Enhancing the Anti-Enterococci Activity of Different Antibiotics by Combining With Metal Oxide Nanoparticles

3.1. Specimen Collection

Enterococcal clinical isolates were obtained from a previous study (2). The samples were collected from the anterior nares and perirectal area of the patients of ICU. Three ATCC strains were used as a control for antibiotic and nanoparticles susceptibility testing; ATCC 51229 VRE-E. faecalis (vanB), ATCC 29212 vancomycin susceptible enterococci (VSE)-E. faecalis and ATCC 51559 VRE-E. faecium (vanA).

3.2. Biochemical Identification

The samples were inoculated onto brain heart infusion agar (BHI) (Oxoid, UK) and bile esculin agar (BEA) (Oxoid, UK). The plates were incubated aerobically at 45°C for 18 - 24 hours. Pin point colonies with black zone around BEA were identified as enterococci by negative catalase and coagulase tests and growth on Mueller Hinton agar (MHA) (Oxoid, UK) with 6% NaCl at 45°C. The confirmation of presumptive positive enterococci was done using VITEK by recommended procedure (VITEK 2 System version 5.01, BioMerieux).

3.3. Identification by PCR

The identification of E. faecalis and E. faecium was done using PCR by amplifying D-Ala:D-Ala ligase gene (ddl_{E. faecalis} and ddl_{E. faecium}) and VRE was identified by targeting vancomycin-resistant gene (vanA and vanB). Primers were purchased from Sigma Genosys (Sigma Aldrich, USA) adapted from a previous study by Kariyama et al. (2000) (24). DNA was extracted with the help of Wizard® Genomic DNA purification kit (Promega Corporation, USA) according to manufacturer’s instructions. The D-Ala:D-Ala ligase gene was amplified with primers ddl_{E. faecalis}(F)= ATCAAGTACAGTTAGTCT, and ddl_{E. faecalis}(R) = ACGATTCAAAGCTAACTG at 941 bp for E. faecalis whereas the primer ddl_{E. faecium} (F) = TTGAGGCAGACCAGATTGACG and ddl_{E. faecium} (R) = TATGACAGCGACTCCGATTCC gave amplicon at 658 bp for E. faecium. VanA genes were amplified with primer vanA-F = GGGAAAACGACAATTGC, and vanA-R = GTACAATGCGGCCGTTA while vanB genes were carried out with primer vanB-F = GTGCTGCGAGATACCACAGA, and vanB-R = CGAACACCATGCAACATTTC with an amplification of 732 bp and 635 bp respectively.

Biometra T1 Thermocycler (Biometra, Germany) was used for amplification. The cycling conditions were as follows: cycle 1: 95°C for 4 minutes cycle 2 - 30: denaturation, 95°C, 30 seconds, annealing 52°C, 60 seconds, extension, 72°C, 2 minutes with the final extension of 7 minutes. Afterwards, the PCR product was run on 1% agarose gel. DNA ladders (O’Gene Ruler, Thermo Fisher Scientific, UK) of 100 bp and 1 kb were used to compare the amplified fragments. The gel was run for electrophoresis at 100 V for 30 minutes and viewed under Molecular Imager Gel Doc XR+ System, Bio-Rad Laboratories, US.

3.4. Antimicrobial Susceptibility Testing

Kirby-Bauer modified Disc diffusion method was used to perform antimicrobial susceptibility testing for all the isolates according to CLSI 2009 recommended direct colony suspension method for disc diffusion. The antibiotic discs used were azithromycin (AZM15), ciprofloxacin (CIP5), erythromycin (E15), imipenem (IPM10), linezolid (LZD30), penicillin G (P10), quinupristin/dalfopristin (QD15), teicoplanin (TEC30), tetracycline (T30) and vancomycin (V30). Mueller Hinton broth (MHB) was used for both antibiotic susceptibility and nanoparticles antimicrobial assay. Broth dilution method was used for MIC using 96-well plate reader Synergy 2 (BioTek, USA) with Gen5 data analysis software. Antibiotics used for MIC were ciprofloxacin, erythromycin, methicillin and vancomycin (Sigma Aldrich, USA). Inoculum used was at a concentration of 10⁶ cfu/mL per well. Following inoculation in 96-well plates under continuous shaking, the optical density (OD) of inoculated isolates was monitored at 600 nm after every 15 minutes with a final reading after 24 hours.

3.5. Antibacterial Activity of Nanoparticles

CaO (< 160 nm and < 50 nm), MgO (< 160 nm and < 50 nm) and ZnO particles (< 50 nm, 100 nm and 5 μm) were purchased from Sigma Aldrich, US. The growth curves of bacterial cells exposed to nanoparticles were examined to evaluate the antibacterial activity of these nanoparticles. On MHB growth medium, different concentrations of particles were used i.e. 0.3125 to 30 mM for CaO and MgO nanoparticles, while 0.3125 to 7 mM for ZnO particles. The concentration of bacterial cells was adjusted to 10⁶ cfu/mL and incubated in a shaking incubator and read on 96-well plate reader Synergy 2 at 37°C for 24 hours. Growth curves were attained through serial monitoring of the OD at 600 nm. Nanoparticle-free media with bacterial cultures under the same growth conditions were used as control.

