Clinical and Epidemiological Profile of Pandemic Influenza A H1N1, H3N2, and Type B in the Southeast of Caspian Sea, Iran

Authors

Naeme Javid1, Abdolvahab Moradi1,*, Alijan Tabarraei1, 2, Masoud Bazouri2
1Department of Microbiology, Golestan University of Medical Sciences, Gorgan, IR Iran
2Infectious Diseases Research Center, Gorgan, IR Iran
*Corresponding Author: Corresponding author: Abdolvahab Moradi, Department of Microbiology, School of Medicine, Golestan University of Medical Sciences, Gorgan, Iran. Tel: +98-9112733321; +98-1732421289, Fax: +98-1732440225, E-mail: Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 10, issue 3; e35616
Published online:Feb 06, 2017
Article type:Research Article
Received:Dec 19, 2015
Accepted:Jan 31, 2017
How to Cite:Javid N, Moradi A, Tabarraei A, Bazouri M. Clinical and Epidemiological Profile of Pandemic Influenza A H1N1, H3N2, and Type B in the Southeast of Caspian Sea, Iran. Jundishapur J Microbiol. 2017;10(3):e35616. doi: https://doi.org/10.5812/jjm.35616

Abstract

Background:

Timely diagnosis of influenza virus is important because this virus can cause severe illness. The 2009 pdmH1N1 influenza virus spread rapidly throughout the world as the first infectious pandemic of the 21st century.

Objectives:

The aim of this study was the investigation of clinical and epidemiological figure of influenza virus A/H1N1, A/H3N2, and Influenza B infection among patients with respiratory syndrome in Golestan province, Southeast of Caspian see, Iran.

Methods:

This prospective, cross sectional study took place since November 2010 through March 2014. Demographic and clinical data were collected. Nasopharyngeal (NP) swabs were taken from patients with respiratory syndrome in virus transport medium and were extracted with High Pure Viral RNA Extraction Kit. Real time PCR were performed according to the CDC recommended protocol.

Results:

A total of 790 suspected cases were assessed; pandemic A H1N1, A/H3N2, and influenza B virus were confirmed in 25 cases (3.2%), 21 cases (2.7%), and 22 (2.8%), respectively. The greatest number of confirmed cases occurred in the age group of 25 to 34 years. There was no significant association between positive cases and age, sex, residency, and clinical symptoms.

Conclusions:

The prevalence of pandemic Influenza viruses in recent years has caused financial losses as well as mortalities around the world. This shows the importance of the rapid diagnosis of common serotypes in our society. Using real-time RT-PCR is recommended for the early diagnosis and the rapid identification of the individuals infected with pandemic influenza virus.

1. Background

Influenza pandemics occur when new influenza A subtypes get widespread among the population. Over the past few years, the global spread of highly pathogenic avian influenza A (H5N1) and the beginning of the pandemic influenza A (pH1N1) have raised concerns about the global ranking of influenza. The use of antiviral drugs (mainly oseltamivir) combined with vaccines is the response to influenza pandemics (1). Influenza A (H1N1) virus infects young and healthy adults suggesting that this group are more susceptible to the disease. It is possible that some level of cross protection antibodies exist in older people. High risk groups for this disease include pregnant women, old people, and people with serious medical illness (2).
Symptoms of pandemic influenza consist of fever, cough, body pain, headache, sore throat, and gastrointestinal complications. This illness is mostly self-limited, thus, a large proportion of infected patients do not get registered in health centers and the Statistics estimating the disease are not correct (3). The definition of influenza A (H1N1) was having high grade fever (upper than 38°C) or at least having two symptoms of respiratory disease. A confirmed case of influenza A (H1N1) was defined as a patient with high grade fever (> 38°C) or at least two of respiratory symptoms. The patient have H1N1 viral infection should be also confirmed by reverse transcriptase PCR (RT-PCR) (4-6).
Some cases have a high incidence of local transmission (such as in New York), but many other cases have led to low transmission or no secondary transmission. The mortality of influenza virus is low (2 % of hospitalized patients), but its morbidity is high (7). To control the influenza A H1N1 infection, early diagnosis with a cost-effective, rapid, and effectual assay is necessary, exclusively in developing countries. Using real time RT-PCR assay compared with other molecular techniques is recommended for the early diagnosis and the rapid identification of individuals infected with pandemic influenza virus. Fast and accurate detection of influenza improves medical handling by proper conditions of prophylaxis, rapid treatment, and appropriate management plans for public health responses to the outbreaks and the avoidance of unnecessary treatment (8).
Influenza virus infection is not detectable only with symptoms. The clinical picture of the disease Is similar to respiratory syncytial virus, parainfluenza viruses, adenoviruses, coronaviruses, and metapneumovirus (9). Correct diagnosis is urgent for the identification of pandemic influenza, surveillance, and public health interventions. Without practical laboratory tests, it is not possible to provide appropriate response efforts (10).

2. Objectives

The aim of the present study was the investigation of clinical and epidemiological figure of influenza virus A/H1N1, A/H3N2, and influenza B infection among patients with respiratory syndrome in Golestan province, the Southeast of Caspian see, Iran, 2011 to 2014.

3. Methods

3.1. Specimens

This prospective, cross sectional study took place since November 2010 through March 2014. The study population was inclusive of all suspected specimens of pandemic influenza A (H1N1) virus infection who had attended hospitals and healthcare centers in Golestan province over the study period. All patients with symptoms like influenza were included in this study and often had high grade fever (> 38°C) or any of respiratory symptoms.
Suspected cases of influenza were confirmed using a Real-time reverse-transcriptase-polymerase-chain-reaction (rRT-PCR) assay at the laboratory of influenza research center in Golestan University of Medical Sciences according to the recommended protocol of the U.S. center for disease control and prevention (CDC) (11).
In this study, the center of influenza received 790 specimens. Acceptable specimen types were given nasopharyngeal (NP) swab. Following the specimen collection in the health care center, Specimens were placed in viral transport medium and were transported to the Influenza center on cold packs.

3.2. Sample Processing and RNA Extraction

Specimens were processed for RNA extraction. The extractions were performed following the protocols supplied with high pure viral RNA extraction kit (Roche Diagnostics, Germany).

3.3. One Step Real-Time PCR Testing

After RNA extraction with High pure viral RNA extraction kit (Roche, Germany), specimens were tested for influenza A and B viruses using TaqMan probes real-time RT-PCR (rRT-PCR) according to the manual of Centers for Disease Control and Prevention (CDC) and by Invitrogen SuperScript III Platinum one step qRT- PCR kit. The subtype of influenza virus was determined for positive influenza A specimen. The subtyping consisted of A/H3 influenza (hemagglutinin gene), A pandemic (H1N1) 2009 virus (hemagglutinin gene), and Influenza B virus (nucleoprotein gene).
PCR was performed in 25 µL volumes containing 12.5 µL 2xrxn Buffer, 10 µM of each primer (40 µM of Influenza A primers), 5 pmol of probe, 0.5 µL of Rox, 2.5 unit of Enzyme mix and 5 µl of RNA template. The reaction was carried out in a 7300 ABI Real time PCR and with the following settings: 50°C for 30 minutes, 95°C for 5 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing and extension 60°C for 30 seconds (Table 1).
Table 1.
The List of Used Primer and Probe Set
NameSequence (5’ > 3’)Working Concentration, µM
Influenza APrimer FGACCRATCCTGTCACCTCTGAC40
Primer RAGGGCATTYTGGACAAAKCGTCTA40
ProbeaTGCAGTCCTCGCTCACTGGGCACG10
SW Inf APrimer FGCACGGTCAGCACTTATYCTRAG10
Primer RGTGRGCTGGGTTTTCATTTGGTC10
ProbebCYACTGCAAGCCCA”T” ACACACAAGCAGGCA10
H3N2Primer FAAGCATTCCYAATGACAAACC10
Primer RATTGCRCCRAATATGCCTCTAGT10
ProbeCAGGATCACATATGGGSCCTGTCCCAG10
Influenza BPrimer FGAGACACAATTGCCTACCTGCTT10
Primer RTTCTTTCCCACCGAACCAAC10
ProbeAGAAGATGGAGAAGGCAAAGCAGAACTAGC10
RNAase PPrimer FAGATTTGGACCTGCGAGCG10
Primer RGAGCGGCTGTCTCCACAAGT10
ProbeTTCTGACCTGAAGGCTCTGCGCG10
aTaqMan probes consist of FAM reporter (5’-end with the reporter molecule 6-carboxyfluorescein) and BHQ1quencher (Blackhole Quencher 1) at the 3’-end.
bQuenched internally at a modified”T” residue with BHQ1, to prevent probe extension by Taq polymerase (11).

4. Results

Among a total of 790 suspected cases, the following results were obtained: the number of influenza cases was 68 (8.6%) which among the proportion of influenza A/H3N2 was 21 (30.8%), influenza A/pdmH1N1 25 (36.7%), and influenza B 22(32.3%) (Table 2). Among the 790 suspected cases, male cases accounted for 72 and female cases for 718 patients. In confirmed cases 7 (10.3%) were male and 61 (89.7%) were female. The mean age was 29.79 years (SD = 16.0, ranging from < 1 days old to 92 years old). The greatest number of confirmed cases occurred in the age group of 25 to 34 years, accounting for 354 (44.8%) of all cases, followed by 227 (28.7%) in 15 to 24 years and the lowest number was in ≥ 65 years, with 22 cases (2.8%) of all cases.
Table 2.
The Frequency of Influenza Viruses and the Proportion for Influenza Type /Subtype by Year and Demographic Characteristicsa
CharacteristicsNo. Samples TestedNo. of Influenza CasesNo. of Influenza Cases
A (H3N2)A (H1N1) pdm09Type BType A and B
Year
2010 - 201479068 (8.6)21 (30.8)25 (36.7)22 (32.3)0
Gender
Male727 (10.3)4 (57.1)1 (14.3)2 (28.6)0
Female71861 (89.7)17 (27.9)24 (39.3)20 (32.8)0
Age group, y
1 to 14322 (2.9)1 (50)1 (50)00
15 to 2422720 (29.4)5 (25)8 (40)7 (35)0
25 - 3435428 (41.2)8 (28.6)12 (42.8)8 (28.6)0
35 to 44839 (13.2)5 (55.6)3 (33.3)1 (11.1)0
45 to 54424 (5.9)004 (100)0
55 to 64303 (4.4)2 (66.7)1 (33.3)00
Over 65222 (2.9)002 (100)0
Total79068 (8.6)21 (30.8)25 (36.7)22 (32.3)0
aValues are expressed as No. (%).
Among the total cases, 244 (30.9%) were hospitalized of which 16 (23.5%) were confirmed cases of influenza. From a total of 790 suspected cases, 283 (35.8%) were pregnant women including 28 (41.2%) confirmed cases (Tables 3 and 4). The most signs were cough (88.7%) and fever (84.3%). As shown in Figures 1 and 2, the highest incidence of confirmed cases occurred in December.
Table 3.
The Comparison of Variable Features in Confirmed and Unconfirmed Cases of Pandemic Influenza A and B Virusa
VariableConfirmed Cases (68 Cases)Unconfirmed Cases (722 Cases)P Value
SexMale7 (10.3)65 (9)0.07
Female61 (89.7)657 (91)
ResidencyUrban21 (30.9)216 (29.9)0.5
Rural47 (69.1)506 (70.1)
HospitalizationYes16 (23.5)228 (31.6)0.2
No52 (76.5)494 (48.4)
PregnancyYes28 (41.2)255 (35.3)0.01
No40 (58.8)467 (64.7)
aValues are expressed as No. (%).
Table 4.
Clinical Symptoms and the Tests of 68 Cases of Influenza A and Ba
Positive SampleClinical Symptoms and Tests
FeverCoughMyalgiaSore throatRhinorrhea
pH1N124 (96)24 (96)22 (88)10 (40)15 (60)
H3N220 (95.2)19 (90.4)16 (76.1)11 (52.3)12 (57.1)
B20 (90.9)21 (95.4)16 (72.7)16 (72.7)11 (50)
aValues are expressed as No. (%).
Frequency of Unconfirmed and Confirmed Cases of Pandemic Influenza A (pH1N1), H3N2, and Influenza B Based on the Month of Occurrence
Figure 1.
Frequency of Unconfirmed and Confirmed Cases of Pandemic Influenza A (pH1N1), H3N2, and Influenza B Based on the Month of Occurrence
Age Distribution of Influenza Virus Types and Subtypes
Figure 2.
Age Distribution of Influenza Virus Types and Subtypes

