirschneri, serovar Bogvere by PFGE, and two genotypes by MLVA. Similarly, among the 4 L. kirschneri strains identified as L. kirschneri serovar Grippotyphosa by PFGE, MLVA identified different patterns. This finding suggests that a high heterogeneity exists among serovars identified as Grippotyphosa by PFGE (14).

The VNTR analysis developed in this research was cost-effective and easy to perform. Combination of VNTR4, VNTR7, VNTR10, VNTR8, and VNTR29 were useful for differentiation of L. interrogans serovars. This technique provides a base on which improvements to the method and comparisons to other methods can be made. These results highlight the potential role of MLVA in molecular epidemiology of L. interrogans serovars.

Acknowledgments

Footnotes

References

  • 1.
    Rafiei A, Hedayati Zadeh-Omran A, Babamahmoodi F, Alizadeh Navaei R, Valadan R. Review of Leptospirosis in Iran [in persian]. J Mazandaran Univ Med Sci. 2012;22(94):114-24.
  • 2.
    Supply P, Magdalena J, Himpens S, Locht C. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol Microbiol. 1997;26(5):991-1003. [PubMed ID: 9426136].
  • 3.
    Zavitsanou A, Babatsikou F. Leptospirosis: epidemiology and preventive measures. Health Sci J. 2008;2(2):75-82.
  • 4.
    Tahbaz A. Human Leptospiros. J Infect Dis Trop Med. 1996;51(3):1234-9.
  • 5.
    Vand Yousefi J, Moradi Bidhendi S, Ahourai P. New finding about leptospirosis in Razi Institute. Pajouhesh va Sazandeghi. 1994;25:72-5.
  • 6.
    Levett PN. Leptospirosis. Clin Microbiol Rev. 2001;14(2):296-326. [PubMed ID: 11292640]. https://doi.org/10.1128/CMR.14.2.296-326.2001.
  • 7.
    Ralph D, McClelland M, Welsh J, Baranton G, Perolat P. Leptospira species categorized by arbitrarily primed polymerase chain reaction (PCR) and by mapped restriction polymorphisms in PCR-amplified rRNA genes. J Bacteriol. 1993;175(4):973-81. [PubMed ID: 8094390].
  • 8.
    Perolat P, Lecuyer I, Postic D, Baranton G. Diversity of ribosomal DNA fingerprints of Leptospira serovars provides a database for subtyping and species assignation. Res Microbiol. 1993;144(1):5-15. [PubMed ID: 8101010].
  • 9.
    Thiermann AB, Handsaker AL, Moseley SL, Kingscote B. New method for classification of leptospiral isolates belonging to serogroup pomona by restriction endonuclease analysis: serovar kennewicki. J Clin Microbiol. 1985;21(4):585-7. [PubMed ID: 2985648].
  • 10.
    Herrmann JL, Baril C, Bellenger E, Perolat P, Baranton G, Saint Girons I. Genome conservation in isolates of Leptospira interrogans. J Bacteriol. 1991;173(23):7582-8. [PubMed ID: 1938954].
  • 11.
    Herrmann JL, Bellenger E, Perolat P, Baranton G, Saint Girons I. Pulsed-field gel electrophoresis of NotI digests of leptospiral DNA: a new rapid method of serovar identification. J Clin Microbiol. 1992;30(7):1696-702. [PubMed ID: 1629323].
  • 12.
    Pourcel C, Vidgop Y, Ramisse F, Vergnaud G, Tram C. Characterization of a tandem repeat polymorphism in Legionella pneumophila and its use for genotyping. J Clin Microbiol. 2003;41(5):1819-26. [PubMed ID: 12734211].
  • 13.
    Majed Z, Bellenger E, Postic D, Pourcel C, Baranton G, Picardeau M. Identification of variable-number tandem-repeat loci in Leptospira interrogans sensu stricto. J Clin Microbiol. 2005;43(2):539-45. [PubMed ID: 15695642]. https://doi.org/10.1128/JCM.43.2.539-545.2005.
  • 14.
    Salaun L, Merien F, Gurianova S, Baranton G, Picardeau M. Application of multilocus variable-number tandem-repeat analysis for molecular typing of the agent of leptospirosis. J Clin Microbiol. 2006;44(11):3954-62. [PubMed ID: 17088367]. https://doi.org/10.1128/JCM.00336-06.
  • 15.
    Slack AT, Dohnt MF, Symonds ML, Smythe LD. Development of a Multiple-Locus Variable Number of Tandem Repeat Analysis (MLVA) for Leptospira interrogans and its application to Leptospira interrogans serovar Australis isolates from Far North Queensland, Australia. Ann Clin Microbiol Antimicrob. 2005;4:10. [PubMed ID: 15987533]. https://doi.org/10.1186/1476-0711-4-10.
  • 16.
    Slack A, Symonds M, Dohnt M, Smythe L. An improved multiple-locus variable number of tandem repeats analysis for Leptospira interrogans serovar Australis: a comparison with fluorescent amplified fragment length polymorphism analysis and its use to redefine the molecular epidemiology of this serovar in Queensland, Australia. J Med Microbiol. 2006;55(Pt 11):1549-57. [PubMed ID: 17030915]. https://doi.org/10.1099/jmm.0.46779-0.
  • 17.
    Pavan ME, Cairo F, Pettinari MJ, Samartino L, Brihuega B. Genotyping of Leptospira interrogans strains from Argentina by Multiple-Locus Variable-number tandem repeat Analysis (MLVA). Comp Immunol Microbiol Infect Dis. 2011;34(2):135-41. [PubMed ID: 20674025]. https://doi.org/10.1016/j.cimid.2010.06.002.
  • 18.
    Zuerner RL, Alt DP. Variable nucleotide tandem-repeat analysis revealing a unique group of Leptospira interrogans serovar Pomona isolates associated with California sea lions. J Clin Microbiol. 2009;47(4):1202-5. [PubMed ID: 19204099]. https://doi.org/10.1128/JCM.01639-08.
  • 19.
    Soltanimajd N, Khodaverdidarian E, Khaki P, Moradi Bidhendi S, Yahaghi E, Mirnejad R. Epidemiological patterns of Leptospira spp. among slaughterhouse workers in Zanjan- Iran. Asian Pac J Trop Dis. 2012:550-2.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles