Logo

Virulence Gene Profile and Multilocus Variable-Number Tandem-Repeat Analysis (MLVA) of Enteroinvasive Escherichia coli (EIEC) Isolates From Patients With Diarrhea in Kerman, Iran

Author(s):
Hossein Hosseini NaveHossein Hosseini Nave1, Shahla MansouriShahla Mansouri1, Majid Taati MoghadamMajid Taati Moghadam1, Mohammad MoradiMohammad Moradi1,*
1Department of Microbiology and Virology, Kerman University of Medical Sciences, Kerman, IR Iran

Jundishapur Journal of Microbiology:Vol. 9, issue 6; e33529
Published online:May 24, 2016
Article type:Research Article
Received:Oct 04, 2015
Accepted:Apr 11, 2016
How to Cite:Hosseini Nave H, Mansouri S, Taati Moghadam M, Moradi M, Virulence Gene Profile and Multilocus Variable-Number Tandem-Repeat Analysis (MLVA) of Enteroinvasive Escherichia coli (EIEC) Isolates From Patients With Diarrhea in Kerman, Iran.Jundishapur J Microbiol.2016;9(6):e33529.https://doi.org/10.5812/jjm.33529.

Abstract

Background:

Enteroinvasive Escherichia coli (EIEC) isolates cause dysentery in humans. Several virulence factors associated with EIEC pathogenesis have been characterized. Multilocus variable-number tandem-repeat analysis (MLVA) is a PCR-based method that has been used for genotyping bacterial pathogens.

Objectives:

The aim of this study was to investigate the distribution of virulence factor genes in EIEC isolates from patients with diarrhea in Kerman, Iran, as well as the genetic relationships between these isolates.

Patients and Methods:

A total of 620 diarrheic stool samples were collected from patients attending two hospitals in Kerman from June 2013 to August 2014. All isolates were confirmed as EIEC by PCR for the ipaH gene. The EIEC isolates were evaluated by PCR for the presence of nine virulence genes (ial, set1A, sen, virF, invE, sat, sigA, pic, and sepA). MLVA was performed for all EIEC isolates.

Results:

A total of 11 EIEC isolates were identified, and all were positive for the ial gene. The invE and virF genes were observed in 81.8% of the isolates, while sen, sigA, and pic were detected in 72.7%, 63.6%, and 27.3% of the isolates, respectively. None of the isolates were positive for the sat, set, and sepA genes. Using MLVA, the 11 total isolates were divided into five types.

Conclusions:

By studying the profiles of virulence genes and MLVA, it can be concluded that EIEC isolates do not have high heterogeneity and are derived from a limited number of clones.

1. Background

Enteroinvasive Escherichia coli (EIEC) isolates cause dysentery in humans and are closely related to Shigella species with regard to their virulence, biochemical, genetic, and physiopathological properties (1). Bacillary dysentery is caused by four Shigella species or EIEC, and is characterized by abdominal cramps, fever, and stool that contains blood, mucus, and pus (2). Enteroinvasive E. coli may cause invasive inflammatory colitis and occasionally causes dysentery, but in most cases, EIEC isolates cause watery diarrhea indistinguishable from that due to other diarrheagenic E. coli strains (1, 3). Several virulence factors associated with Shigella and EIEC pathogenesis have been characterized. These microorganisms possess a large plasmid, pINV, which encodes several proteins involved in the invasion of host cells (4).

The invasion plasmid antigen H gene (ipaH) is present in multiple copies located on both chromosomes, and the plasmid is responsible for dissemination in epithelial cells (5). The invasion-associated locus (ial), which is carried on a large inv plasmid, is involved in cell penetration by Shigella and EIEC (5). Previous studies have suggested that two enterotoxins, Shigella enterotoxin 1 (ShET1) and Shigella enterotoxin 2 (ShET2), are associated with altered water and electrolyte transport in the small intestine (6). Shigella enterotoxin 1 (encoded by the set gene) is found in many isolates of S. flexneri serotype 2a and only rarely in other Shigella serotypes. ShET-2 (encoded by the sen gene) was originally discovered in EIEC isolates, but is found in many Shigella and EIEC isolates (6). Two plasmid-borne proteins, VirF and VirB (InvE) are involved in transcriptional regulation of the invasion genes (7).