5. Discussion

Influenza virus infection can spread rapidly and that is responsible for morbidity and mortality each year in the world. Mutations in the genes of the influenza virus lead to diseases with different symptoms. Therefore, it is important to identify the symptoms in different areas. Checking the symptoms can help in the diagnosis of the disease and its treatment. Chronic respiratory diseases as well as hypertension, diabetes mellitus, and pregnancy were the most common risk factors in the sever disease. Moreover, acute respiratory distress syndrome and viral pneumonia were the most common clinical causes of mortality (7, 12).
In this study, out of 790, the suspected number of influenza cases was 68 (8.6%) among which the proportion of influenza A/ pdmH1N1was 25 (36.7%). Although in Monsef’s study (2013) in Hamadan out of 180 patients, 63.8% were H1N1 positive. In Dashti-Khavidaki’s study (2009, Tehran), 34.5%, which was consistent with our results. In Afrasiabian’s study (2009, Kurdestan), 14.8%; Jedary Seifi’s study (2014 Tabriz), 20.3%; and Gao et al.’s (2009, USA), 19.5% were H1N1 positive (3, 7, 12-14). After several years of the 2009 pandemic outbreaks, H1N1pdm09 was, still, the dominant circulating strain. This was supported by world health organization in 2010 which says that the pandemic strains may circulate as seasonal viruses.
Influenza A/H3N2, in our result, was 21 (30.8%), also, in the study by Haghshenas (2011 - 2013) in which a total number of 201 patients (35.2%) were diagnosed with influenza A1 H3N2 infection. Contrary to Hajikhezri’s study which was 6.8%. Burden of influenza B in our study was 32.3%, also, in Gaini et al.’s in global influenza B study (2000 to 2013) was 22.6%, and in Qi et al.’s (2011 - 2015), influenza B was 34.1% (15-18). In the current research, fever (96%), cough (96%), and myalgia (88%) were the most common symptoms among the infected patients with pH1N1, but Rhino rhea and sore throat were present only in 60% and 40% of the patients, respectively (Table 5). These observations were in accordance with the results obtained in other studies, finally, it was found that fever, cough, and myalgia were the best diagnostic model for H1N1infection (19).
Table 5.
The Comparison of the Frequency of Influenza Viruses and the Proportion of Influenza Type
StudyYearInfluenza Cases, %
A (H3N2)A (H1N1) pdm09Type B
Dashti-Khavidaki et al.2009Iran-Tehran-34.5-
Afrasiabian et al.2009Iran-Kurdestan-14.8-
Gao et al.2009USA-19.5-
Monsef et al.2013Iran-Hamedan-63.8-
Jedary Seifi et al.2014Iran-Tabriz-20.3-
Haghshenas et al.2011 - 2013Iran-Mazandaran35.2--
Hajikhezri et al.2009 - 2010Iran-Ahvaz6.8-0.7
Gaini et al.200 - 2013Global study--22.6
Qi et al.2011 - 2015china44.72134.1
In this study, among the confirmed cases, 7 (10.3%) were male and 61 (89.7%) were female. Also, Li et al. in 2011 in a their study reported that female subjects with influenza A are higher than males (20). Also, this point was reported by other researchers (21-23). And in Cao et al.’s study, male subjects were higher, however, Caini et al. presented that sexes were equally distributed (15). And in Cao et al.’s study, there was no sex difference in the incidence of confirmed pandemic influenza A (H1N1) (24). The mean age of the confirmed cases in the present study was 29.7 years and this was similar to other studies. In this study, there were 22 people aged > 65 years. The lower level of infection and susceptibility to influenza virus in this age group compared with younger age groups can be explained by pre-existing immunity, lower chances of being in crowded places, and fewer contacts with other people (2).
In this study, the peak incidence of the disease occurred in December and, considering the age group of samples, these peaks can be attributed to the transmission of the disease in universities and schools (2). In the last of the pandemic influenza, fast and accurate patient identification remains crucial in preventing the extensive transmission (2).
In conclusion, the outbreak of pandemic Influenza viruses in recent years has created a lot of deaths and financial losses around the world. This result shows the importance of the rapid identification of common serotypes in our society. The detection of antigenic types of circulating viruses has a great importance in vaccine preparation for high-risk individuals. Therefore, using RT-PCR is recommended for early diagnosis and rapid identification of individuals infected with pandemic influenza virus. In addition, it can accelerate vaccine manufacture. Molecular methods should be used in vaccine manufacturing in cases of acute infections. Moreover, Scheduling the urgent influenza A vaccination program is suggested, which can definitely prevent the spread of the virus.