3.6. Antibacterial Activity of Combination of Antibiotics With Nanoparticles

Nanoparticles concentrations were selected depending upon the MICs of that nanoparticle for respective strain and were mixed with serially diluted antibiotics in the wells of a 96-well plate. Concentrations of ZnO particles used were 0.312 to 1.25 mM and 10 mM for CaO and MgO nanoparticles. Cultures were incubated on shaker incubator at 37°C with medium speed. ODs of the cultures were measured every 15 minutes using 96-well plate reader at 600 nm with a final kinetic reading at 24 hours.

4.1. Antibiotic Resistance Pattern

All of the enterococci were 80 to 100% resistant to azithromycin, ciprofloxacin, erythromycin, imipenem and penicillin G while, 40% resistance was found against tetracycline, teicoplanin and vancomycin. None of the isolates were resistant to linezolid and quinupristin/dalfopristin (Figure 1).

Figure 1.

Azithromycin (AZM15), ciprofloxacin (CIP5), erythromycin (E15), imipenem (IPM10), linezolid (LZD30), penicillin G (P10), quinupristin/dalfopristin (QD15), teicoplanin (TEC30), tetracycline (T30) and vancomycin (V30).

4.2. Minimum Inhibitory Concentrations of Antibiotics

The MIC for ciprofloxacin ranged from 16 to 256 μg/mL indicating resistance (≥ 4 μg/mL) of the isolates to ciprofloxacin. MICs of erythromycin ranged from 1024 to 2048 μg/mL (≥ 8 μg/mL). While all the isolates were resistant to methicillin (≥ 8 μg/mL) with an MIC of 32 to 256 μg/mL. Among E. faecalis and E. faecium, 6/15 were VRE (≥ 8 μg/mL), including two reference strains. While 9/15 were VSE with MIC ≤ 8 μg/mL. MICs of vancomycin varied significantly among the isolates (Table 1).

4.3. Minimum Inhibitory Concentrations of Nanoparticles

MICs of ZnO against the enterococci ranged from 5 to 7 mM for < 5 μm and < 100 nm sized ZnO particles while 2.5 to 5 mM for < 50 nm sized nanoparticles. With < 50 nm ZnO, 10/15 isolates were inhibited at 2.5 mM while remaining at 5 mM. The MICs of CaO and MgO nanoparticles were higher as compared to ZnO particles and were in the range of 15 to 25 mM. CaO nanoparticles inhibited 10/15 isolates at 15 mM and remaining at 20 mM. MgO nanoparticles inhibited 8/15 of isolates at 20 mM, 2/15 and 5/15 at 15 mM and 25 mM respectively (Table 2).

4.4. Antibacterial Activity of Combination of Antibiotics With Nanoparticles

Different combinations of nanoparticles with different concentrations of ciprofloxacin, erythromycin, methicillin and vancomycin were tested against enterococcal isolates. Data of all the concentrations of nanoparticles applied on strains are not shown, except that of 0.625 mM, 1 mM, 1.25 mM, 1.5 mM, 2 mM, and 2.5 mM which efficiently reduced the MICs of the antibiotics. ZnO nanoparticles at concentrations of 1 mM (< 50 nm), 1.5 mM (< 100 nm) and 2.5 mM (< 5 μm) were found to be inhibitory with different concentrations of ciprofloxacin. These concentrations of ZnO effectively reduced the MICs range of ciprofloxacin from 16 - 256 μg/mL to 2 - 16 μg/mL, 4 - 32 μg/mL and 4 - 256 μg/mL for all three sized particles respectively. Similarly, 4 - 256 μg/mL MICs range was observed when ciprofloxacin was combined with 10 mM of CaO and MgO (Tables 3 and 4).

With erythromycin, ZnO nanoparticles were found inhibitory at concentrations of 1 mM, 1.25 mM and 2.5 mM respectively by < 50 nm, < 100 nm and < 5 μm. There was an effective reduction in the MICs of erythromycin from 1024 - 2048 μg/mL to 128 - 512 μg/mL and same improvement with that of 10 mM of CaO and MgO.

Methicillin in combination with ZnO particles at concentrations of 1.25 mM (< 50 nm), 2 mM (< 100 nm) and 2.5 mM (< 5 μm) effectively reduced the MICs from 32 - 256 μg/mL to 8 - 64 μg/mL by < 50 nm and < 100 nm and 8 - 128 μg/mL by < 5 μm size particles. With 10 mM of CaO and MgO, the MICs were reduced to 16 - 128 μg/mL.

Vancomycin was also combined with ZnO particles in different concentrations. Most effective concentrations were 0.625 mM (< 50nm), 1 mM (< 100 nm) and 1.25 mM (< 5 μm). MICs of vancomycin against VRE were reduced from 256 - 512 μg/mL to 16 - 32 μg/mL with < 50 nm ZnO and to 32 - 64 μg/mL by < 100 nm and < 5 μm ZnO particles. Upon VSE, MICs were reduced from 2 - 4 μg/mL to 0.5 - 4 μg/mL with all these particles. Both CaO and MgO at 10 mM concentrations were found effective in reducing the MICs of VRE to 32 - 64 μg/mL range while for VSE it was the same as for ZnO nanoparticles (Tables 3 and 4).