The serine protease autotransporters of Enterobacteriaceae (SPATEs) comprise a diverse group of serine proteases, which are produced by members of the Enterobacteriaceae. Phylogenetically, the SPATE family can be divided into two classes. Class 1 SPATEs induce cytopathic effects in epithelial cell lines and include the plasmid-encoded toxin gene (pet) and its two homologs, Shigella IgA-like protease homologue gene (sigA) and secreted autotransporter toxin gene (sat) (8). Members of class 2 are non-toxic SPATEs, including a protein involved in intestinal colonization (Pic), and Shigella extracellular protein A (SepA), a toxin that contributes to intestinal inflammation. Both of these toxins were first reported in S. flexneri 2a (8).

Molecular typing methods are frequently applied for accessing genetic relatedness among bacterial pathogens for the purpose of epidemiological surveillance. Multilocus variable-number tandem repeat analysis (MLVA) is a PCR-based method used for distinguishing between bacterial isolates (9, 10). Several studies have investigated VNTR loci variations to discriminate different E. coli and Shigella isolates (9-15).

2. Objectives

Despite various reports on the prevalence and distribution of virulence genes in Shigella spp. in different parts of the world, investigations into EIEC virulence genes are still rare worldwide, and we are not aware of any paper on this subject in Iran. Therefore, this study aimed to investigate the distribution of numerous virulence genes and the genetic diversity of EIEC isolates.

3. Patients and Methods

3.1. Sample Collection and EIEC Isolate Identification

A total of 620 stool samples were randomly collected from patients with diarrhea who presented at two major hospitals (Ayatollah Kashani and Afzalipour) in the city of Kerman from June 2013 to August 2014. The stools were immediately cultured on xylose lysine deoxycholate (XLD) and MacConkey agar media. The lactose-positive colonies were then re-cultured with the standard biochemical method for detection of E. coli (11). Enteroinvasive E. coli isolate detection was conducted using a PCR assay with ipaH primer. The EIEC isolates were then stored in TSB broth containing 30% glycerol at a temperature of -70°C until further analysis.

3.2. PCR Assay for Virulence Factor Genes

All isolates were tested for the presence of nine virulence genes (Table 1). To identify the virulence genes, DNA was first extracted by the boiling method (10). Singleplex PCR was performed for the detection of the ial, set1A, sen, virF, and invE genes. master mix (Amplicon, Brighton, UK) was used, and the reaction was performed according to the manufacturer’s instructions. Amplification was carried out in a thermocycler (Biometra-T gradient, Gottingen, Germany). The cycling conditions were as follows: initial denaturation at 95°C for 5 minutes, followed by 30 cycles including denaturation for 1 minute at 94°C, annealing for 1 minute (the primer annealing temperatures are listed in Table 1), and extension at 72°C for 45 seconds, with a single final extension at 72°C for 5 minutes. For the SPATE genes, including sat, sigA, pic, and sepA, multiplex PCR was performed according to the method previously described (8), in a final volume of 20 µL containing 17 µL of master mix and 3 µL of DNA template. The cycling conditions comprised an initial denaturation step at 95°C for 10 minutes, followed by 30 cycles with denaturation at 94°C for 30 seconds, annealing for 1 minute, and extension at 72°C for 1 minute, with a final extension step at 72°C for 7 minutes.

Table 1. Primers Used to Identify Various Virulence-Associated Genes of EIEC
GenePrimerAmplicon Size (bp)Annealing Temperature (°C)Reference
ipaHGAAAACCCTCCTGGTCCATCAGG, GCCGGTCAGCCACCCTCTGAGAGTAC43761(16)
ialCTGGATGGTATGGTGAGG, GGAGGCCAACAATTATTTCC32056(6)
set1ATCACGCTACCATCAAAGA, TATCCCCCTTTGGTGGTA30957(6)
senATGTGCCTGCTATTATTTAT, CATAATAATAAGCGGTCAGC79953(6)
virFTCAGGCAATGAAACTTTGAC, TGGGCTTGATATTCCGATAAGTC61858(6)
invECGATAGATGGCGAGAAATTATATCCCG, CGATCAAGAATCCCTAACAGAAGAATCAC76659(6)
satTCAGAAGCTCAGCGAATCATTG, CCATTATCACCAGTAAAACGCACC93058(8)
sigACCGACTTCTCACTTTCTCCCG, CCATCCAGCTGCATAGTGTTTG43058(8)
picACTGGATCTTAAGGCTCAGGAT, GACTTAATGTCACTGTTCAGCG57258(8)
sepAGCAGTGGAAATATGATGCGGC, TTGTTCAGATCGGAGAAGAACG79458(8)