Acknowledgments

References

  • 1.
    Steain MC, Dwyer DE, Hurt AC, Kol C, Saksena NK, Cunningham AL, et al. Detection of influenza A H1N1 and H3N2 mutations conferring resistance to oseltamivir using rolling circle amplification. Antiviral Res. 2009;84(3):242-8. [PubMed ID: 19800370]. https://doi.org/10.1016/j.antiviral.2009.09.010.
  • 2.
    Panning M, Eickmann M, Landt O, Monazahian M, Olschlager S, Baumgarte S, et al. Detection of influenza A(H1N1)v virus by real-time RT-PCR. Euro Surveill. 2009;14(36). [PubMed ID: 19758541].
  • 3.
    Afrasiabian S, Mohsenpour B, Bagheri KH, Barari M, Ghaderi E, Hashemi R, et al. Epidemiological survey on pandemic influenza A (H1N1) virus infection in Kurdistan province, Islamic Republic of Iran, 2009. East Mediterr Health J. 2014;20(3):169-74. [PubMed ID: 24950074].
  • 4.
    Bakhshayeshkaram M, Saidi B, Tabarsi P, Zahirifard S, Ghofrani M. Imaging Findings in Patients With H1N1 Influenza A Infection. Iran J Radiol. 2011;8(4):230-4. [PubMed ID: 23329946]. https://doi.org/10.5812/iranjradiol.4554.
  • 5.
    Nateghian A, Dadras M, Gouya MM, Nabavi M, Soroush M, Hooman N, et al. Pandemic Flu in Islamic Republic of Iran; A Review of Health System Response From July to November. Arch Pediatr Infect Dis. 2013;1(2):80-6. https://doi.org/10.5812/pedinfect.9074.
  • 6.
    Yavarian J, Naseri M, Shadab A, Shafiei Jandaghi NZ, Mokhtari Azad T. Epidemiological aspects of pandemic influenza A(H1N1) virus from 2009 to 2011 in Iran. Influenza Other Respir Viruses. 2012;6(6):e74-6. [PubMed ID: 22487173]. https://doi.org/10.1111/j.1750-2659.2012.00357.x.
  • 7.
    Monsef F, Esmaeili R, Eghbalian F, Pourhossein A, Khiabanchian O, Monsef A. Is there yet influenza virus A/H1N1 infection in Hamadan, Iran? : A cross-sectional serological study in lower the age of 16. Life Sci J. 2013;10:123-6.
  • 8.
    Ma XJ, Shu YL, Nie K, Qin M, Wang DY, Gao RB, et al. Visual detection of pandemic influenza A H1N1 Virus 2009 by reverse-transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye. J Virol Methods. 2010;167(2):214-7. [PubMed ID: 20381535]. https://doi.org/10.1016/j.jviromet.2010.03.027.
  • 9.
    Dwyer DE, Smith DW, Catton MG, Barr IG. Laboratory diagnosis of human seasonal and pandemic influenza virus infection. Med J Aust. 2006;185(10 Suppl):S48-53. [PubMed ID: 17115952].
  • 10.
    Jernigan DB, Lindstrom SL, Johnson JR, Miller JD, Hoelscher M, Humes R, et al. Detecting 2009 pandemic influenza A (H1N1) virus infection: availability of diagnostic testing led to rapid pandemic response. Clin Infect Dis. 2011;52 Suppl 1:S36-43. [PubMed ID: 21342897]. https://doi.org/10.1093/cid/ciq020.
  • 11.
    Geneva F. CDC protocol of real time RT-PCR for swine influenza A (H1N1). 2009.
  • 12.
    Jedary Seifi S, Sabouri Ghannad M. Comparison of Real-Time Polymerase Chain Reaction and Conventional Cell Culture for Detection of Influenza A in Tabriz, Iran. Avicenna J Clin Microbiol Infect. 2014;1(2). https://doi.org/10.17795/ajcmi-21034.
  • 13.
    Dashti-Khavidaki S, Khalili H, Gholamalipour F, Soudbakhsh A, Talasaz AH, Hajabdolbaghi M, et al. Approach to Pandemic 2009 influenza: first report from a main referral hospital for Pandemic H1N1 influenza care in Iran. J Infect Dev Ctries. 2010;4(10):629-35. [PubMed ID: 21045355].
  • 14.
    Gao F, Loring C, Laviolette M, Bolton D, Daly ER, Bean C. Detection of 2009 pandemic influenza A(H1N1) virus Infection in different age groups by using rapid influenza diagnostic tests. Influenza Other Respir Viruses. 2012;6(3):e30-4. [PubMed ID: 22114876]. https://doi.org/10.1111/j.1750-2659.2011.00313.x.
  • 15.
    Caini S, Huang QS, Ciblak MA, Kusznierz G, Owen R, Wangchuk S, et al. Epidemiological and virological characteristics of influenza B: results of the Global Influenza B Study. Influenza Other Respir Viruses. 2015;9 Suppl 1:3-12. [PubMed ID: 26256290]. https://doi.org/10.1111/irv.12319.
  • 16.
    Haghshenas M, Jafarian E, Babamahmoodi F, Tabrizi A, Nandoost S, Alizadeh-Navaei R. Prevalence of influenza A/H3N2 virus in northern Iran from 2011 to 2013. Caspian J Intern Med. 2015;6(2):116-9. [PubMed ID: 26221512].
  • 17.
    Hajikhezri Z, Makvndi M, Samarbaf-zadeh AR, Neisi N, Ahmadi K. Relative frequency of seasonal influenza A and B in Khuzestan province by reverse transcription-polymerase chain reaction (RT-PCR) during 2009-2010. Jundishapur J Microbiol. 2013;6(4). ee5312. https://doi.org/10.5812/jjm.5312.
  • 18.
    Qi L, Xiong Y, Xiao B, Tang W, Ling H, Long J, et al. Epidemiological and Virological Characteristics of Influenza in Chongqing, China, 2011-2015. PLoS One. 2016;11(12):e0167866. [PubMed ID: 27936139]. https://doi.org/10.1371/journal.pone.0167866.
  • 19.
    Kim CO, Nam CM, Lee DC, Han SH, Lee JW. Clinical predictors of novel influenza A (H1N1)infection in Korea. Yonsei Med J. 2010;51(6):895-900. [PubMed ID: 20879057]. https://doi.org/10.3349/ymj.2010.51.6.895.
  • 20.
    Li T, Liu Y, Di B, Wang M, Shen J, Zhang Y, et al. Epidemiological investigation of an outbreak of pandemic influenza A (H1N1) 2009 in a boarding school: serological analysis of 1570 cases. J Clin Virol. 2011;50(3):235-9. [PubMed ID: 21195022]. https://doi.org/10.1016/j.jcv.2010.11.012.
  • 21.
    Afzali H, Nematian M, Rajabi J, Soleimani Z, Momen-Heravi M, Salehi A, et al. Epidemiological survey of confirmed influenza A (H1N1) in Kashan, Aran and Bidgol cities during 2009-10. Feyz J Kashan Univ Med Sci. 2011;15(3).
  • 22.
    Saleh P, Noshad H, Naghili B. Demographic and Paraclinical Findings of Patients with Novel H1N1 Infection Hospitalized in Infectious Disease Ward, Sina Hospital, Tabriz, Iran. ZUMS J. 2011;19(75):84-93.
  • 23.
    Shiley KT, Nadolski G, Mickus T, Fishman NO, Lautenbach E. Differences in the epidemiological characteristics and clinical outcomes of pandemic (H1N1) 2009 influenza, compared with seasonal influenza. Infect Control Hosp Epidemiol. 2010;31(7):676-82. [PubMed ID: 20500086]. https://doi.org/10.1086/653204.
  • 24.
    Cao B, Li XW, Mao Y, Wang J, Lu HZ, Chen YS, et al. Clinical features of the initial cases of 2009 pandemic influenza A (H1N1) virus infection in China. N Engl J Med. 2009;361(26):2507-17. [PubMed ID: 20007555]. https://doi.org/10.1056/NEJMoa0906612.

