Patterns of Efflux Pump Genes Among Tetracycline Resistance Uropathogenic Escherichia coli Isolates Obtained From Human Urinary Infections

Authors

Sahar Nouri Gharajalar1,*, Vahideh Hamidi Sofiani2
1Department of Pathobiology, Faculty of Veterinary Medicine, Tabriz University, Tabriz, IR Iran
2Faculty of Veterinary Medicine, Tabriz University, Tabriz, IR Iran
*Corresponding Author: Corresponding author: Sahar Nouri Gharajalar, Department of Pathobiology, Faculty of Veterinary Medicine, Tabriz University, Tabriz, IR Iran. Tel: +98-9141468635, E-mail: Email: [email protected]

Jundishapur Journal of Microbiology:Vol. 10, issue 2; e40884
Published online:Jan 14, 2017
Article type:Research Article
Received:Jul 17, 2016
Accepted:Jan 07, 2017
How to Cite:Nouri Gharajalar S, Hamidi Sofiani V. Patterns of Efflux Pump Genes Among Tetracycline Resistance Uropathogenic Escherichia coli Isolates Obtained From Human Urinary Infections. Jundishapur J Microbiol. 2017;10(2):e40884. doi: https://doi.org/10.5812/jjm.40884

Abstract

Background:

Uropathogenic Escherichia coli is one of the most prevalent infectious agents in humans, but its resistance to commonly used antibiotics is growing rapidly.

Objectives:

The aim of this cross sectional study was to investigate the prevalence of tetracycline resistance determinants in urinary E. coli isolates obtained from patients in Iran.

Methods:

A total of 50 E. coli isolates from human urinary infections were characterized by cultural, biochemical, and molecular tests from 2014 to 2015. Isolates were tested for resistance to tetracycline by disc diffusion method. Then, the prevalence of tetracycline efflux genes (tetA, tetB, tetC, tetD, tetE, tetG, tetH and tetZ) was detected by means of molecular polymerase chain reaction method (PCR).

Results:

Of the 50 E. coli isolates tested, tetracycline resistance was identified in 62% of the strains. PCR analysis revealed that 36% of these isolates contained tetB gene, followed by tetA determinant with 32% frequency. The prevalence of tetG, tetZ, tetC, tetE, tetH, and tetD were 16%, 14%, 12%, 12%, 11%, and 8% among the isolates.

Conclusions:

Tetracycline resistance is widespread among uropathogenic E. coli isolates from human infections. Moreover, the distribution of tetracycline resistance determinants among the studied E. coli was very similar to the findings of the international sourced gallery of clinical E. coli Strains.

1. Background

Escherichia coli is a commensal bacterium living in human and animal intestine, but is also found in many environments such as water, soil, or plants. Moreover, some E. coli strains are able to cause disease of the gastrointestinal, urinary, or central nervous system in the hosts. Intestinal pathogenic E. coli strains are divided into 6 categories as follow: Enteropathogenic E. coli (EPEC); enterohaemorrhagic E. coli (EHEC); enterotoxigenic E. coli (ETEC); enteroinvasive E. coli (EIEC); enteraggregative E. coli (EAEC); and diffusely adherent E. coli (DAEC) (1).
Among the various extraintestinal infections caused by this bacterium, urinary infections are very important in humans (2). Recent reports have indicated that the rate of antibiotic resistance among E. coli isolates is increasing rapidly (3). The main reason for this problem is the widespread clinical use of antimicrobials, which leads to the suppression of susceptible normal flora and rise of resistant strains (4).
Tetracyclines are broad- spectrum antibiotics that act through inhibition of protein synthesis. The suitable antibacterial characteristics of these antibiotics and the absence of any important side effects have led to their widespread use in treating human infections (5). Efflux pumps are transmembrane proteins, which export toxic materials such as antibiotics out of the bacterial cell. Among the prokaryotes, 5 major efflux pumps are detected as follow: MFS (major facilitator super family); MATE (multidrug and toxic efflux); RND (resistance-nodulation-division); SMR (small multi drug resistance); and ABC (ATP binding cassette) (6). Efflux pumps are the most abundant in Gram-negative bacteria, but ribosomal protection mechanisms of resistance is more prevalent in Gram-positive bacteria (7).
Tetracycline efflux pumps belong to FMS group, and most of them export tetracycline from the bacteria but not to minocycline. Only the product of the tetB gene could efflux both antibiotics out of the cell (5). These pumps belong to 6 groups according to amino acid sequence similarities: tetA, tetB, tetC, tetD, tetE, tetG, tetH, tetJ, tetZ, tetI, and tet30 are placed in group 1 (5).