Primers Used to Identify Various Virulence-Associated Genes of EIEC

3.3. VNTR Locus Selection and Amplification

Various VNTR loci have been characterized in the genomes of E. coli and Shigella (12-14). From these, loci with appropriate repetitions and sufficiently long repeat sizes were selected for genetic typing of the EIEC isolates. Accordingly, seven different VNTR loci were selected, and PCR was performed according to the previously described method (14). The locus names, selected primers, and repeat sizes for each locus are presented in Table 2. After performing PCR, the size of each locus (amplicon size) was determined on 1.5% agarose gel, and the number of repeats was calculated (Figure 1). The results were entered into Microsoft excel 2010 software and analyzed with Bionumerics software (14). Any difference in one or more VNTR loci was considered to indicate a distinct type. A genotypic similarity of 90% was used as the cut-off value for clustering (17).

Table 2. Locus-Specific PCR Primers Selected for MLVA Assay
LocusPrimer SequenceRepeat Size (bp)Annealing Temperature (°C)Reference
ms06F-AAACGGGAGAGCCGGTTATT, R-TGTTGGTACAACGGCTCCTG3957(14)
ms07F:GTCAGTTCGCCCAGACACAG, R: CGGTGTCAGCAAATCCAGAG3957(14)
ms09F:GTGCCATCGGGCAAAATTAG, R:CCGATAAGGGAGCAGGCTAGT17957(14)
ms11F:GAAACAGGCCCAGGCTACAC, R:CTGGCGCTGGTTATGGGTAT9657(14)
ms21F:GCTGATGGCGAAGGAGAAGA, R: GGGAGTATGCGGTCAAAAGC14157(14)
ms23F:GCTCCGCTGATTGACTCCTT, R:CGGTTGCTCGACCACTAACA37557(14)
ms32F:TGAGATTGCCGAAGTGTTGC; R:AACTGGCGGCGTTTATCAAG10157(14)

Locus-Specific PCR Primers Selected for MLVA Assay

This image illustrates how the number of repeats can be directly deduced by manual reading.
Figure 1.

This image illustrates how the number of repeats can be directly deduced by manual reading.

4. Results

In the present study, eleven EIEC isolates were isolated from 620 stool samples from June 2013 to August 2014. The detection of the virulence genes from 11 EIEC isolates showed that all isolates were positive for ial, whereas 81.8% were positive for the invE and virF genes. The sen, sigA, and pic genes were detected in 72.7%, 63.6%, and 27.3% of the isolates, respectively (Figure 2). None of the isolates were positive for the sat, sepA, or set genes. Using MLVA, a total of 11 isolates were divided into five types. Analysis of the MLVA profiles using UPGMA showed that the EIEC isolates fell into two main clusters, using 90% similarity as the cut-off (Figure 3). In some cases, the patterns of virulence genes were not similar in isolates with the same MLVA type; however, isolates with similar MLVA patterns mostly had similar virulence patterns. For example, isolates 1 and 11, as well as isolates 2, 7, and 9, had identical patterns of virulence genes and similar MLVA patterns (Figure 3).

Lanes 1 and 6, ladder 100 bp; lane 2, <i>S. flexneri</i> 2a strain 2457Ti as positive control for <i>sepA</i>, <i>pic</i>, <i>sat</i>, and <i>sigA</i>; lane 3, positive clinical isolate for <i>pic</i>; lane 4, positive clinical isolate for <i>sigA</i>; lane 5, negative control.
Figure 2.

Lanes 1 and 6, ladder 100 bp; lane 2, S. flexneri 2a strain 2457Ti as positive control for sepA, pic, sat, and sigA; lane 3, positive clinical isolate for pic; lane 4, positive clinical isolate for sigA; lane 5, negative control.

Dendrogram Demonstrating Genetic Similarities of 11 EIEC Isolates Based on MLVA Genotyping
Figure 3.