Copyright

Copyright © 2017, Ahvaz Jundishapur University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

10
Jun
2013

Relative Frequency of Seasonal Influenza A and B in Khuzestan Province by Reverse Transcription-Polymerase Chain Reaction (RT-PCR) During 2009-2010

Zamaneh Hajikhezri,
Manoochehr Makvndi,
Ali Reza Samarbaf-zadeh,
Niloofar Neisi,
Kambiz Ahmadi

Hajikhezri Z, Makvndi M, Samarbaf-zadeh AR, Neisi N, Ahmadi K. Relative Frequency of Seasonal Influenza A and B in Khuzestan Province by Reverse Transcription-Polymerase Chain Reaction (RT-PCR) During 2009-2010. Jundishapur J Microbiol. 2013;6(4):e5312. doi: https://doi.org/10.5812/jjm.5312

10
Jun
2019
The Prevalence of Respiratory Viruses Among Patients with Influenza-Like Illness in Zahedan, Southeastern Iran

The Prevalence of Respiratory Viruses Among Patients with Influenza-Like Illness in Zahedan, Southeastern Iran

Farnoosh Sharify Mood,
Seyed Mehdi Tabatabaei,
Batool Sharifi-Mood,
Tahereh Khalili,
Narges Arbabi,
Maliheh Metanat
,et al.

Sharify Mood F, Tabatabaei SM, Sharifi-Mood B, Khalili T, Arbabi N, et al. The Prevalence of Respiratory Viruses Among Patients with Influenza-Like Illness in Zahedan, Southeastern Iran. Arch Clin Infect Dis. 2019;14(3):e77089. doi: https://doi.org/10.5812/archcid.77089

2
Jul
2012

Statistical Study of Clinical Predictors of Influenza A (H1N1) in Iran

Hossain Faramarzi,
Mahdie Khalily Zade,
Maryam Bazrgar,
Negar Panahi,
Behrooz Fathi

Faramarzi H, Khalily Zade M, Bazrgar M, Panahi N, Fathi B. Statistical Study of Clinical Predictors of Influenza A (H1N1) in Iran. Arch Clin Infect Dis. 2012;7(3):88-91. doi: https://doi.org/10.5812/archcid.14385

1
Apr
2014

Prevalence and Mortality of Influenza A (H1N1) Virus Among Patients With Acute Respiratory Infection in Southwest Iran

Seyed Mohammad Alavi,
Roohangiz Nashibi,
Fatemeh Moradpoor

Alavi SM, Nashibi R, Moradpoor F. Prevalence and Mortality of Influenza A (H1N1) Virus Among Patients With Acute Respiratory Infection in Southwest Iran. Jundishapur J Microbiol. 2014;7(4):e9263. doi: https://doi.org/10.5812/jjm.9263

1
Dec
2013

Clinical and Epidemiological Characteristics of Children With Influenza A H1N1 in Khuzestan, Iran During July 2009–April 2010

Manoochehr Makvandi,
Amir Houshang Alvandi,
Ehsan Aryan,
Mohammad-Mehdi Gooya,
Mahmood Sorosh,
Mahmood Nabavi
,et al.

Makvandi M, Alvandi AH, Aryan E, Gooya M, Sorosh M, et al. Clinical and Epidemiological Characteristics of Children With Influenza A H1N1 in Khuzestan, Iran During July 2009–April 2010. Jundishapur J Microbiol. 2013;6(10):e94141. doi: https://doi.org/10.5812/jjm.7873

More by these authors

Naeme JavidPubMedScholar
Abdolvahab MoradiPubMedScholar
Alijan TabarraeiPubMedScholar
Masoud BazouriPubMedScholar
Share
Cited by
Metrics