2. Objectives

In the present study, the occurrence of phenotypic tetracycline resistance and carriage of tet resistance genes in uropathogenic E. coli strains was investigated in Iranian patients.

3. Methods

3.1. Isolation and Identification of Uropathogenic E. coli

A total of 50 uropathogenic E. coli isolates from human urinary samples were obtained from the microbiology laboratory of Azerbaijan hospital, Urmia, Iran, from October 2014 to February 2015. All samples belonged to hospitalized patients aged 20 to 40 years. The urine samples were streaked on to MacConkey agar and incubated at 37°C for 24 hours. Then, the plates were examined for E. coli red colonies with a dark red center. Other biochemical tests like indol, methyl red, voges-proskauer, Simmons citrate, and TSI were conducted to confirm the presence of E. coli (8).

3.2. Molecular Characterization of Uropathogenic E. coli

Escherichia coli confirmation was achieved by PCR assay (9). E. coli cultures were grown overnight at 37°C, and the chromosomal DNA was extracted using bacterial genomic purification kit (iNtRON, Korea). Then, the extracted DNA was used as a template for PCR amplification of uropathogenic E. coli 16s rRNA gene by forward primer F: 5/- GTA TAG ATA CCC TGG TAG TCCA-3,/ and reverse primer R: 5/- CCC GGG AAC GTA TTC ACC G-3/. PCR reactions were carried out in the total volume of 25 µL using DNA thermo cycler (MWG AG BIOTECHTHERMAL CYCLER, USA).The conditions used for the PCR assay are as follow: 3 minutes of initial denaturation at 95°C, followed by 26 cycles of 94°C for 1 minute; 55°C for 1 minute, and 72°C for 10 minutes (9). The PCR products were separated by 1% agarose gel electrophoresis stained with red safe (Sigma Aldrich, Germany) and visualized under UV exposure.

3.3. Antibiotic Susceptibility Testing

Tetracycline susceptibility profiles of isolated uropathogenic E. coli were determined via the disc diffusion method (10). A 15 mm Muller-Hinton medium plate was swabbed with nutrient broth inoculated with E. coli and incubated to a turbidity of 0/5 McFarland standard. Commercially tetracycline disks (30 µg) were placed on the inoculated plates (Padtan Teb, Iran). Then, all the plates were incubated aerobically at 37°C for 18 - 20 hours. The diameters zone of inhibition (mm) around the disks were measured and interpreted by referring to the performance standard for antimicrobial susceptibility testing, as described by the clinical and laboratory standards Institute (CLSI) guidelines, 2015 (11). The percentage of E. coli resistant, intermediate and susceptible to tetracycline was determined.

3.4. Identification of Tetracycline Efflux Genes using PCR Assay

3 PCR amplification assays were performed to determine the prevalence of tetA, tetB, tetD, tetE, tetH, tetG, and tetZ among all tetracycline resistant E. coli. Table 1 demonstrates the sets of primers used to identify these determinants (12). The first PCR assay performed to amplify the tetB and tetE genes is as follow: Initial denaturation at 94°C for 1 minute, 25 cycles each consisting of minute at 94°C, minute at 50°C, and 72°C for 10 minutes. The second PCR used to detect tetA and tetD genes was performed as above, but the annealing temperature was 48°C.
Table 1.
Primer Sequences Used for PCR Identification of tetB, tetA, tetE, tetC, tetD, tetG, tetH, and tetZ
PrimerGeneSequences
ForwardtetA5/ GCGCGATCTGGTTCACTCG 3/
ReversetetA5/ AGTCGACAGYRGCGCCGGC 3/
ForwardtetB5/ TACGTGAATTTATTGCTTCGG 3/
ReversetetB5/ ATACAGCATCCAAAGCGCAC 3/
ForwardtetC5/ GCGGGATATCGTCCATTCCG 3/
ReversetetC5/ GCGTAGAGGATCCACAGGACG 3/
ForwardtetD5/ GGAATATCTCCCGGAAGCGG 3/
ReversetetD5/ CACATTGGACAGTGCCAGCAG 3/
ForwardtetE5/ GTTATTACGGGAGTTTGTTGG 3/
ReversetetE5/ AATACAACACCCACACTACGC 3/
ForwardtetG5/ GCAGAGCAGGTCGCTGG 3/
ReversetetG5/ CCYGCAAGAGAAGCAGAAG 3/
ForwardtetH5/ CAGTGAAAATTCACTGGCAAC 3/
ReversetetH5/ ATCCAAAGTGTGGTTGAGAAT 3/
ForwardtetJ5/ CGAAAACAGACTCGCCAATC 3/
ReversetetJ5/ TCCATAATGAGGTGGGGC 3/
ForwardtetZ5/ CCTTCTCGACCAGGTCGG 3/
ReversetetZ5/ ACCCACAGCGTGTCCGTC 3/
The third PCR regimen used to amplify tetH, tetG, and tetZ was carried out as described above, but the annealing temperature was 46°C. Finally, the reaction products were run on 1% agarose gel, and the prevalence of each tetracycline efflux gene was determined using agarose gel electrophoresis. Descriptive statistics, such as the percentage of tetracycline efflux genes, were done using the statistical package, SPSS, Version 15.0.

4. Results

All 50 isolated bacteria from urinary infections, possessed the cultural, morphological, and biochemical characteristics of E. coli. Also, 16s rRNA gene of E. coli were detected in all of the isolates by PCR assay using 16s rRNA universal primers. Figure 1 displays the product of 16s rRNA gene found at 612 bp using 100 bp DNA marker.
Lane M, 100 bp ladder marker; lane 1, positive control; lane 2, 3, <i>E. coli</i> 16s rRNA  gene gound at 612 bp.
Figure 1.
Lane M, 100 bp ladder marker; lane 1, positive control; lane 2, 3, E. coli 16s rRNA gene gound at 612 bp.
The results of antibiotic susceptibility testing in E. coli isolates showed that 31 (62%) of them were phenotypically resistant to tetracycline, 16 (32%) were susceptible, and 3 (6%) showed intermediate susceptibility to tetracycline. Three multiplex PCR assay were developed to monitor the prevalence of resistance determinants for tetracycline. The results are presented in Figures 2 - 4.
Lane M, 50 bp ladder marker; lane 2, <i>tetE</i> gene found at 199 bp; lane 3, 4, <i>tetB</i> gene found at 206 bp.
Figure 2.
Lane M, 50 bp ladder marker; lane 2, tetE gene found at 199 bp; lane 3, 4, tetB gene found at 206 bp.
Lane M, 50 bp ladder marker; lane 8, <i>tetA </i>(164 bp) and <i>tetC</i> (207 bp).
Figure 3.
Lane M, 50 bp ladder marker; lane 8, tetA (164 bp) and tetC (207 bp).
Lane M, 50 bp ladder marker; lane 1, <i>tetH</i> (187 bp); lane 3, <i>tetG</i> (133 bp and <i>tetZ</i> (204 bp).
Figure 4.
Lane M, 50 bp ladder marker; lane 1, tetH (187 bp); lane 3, tetG (133 bp and tetZ (204 bp).
The frequency and distribution of tetracycline resistance genes among E. coli strains used in the presented study are demonstrated in Table 2.
Table 2.
The Frequency of Tetracycline Efflux Genes in E. coli Obtained from Patients with Urinary Infections
SampletetZtetGtetHtetDtetCtetAtetEtetB
Frequencya141681112321236
aValues are expressed as %.
The results of the present study revealed that all tetracycline resistant isolates carried at least 1 of the tet determinants examined; tetB was the most prevalent gene detected in 36% of the resistance isolates, followed by tetA (32%), and tet A + B (18%). Moreover, tetC, tetE, tetG, tetD, and tetZ were found to have lower frequencies. However, the lowest prevalent gene among the studied determinants belonged to tetH (8%).

5. Discussion

Among 50 E. coli strains isolated from patients with urinary infections, 31 strains showed resistance to tetracycline. Monitoring the distribution prevalence of tetracycline resistance genes, we found that the tetB gene had the highest frequency among the studied determinants. Escherichia coli is a facultative Gram-negative bacterium, which can cause many infections, like diarrhea, urinary tract infections, meningitis, peritonitis, and septicemia in humans (13). However, the most prevalent form of the extraintestinal infection caused by E. coli is urinary tract infection (14).
Antibiotic resistance in E. coli has emerged and increased in many countries and led to the difficult treatment of infectious bacteria (2). In the present study, 62% of human E. coli strains were resistant to tetracycline, which supported the above hypothesis. Tetracyclines are broad-spectrum antibiotics that are used for treatment and prevention of human infections (15). Chlortetracycline was the first tetracycline identified in the late 1940s (16). However, heavy clinical use of tetracyclines has a major role in the emergence and dissemination of tetracycline resistance among infectious bacteria (17).
Different tet genes are responsible for tetracycline resistance in Gram- negative bacteria like E. coli (15). However, the most common tet resistance mechanism in E. coli is tetracycline efflux pumps, which exports the drug out of the cell (17). These proteins belong to 6 groups: tetA, tetB, tetC, tetD, tetG, tetH, tetZ , tetE, tetI, and tet30 that are placed in Group 1. Several investigations have studied tetracycline resistance in bacteria by examining their ability to grow in the presence of drugs, but these studies are not useful for determining the types of tetracycline resistance determinants responsible for antibiotic resistance in bacteria (7). On the Other hand, molecular microbiology techniques can accurately describe genetic basis of antibiotic resistance in bacteria (18).
In the present study, the molecular PCR assay was also used to determine the tetracycline resistance genes prevalence among E. coli isolates. In 2006, Karami et al. studied the prevalence of tetracycline resistance genes in intestinal E. coli strains and identified tetB and tetA as the most common tetracycline resistance genes in human E. coli (10). Our findings about the frequency of tetracycline resistance genes in urinary E. coli are in agreement with their results.
In 2007, Tuckman et al. examined the occurrence of tetracycline resistance genes among E. coli isolated from patients and found that tetA and tetB had the highest frequency among the studied determinants. In the present study, the same determinants had the highest occurrence among tetracycline efflux genes belonging to Group 1. The results of monitoring the prevalence of tetracycline resistance genes in E. coli strains isolated from human urinary infections, confirmed the emergence and spreading of the resistant E. coli in human populations.

Footnotes

  • Financial Disclosure:We have no financial interests related to the material in the manuscript.

  • Conflict of Interest:This work was financially supported by Tabriz University.

References

  • 1.
    Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2(2):123-40. [PubMed ID: 15040260]. https://doi.org/10.1038/nrmicro818.
  • 2.
    Kibret M, Abera B. Antimicrobial susceptibility patterns of E. coli from clinical sources in northeast Ethiopia. Afr Health Sci. 2011;11 Suppl 1:S40-5. [PubMed ID: 22135643].
  • 3.
    Schroeder CM, Zhao C, DebRoy C, Torcolini J, Zhao S, White DG, et al. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. Appl Environ Microbiol. 2002;68(2):576-81. [PubMed ID: 11823193].
  • 4.
    Raum E, Lietzau S, von Baum H, Marre R, Brenner H. Changes in Escherichia coli resistance patterns during and after antibiotic therapy: a longitudinal study among outpatients in Germany. Clin Microbiol Infect. 2008;14(1):41-8. [PubMed ID: 18005177]. https://doi.org/10.1111/j.1469-0691.2007.01841.x.
  • 5.
    Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;65(2):232-60. second page, table of contents. [PubMed ID: 11381101]. https://doi.org/10.1128/MMBR.65.2.232-260.2001.
  • 6.
    Webber MA, Piddock LJ. The importance of efflux pumps in bacterial antibiotic resistance. J Antimicrob Chemother. 2003;51(1):9-11. [PubMed ID: 12493781].
  • 7.
    Bryan A, Shapir N, Sadowsky MJ. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl Environ Microbiol. 2004;70(4):2503-7. [PubMed ID: 15066850].
  • 8.
    Sayah RS, Kaneene JB, Johnson Y, Miller R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic- and wild-animal fecal samples, human septage, and surface water. Appl Environ Microbiol. 2005;71(3):1394-404. [PubMed ID: 15746342]. https://doi.org/10.1128/AEM.71.3.1394-1404.2005.
  • 9.
    Sharma S, Mahajan B, Patidar RK, Sahare KN, Khare M, Singh V. Molecular Detection of Antimicrobial Resistance Genes in Biofilm Forming Escherichia Coli. Am J Pharm Health Res. 2013;1:2321-3647.
  • 10.
    Karami N, Nowrouzian F, Adlerberth I, Wold AE. Tetracycline resistance in Escherichia coli and persistence in the infantile colonic microbiota. Antimicrob Agents Chemother. 2006;50(1):156-61. [PubMed ID: 16377681]. https://doi.org/10.1128/AAC.50.1.156-161.2006.
  • 11.
    CLSI, document. : M 100-S25. Performance standards for antimicrobial susceptibility testing. 25nd informational supplement. Wayne, USA; 2015.
  • 12.
    Aminov RI, Chee-Sanford JC, Garrigues N, Teferedegne B, Krapac IJ, White BA, et al. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of gram-negative bacteria. Appl Environ Microbiol. 2002;68(4):1786-93. [PubMed ID: 11916697].
  • 13.
    Hammerum AM, Heuer OE. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin Infect Dis. 2009;48(7):916-21. [PubMed ID: 19231979]. https://doi.org/10.1086/597292.
  • 14.
    Shariff V, Shenoy MS, Yadav T, M R. The antibiotic susceptibility patterns of uropathogenic Escherichia coli, with special reference to the fluoroquinolones. J Clin Diagn Res. 2013;7(6):1027-30. [PubMed ID: 23905095]. https://doi.org/10.7860/JCDR/2013/4917.3038.
  • 15.
    Ozgumus OB, Celik-Sevim E, Alpay-Karaoglu S, Sandalli C, Sevim A. Molecular characterization of antibiotic resistant Escherichia coli strains isolated from tap and spring waters in a coastal region in Turkey. J Microbiol. 2007;45(5):379-87. [PubMed ID: 17978796].
  • 16.
    Jones CH, Tuckman M, Murphy E, Bradford PA. Identification and sequence of a tet(M) tetracycline resistance determinant homologue in clinical isolates of Escherichia coli. J Bacteriol. 2006;188(20):7151-64. [PubMed ID: 17015654]. https://doi.org/10.1128/JB.00705-06.
  • 17.
    Tuckman M, Petersen PJ, Howe AY, Orlowski M, Mullen S, Chan K, et al. Occurrence of tetracycline resistance genes among Escherichia coli isolates from the phase 3 clinical trials for tigecycline. Antimicrob Agents Chemother. 2007;51(9):3205-11. [PubMed ID: 17620376]. https://doi.org/10.1128/AAC.00625-07.
  • 18.
    Blake DP, Humphry RW, Scott KP, Hillman K, Fenlon DR, Low JC. Influence of tetracycline exposure on tetracycline resistance and the carriage of tetracycline resistance genes within commensal Escherichia coli populations. J Appl Microbiol. 2003;94(6):1087-97. [PubMed ID: 12752819].

Copyright

Copyright © 2017, Ahvaz Jundishapur University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Similar Articles

10
May
2021
Detection of Phylogenetic Groups and Drug Resistance Genes of Escherichia coli Causing Urinary Tract Infection in Southwest Iran

Detection of Phylogenetic Groups and Drug Resistance Genes of Escherichia coli Causing Urinary Tract Infection in Southwest Iran

Mostafa Boroumand,
Mohsen Naghmachi,
Mohammad Amin Ghatee

Boroumand M, Naghmachi M, Ghatee MA. Detection of Phylogenetic Groups and Drug Resistance Genes of Escherichia coli Causing Urinary Tract Infection in Southwest Iran. Jundishapur J Microbiol. 2021;14(2):e112547. doi: https://doi.org/10.5812/jjm.112547

15
Aug
2018
Investigation of P Fimbriae Presence in Escherichia coli Strains Isolated from Urine Samples in Human, and Their Antibacterial Resistance

Investigation of P Fimbriae Presence in Escherichia coli Strains Isolated from Urine Samples in Human, and Their Antibacterial Resistance

Emel Inegol Paykoc,
Suheyla Turkyilmaz

Inegol Paykoc E, Turkyilmaz S. Investigation of P Fimbriae Presence in Escherichia coli Strains Isolated from Urine Samples in Human, and Their Antibacterial Resistance. Jundishapur J Microbiol. 2018;11(9):e66119. doi: https://doi.org/10.5812/jjm.66119

7
Feb
2015

Virulence Genes and Antimicrobial Resistance Pattern in Uropathogenic Escherichia coli Isolated From Hospitalized Patients in Kashan, Iran

Foroogh Neamati,
Farzaneh Firoozeh,
Mahmood Saffari,
Mohammad Zibaei

Neamati F, Firoozeh F, Saffari M, Zibaei M. Virulence Genes and Antimicrobial Resistance Pattern in Uropathogenic Escherichia coli Isolated From Hospitalized Patients in Kashan, Iran. Jundishapur J Microbiol. 2015;8(2):e17514. doi: https://doi.org/10.5812/jjm.17514

15
Feb
2025
Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran

Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran

Mehdi Bozorgi Mazandarani,
Mohammad Kargar,
Farshid Kafilzadeh

Bozorgi Mazandarani M, Kargar M, Kafilzadeh F. Molecular Characterization of ESBL and Carbapenemase-Producing Uropathogenic Escherichia coli in Hospitalized Patients, Tehran, Iran. Jundishapur J Microbiol. 2025;18(2):e156768. doi: https://doi.org/10.5812/jjm-156768

27
Feb
2019
Distribution of Virulence and Antimicrobial Resistance Genes in Phylogenetic Groups of Escherichia coli Strains Isolated from Mexican Patients with Urinary Infection

Distribution of Virulence and Antimicrobial Resistance Genes in Phylogenetic Groups of Escherichia coli Strains Isolated from Mexican Patients with Urinary Infection

Juan Carlos Bravata-Alcantara,
Juan Manuel Bello-Lopez,
Iliana Alejandra Cortes-Ortiz,
Juan Jose Mendez-Velazquez,
Brandon Aviles-Soto,
Laura Itzel Quintas-Granados
,et al.

Bravata-Alcantara JC, Bello-Lopez JM, Cortes-Ortiz IA, Mendez-Velazquez JJ, Aviles-Soto B, et al. Distribution of Virulence and Antimicrobial Resistance Genes in Phylogenetic Groups of Escherichia coli Strains Isolated from Mexican Patients with Urinary Infection. Jundishapur J Microbiol. 2019;12(3):e83711. doi: https://doi.org/10.5812/jjm.83711

More by these authors

Sahar Nouri GharajalarPubMedScholar
Vahideh Hamidi SofianiPubMedScholar
Share
Cited by
Metrics