Dendrogram Demonstrating Genetic Similarities of 11 EIEC Isolates Based on MLVA Genotyping

5. Discussion

Enteroinvasive E. coli isolates cause watery diarrhea and dysentery in humans, similar to that caused by Shigella spp. In the present study, 11 isolates of EIEC were obtained from 620 diarrhea samples, which indicates that EIEC is not endemic in Kerman. These results are consistent with the results of many studies around the world and in Iran (18-21), except for a limited number of reports (22, 23). EIEC isolates are similar to Shigella in terms of pathogenesis; however, very little research has been conducted to identify their virulence gene profiles. We studied the distribution of several virulence genes in EIEC isolates, which was mostly assessed only in Shigella spp. in previous studies. It has been reported that some of the Shigella isolates were negative for the ial gene because it is located on the inv plasmid, which is prone to loss or deletion (5, 24, 25). However, in the present study, all isolates were positive for the ial gene, and most were positive for the invE and virF genes.

This is in agreement with data obtained in previous studies on virulence gene distribution in Shigella spp. (6, 26). As expected, the set gene was not found in the EIEC isolates, while the sen gene was observed in 72.7%. The set gene has been found in S. flexneri (especially S. flexneri 2a), while sen has been identified in all Shigella spp. and also in EIEC isolates (5, 27). Pic and SigA toxins were found among our EIEC isolates. These SPATE toxins were also identified in a few previous studies on EIEC isolates (8, 28). These toxins, especially SigA, may be important for EIEC pathogenesis. In the current study, all isolates were negative for the Sat and SepA toxins. These results are consistent with those obtained by Taddei et al. (29) and Boisen et al. (8).

The genetic diversity of EIEC isolates has been studied only by a few researchers until now (4, 30, 31). We used the MLVA method for the typing of EIEC isolates. This method has several advantages, such as easy application, inexpensiveness, and repeatability (9), and it has been used for typing Shigella spp. and E. coli. In research by Liang et al. (13), MLVA showed a high level of discrimination compared to PFGE, and isolates with the same PFGE patterns were distinguished by the MLVA method (13). In research by Ranjbar et al. (10), similar to the present study, seven VNTR loci were used to distinguish 47 isolates of S. soneii. The S. sonnei isolates belonged to two clonal complexes and had little genetic diversity (10). In the current study, EIEC isolates belonged to two clonal complexes, which revealed that limited numbers of distinct clones cause the diarrhea related to EIEC isolates in Kerman. However, it may be possible to distinguish these closely related isolates with the MLVA method based on highly polymorphic VNTR loci. It should be noted that these methods require sequencing or microcapillary electrophoresis to determine the number of short repeats at the VNTR loci (12, 14). We selected VNTR loci that can successfully estimate the number of repetitive DNAs among the isolates based on agarose gel electrophoresis. Hence, our MLVA typing scheme would be a suitable tool for epidemiological studies in many laboratories with simple molecular biology equipment. In this study, isolates with the same MLVA type also had the same virulence gene patterns in most cases. However, in some cases, the virulence gene patterns of the isolates within an MLVA type were not similar. This might be a result of many virulence genes found on the large plasmid, which is prone to loss or deletions during growth under in vitro conditions.

In conclusion, it seems that EIEC is of little importance in the prevalence of diarrhea in Kerman. A number of virulence genes found in Shigella, such as sat, set, and sepA, were not found in EIEC. In our study, the incidence of EIEC was low, and a bigger sample size is needed to draw firm conclusions about the heterogeneity of EIEC isolates.

