1. Background
2. Objectives
3. Patients and Methods
3.1. Fecal Sampling
3.2. Extraction of Total DNA and PCR Amplification
| Target Bacteria | Prime | Sequence (5′ to 3′) |
|---|---|---|
| Total Bacteria | BA-GC-338f ,UN518r | ACTCCTACGGGAGGCAGCAGATT ACC GCG GCTGCT GG |
| Lactobacillus | Lac1, Lac2-GC | AGCAGTAGGGAATCTTCCAATTTCACCGCTACACATG |
| Bifidobacterium | Bif164-GC-f, Bif662-r | GGGTGGTAATGCCGGATGCCACCGTTACACCGGGAA |
| GCd | CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG |
aThe reaction of total bacteria was performed using the following conditions: 92°C for 2 minutes and 30 cycles of 92°C for 1 minute, 55°C for 30 seconds and 72°C for 1 minute, and a final extension at 6°C for 72 minutes.
bThe reaction was performed using the following conditions: 94°C for 2 minutes and 35 cycles of 94°C for 30 seconds, 61°C for 1 minute and 68°C for 1 minute. The reaction was terminated with an extension step of 7 minutes at 68°C.
cThe reaction was performed using the following conditions: 95°C for 5 minutes and 35 cycles of 95°C for 1 minute, 62°C for 20 seconds and 68°C for 40seconds final extension at 6°C for 7 minutes.
dAll GC primers contained a 40 bp GC-clamp sequence at their 5′ end to prevent the complete denaturation of the amplicons.
3.3. Analysis of Fecal Microbiota by Denaturing Gradient Gel Electrophoresis
3.4. Gene Sequencing for the Bands
3.5. Statistical and Clustering Analysis
4. Results
| Group | Microbiota Diversity (Mean ± SD) | Microbiota Similarity (Mean H′ or H max′ ± SD) | ||
|---|---|---|---|---|
| DGGE bands | Shannon-Weaver | Intragroup | Intergroup | |
| RV | 6.6 ± 1.92 | 2.03 ± 0.12 | 68.54 ± 13.33 | 33.16 ± 8.23 |
| H | 8.8 ± 0.94 | 2.24 ± 0.34 | 65.47 ± 8.34 | NA |
| p | 0.00022 | 0.0038 | NA | NA |
aNumber of DGGE bands produced by each sample.
bDice similarity coefficients comparing DGGE band profiles within individuals of each group.
cDice similarity coefficients comparing DGGE band profiles between each RD infant and H infant.
| Amplicon ID | Closest relative (Accession number) | Size, bp | H = 15, No. (%) | RD = 15, No. (%) |
|---|---|---|---|---|
| L1, L2, L3, L4 | L. brevis (jx003598) | 1360 | 13 (87) | 13 (87) |
| L5, L6, L7 | L. helveticus (fj749441) | 1462 | 15 (100) | 3 (20) |
| L8, L9, L10 | L. acidophilus (ay763430) | 1475 | 15 (100) | 2 (13) |
| L11, L12, L13, L4 | L. crispatus (jq805668) | 1503 | 14 (93) | 14 (93) |
| L15, L16 | L. fermentum (gq455406) | 1523 | 12 (80) | 0 (0) |
| B1, B2, B3, B4, B5 | B. breve (gu942826) | 294 | 12 (80) | 12 (80) |
| B6, B7, B8, B9, B10 | B. catenulatum (ab846175) | 591 | 15 (100) | 15 (100) |
| B11, B12, B13 | B. infantis (bif16srrge) | 642 | 14 (93) | 0 (0) |
| B15, B17, B18 | B. longum (hq591348) | 1369 | 11 (73) | 0 (0) |
| B16, B21 | B. breve (ay172656) | 1401 | 6 (40) | 0 (0) |
| B14, B19, B20, B22 | B. adolescentis (hq259739) | 1460 | 12 (80) | 5 (33) |
| B23, B24, B25 | B. bifidum (aj311604) | 1469 | 14 (93) | 0 (0) |
aThe marks corresponding to the DGGE bands shown in Figures 3, and 4.
bThe sequence identity was ≥ 99%.
cSignificant differences between RD infants and H infants: P < 0.05.
5. Discussion
| Band Number | Species | Closest relative ID in NCBI | Size, bp | Identities, % |
|---|---|---|---|---|
| 1-1,2-4,3-4,4-4,6-4,7-4,8-4, 9-3,11-4,12-4,13-4,14-1 | Clostridium spp. | JN605802 | 664 | 100 |
| 1-2,2-5,3-5,4-5,6-5,7-5,8-5, 9-4,11-5,12-5,13-5,14-2 | C. sardiniense | FJ546743 | 681 | 99 |
| 1-3,2-6,3-6,4-6,5-3,6-5,7-6,8-6,9-5,10-1,11-6,12-6,13-614-3,15-1 | Escherichia fergusonii | HE612113 | 1211 | 100 |
| 1-4,2-7,3-7,4-7,5-4,6-7,7-7,8-7,9-6,10-2,11-7,12-7,13-7, 14-4,15-2 | Enterococcus faecium | JQ778275 | 1473 | 99 |
| 1-5,2-8,3-8,4-8,5-5,6-8,7-8,8-8,9-7,10-311-8,12-8,13-8,14-5,15-3,17-6,22-5,27-7 | E. coli | HQ622348 | 1511 | 100 |
| 2-1,3-1,4-1,6-1,7-1,8-1,9-1, 11-1,12-1,13-1 | P. anaerobius | GQ496449 | 300 | 100 |
| 2-2,2-3,3-2,3-3,4-2,4-3,5-1, 5-2,6-2,6-3,7-2,7-3,8-2,8-3,9-2,11-211-3,12-2,12-3,13-2,13-3 | Bacteroides vulgatus | JF298877 | 540 | 99 |
| 16-1,17-1,18-1,19-1,20-1,21-1,23-1,24-1,25-1,26-1,27-1,28-1,29-1,30-1 | Clostridium spp. | AM774623 | 354 | 99 |
| 16-2.17-2,18-2,19-2,20-3,21-1,22-2,23-2, 24-2,25-2,26-2,28-2,28-3,29-2,30-2 | Uncultured bacterium | JF256482 | 644 | 100 |
| 16-3,17-3,18-3,19-4,20-4,21-3,22-2,23-3,24-3,25-3,26-3,27-2,28-4,29-4,30-5 | Bacteroides spp. | AM117579 | 821 | 100 |
| 16-4,18-4,19-5,20-5,21-4,23-4,24-4,25-4,26-4,27-3,28-5,29-5,30-6 | Bifidobacterium spp. | AM117580 | 845 | 99 |
| 16-6,17-4,18-5,19-6,20-7,21-5,22-3,23-5,24-5,25-6,26-5,28-6,29-7,30-8 | Lactobacillus spp. | JH164960 | 936 | 99 |
| 16-7,17-6,18-6,20-8,21-5,22-5,23-7,24-7, 25-7.26-6,27-5,28-8,29-8,30-8 | B. infantis | HQ591348 | 1369 | 99 |
| 16-5,20-6,25-5,27-4,29-6,30-7 | P. bacterium | AXYJ01000008 | 1222 | 100 |
ai - i′ stands for the i′th band of the i th lane in Figure 1.