Acknowledgments

Footnotes

References

  • 1.
    Sousa CP. East1 toxin and its presence in a changing microbial world. J Venom Anim Toxins Incl Trop Dis. 2003;9(1):4-52. https://doi.org/10.1590/S1678-91992003000100002.
  • 2.
    Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. [PubMed ID: 15040260]. https://doi.org/10.1038/nrmicro818.
  • 3.
    Abbasi P, Kargar M, Doosti A, Mardaneh J, Dalini SG, Dehyadegari MA. Real time pcr for characterization of enteroinvasive e. Coli (eiec) in children with diarrhea in shiraz. Ann Colorectal Res. 2015;2(3). ee22721. https://doi.org/10.17795/acr-22721.
  • 4.
    Martinez MB, Whittan TS, McGraw EA, Rodrigues J, Trabulsi LR. Clonal relationship among invasive and non-invasive strains of enteroinvasive Escherichia coli serogroups. FEMS Microbiol Lett. 1999;172(2):145-51. [PubMed ID: 10188242].
  • 5.
    Sousa MA, Mendes EN, Collares GB, Peret-Filho LA, Penna FJ, Magalhaes PP. Shigella in Brazilian children with acute diarrhoea: prevalence, antimicrobial resistance and virulence genes. Mem Inst Oswaldo Cruz. 2013;108(1):30-5. [PubMed ID: 23440111].
  • 6.
    Cruz C, Souza M, Serra P, Santos I, Balieiro A, Pieri FA, et al. Virulence factors associated with pediatric shigellosis in Brazilian Amazon. Biomed Res Int. 2014;2014. https://doi.org/10.1155/2014/539697.
  • 7.
    Broach WH, Egan N, Wing HJ, Payne SM, Murphy ER. VirF-independent regulation of Shigella virB transcription is mediated by the small RNA RyhB. PLoS One. 2012;7(6). eee38592. [PubMed ID: 22701677]. https://doi.org/10.1371/journal.pone.0038592.
  • 8.
    Boisen N, Ruiz-Perez F, Scheutz F, Krogfelt KA, Nataro JP. Short report: high prevalence of serine protease autotransporter cytotoxins among strains of enteroaggregative Escherichia coli. Am J Trop Med Hyg. 2009;80(2):294-301. [PubMed ID: 19190229].
  • 9.
    Kawamori F, Hiroi M, Harada T, Ohata K, Sugiyama K, Masuda T, et al. Molecular typing of Japanese Escherichia coli O157 : H7 isolates from clinical specimens by multilocus variable-number tandem repeat analysis and PFGE. J Med Microbiol. 2008;57(Pt 1):58-63. [PubMed ID: 18065668]. https://doi.org/10.1099/jmm.0.47213-0.
  • 10.
    Ranjbar R, Memariani M. Multilocus variable-number tandem-repeat analysis for genotyping of Shigella sonnei strains isolated from pediatric patients. Gastroenterol Hepatol Bed Bench. 2015;8(3):225-32. [PubMed ID: 26328045].
  • 11.
    Memariani M, Peerayeh SN, Salehi TZ, Mostafavi SKS. Occurrence of shv, tem and ctx-m β-lactamase genes among enteropathogenic escherichia coli strains isolated from children with diarrhea. Jundishapur J Microbiol. 2015;8(4). ee15620. https://doi.org/10.5812/jjm.8(4)2015.15620.
  • 12.
    Wang YW, Watanabe H, Phung DC, Tung SK, Lee YS, Terajima J, et al. Multilocus variable-number tandem repeat analysis for molecular typing and phylogenetic analysis of Shigella flexneri. BMC Microbiol. 2009;9:278. [PubMed ID: 20042119]. https://doi.org/10.1186/1471-2180-9-278.
  • 13.
    Liang SY, Watanabe H, Terajima J, Li CC, Liao JC, Tung SK, et al. Multilocus variable-number tandem-repeat analysis for molecular typing of Shigella sonnei. J Clin Microbiol. 2007;45(11):3574-80. [PubMed ID: 17881552]. https://doi.org/10.1128/JCM.00675-07.
  • 14.
    Gorge O, Lopez S, Hilaire V, Lisanti O, Ramisse V, Vergnaud G. Selection and validation of a multilocus variable-number tandem-repeat analysis panel for typing Shigella spp. J Clin Microbiol. 2008;46(3):1026-36. [PubMed ID: 18216214]. https://doi.org/10.1128/JCM.02027-07.
  • 15.
    Chiou CS, Watanabe H, Wang YW, Wang WL, Terajima J, Thong KL, et al. Utility of multilocus variable-number tandem-repeat analysis as a molecular tool for phylogenetic analysis of Shigella sonnei. J Clin Microbiol. 2009;47(4):1149-54. [PubMed ID: 19225095]. https://doi.org/10.1128/JCM.01607-08.
  • 16.
    Bonkoungou IJ, Lienemann T, Martikainen O, Dembele R, Sanou I, Traore AS, et al. Diarrhoeagenic Escherichia coli detected by 16-plex PCR in children with and without diarrhoea in Burkina Faso. Clin Microbiol Infect. 2012;18(9):901-6. [PubMed ID: 21985619]. https://doi.org/10.1111/j.1469-0691.2011.03675.x.
  • 17.
    van Belkum A, Tassios PT, Dijkshoorn L, Haeggman S, Cookson B, Fry NK, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect. 2007;13 Suppl 3:1-46. [PubMed ID: 17716294]. https://doi.org/10.1111/j.1469-0691.2007.01786.x.
  • 18.
    Katouli M, Jaafari A, Farhoudi-Moghaddam AA, Ketabi GR. Aetiological studies of diarrhoeal diseases in infants and young children in Iran. J Trop Med Hyg. 1990;93(1):22-7. [PubMed ID: 2406458].
  • 19.
    Rappelli P, Folgosa E, Solinas ML, Dacosta JL, Pisanu C, Sidat M, et al. Pathogenic enteric Escherichia coli in children with and without diarrhea in Maputo, Mozambique. FEMS Immunol Med Microbiol. 2005;43(1):67-72. [PubMed ID: 15607638]. https://doi.org/10.1016/j.femsim.2004.07.006.
  • 20.
    Regua-Mangia AH, Gomes TA, Vieira MA, Andrade JR, Irino K, Teixeira LM. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Infect. 2004;48(2):161-7. [PubMed ID: 14720492].
  • 21.
    Teng LJ, Hsueh PR, Liaw SJ, Ho SW, Tsai JC. Genetic detection of diarrheagenic Escherichia coli isolated from children with sporadic diarrhea. J Microbiol Immunol Infect. 2004;37(6):327-34. [PubMed ID: 15599464].
  • 22.
    Vieira N, Bates SJ, Solberg OD, Ponce K, Howsmon R, Cevallos W, et al. High prevalence of enteroinvasive Escherichia coli isolated in a remote region of northern coastal Ecuador. Am J Trop Med Hyg. 2007;76(3):528-33. [PubMed ID: 17360879].
  • 23.
    Kain KC, Barteluk RL, Kelly MT, He X, de Hua G, Ge YA, et al. Etiology of childhood diarrhea in Beijing, China. J Clin Microbiol. 1991;29(1):90-5. [PubMed ID: 1993771].
  • 24.
    Thong KL, Hoe SL, Puthucheary SD, Yasin R. Detection of virulence genes in Malaysian Shigella species by multiplex PCR assay. BMC Infect Dis. 2005;5:8. [PubMed ID: 15707504]. https://doi.org/10.1186/1471-2334-5-8.
  • 25.
    Kingombe CI, Cerqueira-Campos ML, Farber JM. Molecular strategies for the detection, identification, and differentiation between enteroinvasive Escherichia coli and Shigella spp. J Food Prot. 2005;68(2):239-45. [PubMed ID: 15726963].
  • 26.
    Su WL, Chen C, Wang ZQ, Li J, He X, Sun ZN, et al. [Virulence genes and pathogenicity of Shigella flexneri Xv isolated in Beijing]. Zhonghua Liu Xing Bing Xue Za Zhi. 2013;34(1):57-60. [PubMed ID: 23648252].
  • 27.
    Vargas M, Gascon J, Jimenez De Anta MT, Vila J. Prevalence of Shigella enterotoxins 1 and 2 among Shigella strains isolated from patients with traveler's diarrhea. J Clin Microbiol. 1999;37(11):3608-11. [PubMed ID: 10523561].
  • 28.
    Muller D, Greune L, Heusipp G, Karch H, Fruth A, Tschape H, et al. Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl Environ Microbiol. 2007;73(10):3380-90. [PubMed ID: 17400780]. https://doi.org/10.1128/AEM.02855-06.
  • 29.
    Taddei CR, Moreno ACR, Fernandes Filho A, Montemor LPG, Martinez MB. Prevalence of secreted autotransporter toxin gene among diffusely adheringEscherichia coliisolated from stools of children. FEMS Microbiol Lett. 2003;227(2):249-53. https://doi.org/10.1016/s0378-1097(03)00688-8.
  • 30.
    Gibotti A, Tanaka T, Oliveira V, Taddei CR, Martinez MB. Molecular characterization of enteroinvasive Escherichia coli ipa genes by PCR-RFLP analysis. Braz J Microbiol. 2004;35(1-2):74-80. https://doi.org/10.1590/S1517-83822004000100012.
  • 31.
    Beutin L, Gleier K, Kontny I, Echeverria P, Scheutz F. Origin and characteristics of enteroinvasive strains of Escherichia coli (EIEC) isolated in Germany. Epidemiol Infect. 1997;118(3):199-205. [PubMed ID: 9207729].
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles