Evaluation of Virulence Factors and Antibiotic Resistance Patterns in Clinical Urine Isolates of Klebsiella pneumoniae in Semnan, Iran

Author(s):
Ali Jazayeri MoghadasAli Jazayeri Moghadas1, Farzaneh KalantariFarzaneh Kalantari2, Mohammad SarfiMohammad Sarfi3, Soroush ShahhoseiniSoroush Shahhoseini3, Shiva MirkalantariShiva Mirkalantari4,*
1Bacteriology and Virology Department, Medicine Faculty, Semnan University of Medical Sciences, Semnan, Iran
2Laboratory Technical Officer, Shafa Hospital, Semnan, Iran
3Student Research Committee, Semnan University of Medical Sciences, Semnan, Iran
4Department of Microbiology, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran

Jundishapur Journal of Microbiology:Vol. 11, issue 7; e63637
Published online:Jun 09, 2018
Article type:Research Article
Received:Nov 04, 2017
Accepted:Apr 29, 2018
How to Cite:Jazayeri Moghadas A, Kalantari F, Sarfi M, Shahhoseini S, Mirkalantari S. Evaluation of Virulence Factors and Antibiotic Resistance Patterns in Clinical Urine Isolates of Klebsiella pneumoniae in Semnan, Iran. Jundishapur J Microbiol. 2018;11(7):e63637. doi: https://doi.org/10.5812/jjm.63637

Abstract

Background:

Klebsiella pneumoniae as an opportunistic pathogen can be the cause of a range of nosocomial and community - acquired infections. Many virulence factors help these bacteria overcome an immune system and cause various diseases. K1 and K2 capsular antigens, also magA, wcaG, and rmpA are well - known K. pneumoniae virulence factors. Klebsiella pneumoniae has been revealed to have the ability to acquire resistance to many antibiotics, which cause treatment failure.

Objectives:

This study aimed at determining the prevalence of magA, wcaG, rmpA, Capsular type K1, Capsular type K2, TEM, and SHV in K. pneumoniae isolates.

Methods:

A total of 173 non - duplicate K. pneumoniae isolates were collected from two different hospitals in Semnan, Iran, from urine specimens. Klebsiella pneumoniae was identified by conventional bacteriological tests. Disk diffusion test was performed according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI). Detection of virulence factors, TEM, and SHV gene was performed by specific primers.

Results:

Frequency of virulence factors was as follow: capsular type K2: 32.9%, rmpA: 20.2%, capsular type K1: 6.9%, and wcaG: 16.2%. Also, the SHV and TEM were observed in 46.8% and 33.5%, respectively. Antibiotics resistance rates were as follow, imipenem: 7.5%, ciprofloxacin: 16.1%, levofloxacin: 17.3%, amoxicillin - clavulanic acid: 30%, trimethoprim - sulfamethoxazole: 32.9%, cefepime: 34.1%, nitrofurantoin: 35.8%, amikacin: 36.4%, aztreonam: 39.3%, ceftazidime: 42.7%.

Conclusions:

Frequency of some virulence factors including capsular type K2, rmpA, wcaG, and also resistant rate to imipenem, amikacin, and ceftazidime were significantly higher than similar studies. Presence of virulence factors accompanied by drug resistance should make bacteria an infectious agent and lead to treatment failure.

1. Background

Klebsiella pneumoniae, as an opportunistic pathogen, can be the cause of a range of nosocomial and community - acquired infections (1-3). Pathogenic K. pneumoniae strains are responsible for urinary tract, respiratory, and blood infections and are associated with mortality and morbidity in patients (4-6). Pathogenicity of K. pneumoniae is the result of production of many virulence factors that help these bacteria overcome the immune system and cause various diseases. Different virulence factors, such as lipopolysaccharide (o - antigen), capsular polysaccharides (K antigen), fimbriae and siderophores contribute to the pathogenicity of Klebsiella (7, 8). Among these factors, the capsule is one of the most important virulence determinants, which helps achieve biofilm formation and leads to protection against phagocytosis, antimicrobial peptides, and serum bactericidal activity. There are more than 77 types of capsular antigens in K. pneumoniae strains, of which K1 and K2 serotypes are well known (9, 10).
Klebsiella pneumoniae also carries virulence - associated genes, which may encode capsules (magA, K2A, WcaG) and a capsular regulator gene (regulator of mucoid phenotype (rmpA). Mucoviscosity - associated gene A (magA) and WcGA genes located within the gene clusters are responsible for encoding capsular polymerase and capsular biosynthesis, respectively (11-13). Capsular biogenesis by magA is achieved through conversion of manose to fucose, which may enhance the ability of the bacteria to evade phagocytosis by macrophage. The regulator of mucoid phenotype A (rmpA) gene located on the plasmid increases capsular polysaccharide production and is found in the hypermucoviscous phenotype. Moreover, two genes, including the magA and rmpA, were initially associated with invasive infections (14, 15).
Resistance of pathogenic bacteria to different antibiotics has become a serious worldwide problem because of the fatal outcome of defective treatment and the difficulty to find treatment options (16). Klebsiella pneumoniae has been revealed to have the ability to acquire resistance to many antibiotics, especially third generation cephalosporins. Multidrug resistance of K. pneumoniae against the antibiotics used for therapy intensifies the virulence potential of Klebsiella. Beta - lactam antibiotics are one of the most commonly used antibiotics in the treatment of bacterial infections and the production of B - lactamase enzymes are the most common bacterial resistance mechanisms (17, 18). In the recent years, Extended Spectrum Beta Lactamase (ESBL) producer K. pneumoniae have increased over the world. The ESBLs are divided to several groups; the main groups are TEM, CTX, and SHV derivatives (19, 20).

2. Objectives

The present study aimed at determining the prevalence of magA, wcaG, rmpA, Capsular type K1 and Capsular type K2 virulence genes along with SHV and TEM beta lactam resistance genes in K. pneumoniae isolates.

3. Methods

3.1. Ethics Statement

The ethics committee of the Semnan University of Medical Sciences, Semnan, Iran, approved this study (IR.SEMUMS.REC 1394.29).

3.2. Sampling

A cross sectional study was performed. A total of 173 non - duplicate K. pneumoniae isolates were collected during year 2015 at two different hospitals of Semnan, Iran, from urine specimens.

3.3. Bacterial Identification

The specimens were cultured on blood agar and Eosin Methylene Blue (EMB) agar (Merck, Darmstadt, Germany), and incubated at 37°C for 24 hours. Klebsiella pneumoniae was identified by conventional bacteriological tests. Gram stain was performed for suspected colonies. Biochemical tests, including lactose fermentation, gas production from glucose, FeS production, motility, indole production, sodium citrate utilization, and urea utilization were used for K. pneumoniae identification (21).

3.4. Antibiotic Susceptibility Testing

Disks diffusion test was performed according to the guidelines of the Clinical and Laboratory Standards Institute (22). Used disks (Rosco, Taastrup, Denmark) were amikacin (30 μg), ciprofloxacin (5 μg), amoxicillin - clavulanic acid (20/10 μg), ceftazidime (30 μg), imipenem (10 μg), cefepime (30 μg), aztreonam (30 μg), nitrofurantoin (300 μg), and trimethoprim - sulfamethoxazole (1.25/23.75 μg). Escherichia coli (ATCC 25922) strain was used for quality control.

3.5. DNA Extraction

DNA of each K. pneumoniae isolate was extracted from 1 mL of overnight bacterial culture. Extraction was performed as previously described by Kuske et al. (23). The supernatant was used as the template DNA in PCR reactions.

3.6. Detection of Capsular type K1, Capsular type K2, rmpA, wcaG, TEM, and SHV

Specific primers for detection of Capsular type K1, Capsular type K2, rmpA, wcaG, TEM, and SHV are shown in Table 1. For capsular type K1, capsular type K2, rmpA, and wcaG amplification were performed as follow: initial denaturation at 95°C for five minutes, followed by 35 cycles at 94°C for 30 seconds, 58°C for 90 seconds and 72°C for 90 seconds and a final extension at 72°C for 10 minutes (24). Polymerase Chain Reaction (PCR) conditions for TEM amplification were as follow: initial denaturation at 94°C for three minutes, 35 cycles at 94°C for 30 seconds, 45°C for one minute, 72°C for one minute, final extension at 72°C for 10 minutes (25). The SHV was amplified under the following conditions: 94°C for three minutes, 35 cycles at 94°C for 30 minutes, 60°C for one minute, 72°C for one minute, and a final extension at 72°C for 10 minutes (25). The PCR products were analyzed by electrophoresis with 1% agarose gel in 1X Tris - Acetate - EDTA buffer. The gels were stained with ethidium bromide and the PCR products were visualized under UV light (Figure 1).
Table 1.Specific Primers for Detection of Capsular Type K1, Capsular Type K2, rmpA, wcaG, TEM, and SHV
GenePrimerSequenceProduct Size (bp)Reference
Capsular type K1MagA - FGGTGCTCTTTACATCATTGC1283Turton et al. (24)
MagA - RGCAATGGCCATTTGCGTTAG
Capsular type K2K2wzy - FGACCCGATATTCATACTTGACAGAG641Turton et al. (24)
K2wzy - RCCTGAAGTAAAATCGTAAATAGATGGC
rmpArmpA - FACTGGGCTACCTCTGCTTCA516Turton et al. (24)
rmpA - RCTTGCATGAGCCATCTTTCA
wcaGwcaG - FGGTTGGKTCAGCAATCGTA169Turton et al. (24)
wcaG - RACTATTCCGCCAACTTTTGC
SHVSHV - FAAGATCCACTATCGCCCAGCAG200Shahcheraghi et al. (25)
SHV - RATTCAGTTCCGTTTCCCAGCGG
TEMTEM - FGAGTATTCAACATTTCCGTGTC800Shahcheraghi et al. (25)
TEM - RTAATCAGTGAGGCACCTATCTC
PCR products electrophoresis. 1: Marker (100 bp), 2: Capsular type K1 (1283 bp), 3: <i>wcaG</i> (169 bp), 4: Capsular type K2 (641 bp), 5: SHV (200 bp), 6: TEM (800bp), 7:rmp A (516 bp), 8: negative control.
Figure 1.

PCR products electrophoresis. 1: Marker (100 bp), 2: Capsular type K1 (1283 bp), 3: wcaG (169 bp), 4: Capsular type K2 (641 bp), 5: SHV (200 bp), 6: TEM (800bp), 7:rmp A (516 bp), 8: negative control.

3.7. Statistical Analysis

Confidence interval test was used to assess the statistical significance with confidence level of 95% (α = 0.05).

4. Results

In this study, frequency of virulence factors was as follow: capsular type K2: 57 out of 173 (32.9% CI: 39.9%, 25.9%), rmpA: 35 out of 173 (20.2% CI: 26.2%, 14.2%), wcaG: 28 out of 173 (16.2% CI: 19.4%, 13%), capsular type K1: 12 out of 173 (6.9% CI: 10.6%, 3.2%). Also, the SHV was observed in 81 out of 173 (46.8% CI: 51.2%, 42.4%) and TEM was observed in 58 out of 173 (33.5% CI: 37.5%, 29.5%) cases. The resistant rates to antibiotics were as follow, imipenem: 13 out of 173 (7.5% CI: 9.8%, 5.2%), ciprofloxacin: 28 out of 173 (16.1% CI: 19.2%, 13%), amoxicillin - clavulanic acid: 52 out of 173 (30% CI: 33.9%, 26.1%), trimethoprim - sulfamethoxazole: 57 out of 173 (32.9% CI: 36.9%, 28.9%), cefepime: 59 out of 173 (34.1% CI: 38.2%, 30%), nitrfurantoin: 62 out of 173 (35.8% CI: 35.8%, 27.8%), amikacin: 63 out of 173 (36.4% CI: 40.5%, 32.3%), aztreonam: 68 out of 173 (39.3% CI: 43.5%, 35.1%).

5. Discussion

Klebsiella pneumoniae is the cause of nosocomial and community acquired infections, such as urinary tract, respiratory, and blood infections. It harbors many virulence-associated genes including magA, rmpA, WcaG, fimbriae, and siderophores, which help the bacteria overcome the immune system and cause infection. Drug resistant, especially ESBL - producing K. pneumoniae strains, contribute to treatment failure and increase morbidity and mortality in patients (26-28).
In this study, the frequency of SHV was significantly lower than 69.6% and 67.4% reported by Shahcheraghi et al. (25) and Feizabadi et al. (29), respectively. Frequency of TEM was significantly lower than 54%, reported by Feizabadi et al. (29), yet in accordance with 32.1% reported by Shahcheraghi et al. (25). These differences were the result of differences in infection control system and therapeutic regimens in different parts of Iran. Age of over 60, long hospitalization, diabetes and previous antibiotic treatment were other factors associated with the ESBL phenotype (30).
Capsular type K1 frequency was significantly lower than 39.5% and 64.3% reported by Liu et al. (31) and Lee et al. (32), yet significantly higher than 1.4% reported by Maatallah et al. (33). Capsular type K2 frequency was significantly higher than 18.4% and 20% reported by Liu et al. (30) and Lee et al. (32), yet significantly lower than 5% reported by Maatallah et al. (33). Frequency of rmpA was significantly higher than 5.5%, 3.6%, and 7.0% reported by Derakhshan et al. (27), Maatallah et al. (33), and Derakhshan et al., respectively (34). Frequency of wcaG was significantly higher than 2.7% and 8.6% reported by Derakhshan et al. (27) and Maatallah et al. (33), yet significantly lower than 23.5% reported by Derakhshan et al. (34).
The resistance rate to imipenem was significantly higher than 1.4% and 0.05% reported by Liu et al. (31), and Derakhshan et al. (34), and also reports of Shahcheraghi et al. (25), Peerayeh et al. (26), Derakhshan et al. (27), Peerayeh et al. (28), and Ranjbar et al. (35), which reported no resistance to imipenem, yet significantly lower than 20.8% reported by Amraie et al. (36). The resistance rate to ciprofloxacin was significantly lower than 44.4%, 37.1%, 42.5%, and 52.5% reported by Derakhshan et al. (27), Liu et al. (31), Derakhshan et al. (34), and Ranjbar et al. (35), yet in accordance with 18%, 18%, and 15.6% reported by Shahcheraghi et al. (25), Peerayeh et al. (26), and Amraie et al. (36). The resistance rate to amoxicillin - clavulanic acid was significantly lower than 31.7% and 28.6% reported by Liu et al. (31) and Pereira et al. (37), yet in accordance with 100% and 60.5% reported by Derakhshan et al. (27) and Derakhshan et al. (34), respectively.
The resistance rate to nitrofurantoin was significantly lower than 40% and 71% reported by Ranjbar et al. (35) and Amraie et al. (36). The resistance rate to trimethoprim - sulfamethoxazole was significantly lower than 39%, 55.5%, 39.3%, 50%, 51.5%, and 54% reported by Peerayeh et al. (26), Derakhshan et al. (27), Peerayeh et al. (26), Derakhshan et al. (34), Ranjbar et al. (35), and Amraie et al. (36), respectively, yet in accordance with 32.9% reported by Liu et al. (31). The resistance rate to cefepime was significantly higher than 12.9% reported by Liu et al. (31), yet in accordance with 37.5% reported by Peerayeh et al. (26), also significantly lower than 80.5% and 57% reported by Peerayeh et al. (26) and Derakhshan et al. (34).
The resistance rate to amikacin was significantly higher than 14%, 27%, 10%, 22%, and 4.8% reported by Shahcheraghi et al. (25), Peerayeh et al. (26), Liu et al. (31), Amraie et al. (36), and Pereira et al. (37), yet in accordance with 31.5% reported by Derakhshan et al. (34), also significantly lower than 50% reported by Derakhshan et al. (27). The resistant rate to aztreonam was significantly lower than 100%, 59%, and 92.5% reported by Derakhshan et al. (27), Derakhshan et al. (34), and Ranjbar et al. (35), yet in accordance with 39% and 38.1% reported by Peerayeh et al. (26) and Pereira et al. (37), also, significantly higher than 30% reported by Liu et al. (31). The resistance rate to ceftazidime was significantly higher than 31.3%, 51.1%, 35.8%, and 4.8% reported by Shahcheraghi et al. (25), Peerayeh et al. (28), Liu et al. (31), and Pereira et al. (37), yet significantly lower than 100%, 57%, 100%, and 49.7% reported by Derakhshan et al. (27), Derakhshan et al. (34), and Ranjbar et al. (35).

6. Conclusions

Frequency of some virulence factors including Capsular type K2, rmpA, wcaG, and also resistance rates to imipenem, amikacin, and ceftazidime were significantly higher than similar studies. Presence of virulence factors accompanied by drug resistance make bacteria an infectious agent and lead to treatment failure.

Acknowledgments

Footnotes

References

  • 1.
    Lu B, Zhou H, Zhang X, Qu M, Huang Y, Wang Q. Molecular characterization of Klebsiella pneumoniae isolates from stool specimens of outpatients in sentinel hospitals Beijing, China, 2010-2015. Gut Pathog. 2017;9:39. [PubMed ID: 28670346]. [PubMed Central ID: PMC5493082]. https://doi.org/10.1186/s13099-017-0188-7.
  • 2.
    Bina M, Pournajaf A, Mirkalantari S, Talebi M, Irajian G. Detection of the Klebsiella pneumoniae carbapenemase (KPC) in K. pneumoniae Isolated from the Clinical Samples by the Phenotypic and Genotypic Methods. Iran J Pathol. 2015;10(3):199-205. [PubMed ID: 26351485]. [PubMed Central ID: PMC4539771].
  • 3.
    Moradigaravand D, Martin V, Peacock SJ, Parkhill J. Evolution and Epidemiology of Multidrug-Resistant Klebsiella pneumoniae in the United Kingdom and Ireland. MBio. 2017;8(1). [PubMed ID: 28223459]. [PubMed Central ID: PMC5358916]. https://doi.org/10.1128/mBio.01976-16.
  • 4.
    Kang CI, Kim SH, Bang JW, Kim HB, Kim NJ, Kim EC, et al. Community-acquired versus nosocomial Klebsiella pneumoniae bacteremia: clinical features, treatment outcomes, and clinical implication of antimicrobial resistance. J Korean Med Sci. 2006;21(5):816-22. [PubMed ID: 17043412]. [PubMed Central ID: PMC2721989]. https://doi.org/10.3346/jkms.2006.21.5.816.
  • 5.
    Kang CI, Kim SH, Park WB, Lee KD, Kim HB, Kim EC, et al. Bloodstream infections due to extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae: risk factors for mortality and treatment outcome, with special emphasis on antimicrobial therapy. Antimicrob Agents Chemother. 2004;48(12):4574-81. [PubMed ID: 15561828]. [PubMed Central ID: PMC529180]. https://doi.org/10.1128/AAC.48.12.4574-4581.2004.
  • 6.
    Martin RM, Cao J, Brisse S, Passet V, Wu W, Zhao L, et al. Molecular Epidemiology of Colonizing and Infecting Isolates of Klebsiella pneumoniae. mSphere. 2016;1(5). [PubMed ID: 27777984]. [PubMed Central ID: PMC5071533]. https://doi.org/10.1128/mSphere.00261-16.
  • 7.
    Schembri MA, Blom J, Krogfelt KA, Klemm P. Capsule and fimbria interaction in Klebsiella pneumoniae. Infect Immun. 2005;73(8):4626-33. [PubMed ID: 16040975]. [PubMed Central ID: PMC1201234]. https://doi.org/10.1128/IAI.73.8.4626-4633.2005.
  • 8.
    Vuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol. 2017;123(4):1003-18. [PubMed ID: 28731269]. https://doi.org/10.1111/jam.13533.
  • 9.
    Cortes G, Borrell N, de Astorza B, Gomez C, Sauleda J, Alberti S. Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia. Infect Immun. 2002;70(5):2583-90. [PubMed ID: 11953399]. [PubMed Central ID: PMC127904].
  • 10.
    Lin TH, Huang SH, Wu CC, Liu HH, Jinn TR, Chen Y, et al. Inhibition of Klebsiella pneumoniae Growth and Capsular Polysaccharide Biosynthesis by Fructus mume. Evid Based Complement Alternat Med. 2013;2013:621701. [PubMed ID: 24062785]. [PubMed Central ID: PMC3770061]. https://doi.org/10.1155/2013/621701.
  • 11.
    Ho JY, Lin TL, Li CY, Lee A, Cheng AN, Chen MC, et al. Functions of some capsular polysaccharide biosynthetic genes in Klebsiella pneumoniae NTUH K-2044. PLoS One. 2011;6(7). e21664. [PubMed ID: 21765903]. [PubMed Central ID: PMC3134468]. https://doi.org/10.1371/journal.pone.0021664.
  • 12.
    Lee HC, Chuang YC, Yu WL, Lee NY, Chang CM, Ko NY, et al. Clinical implications of hypermucoviscosity phenotype in Klebsiella pneumoniae isolates: association with invasive syndrome in patients with community-acquired bacteraemia. J Intern Med. 2006;259(6):606-14. [PubMed ID: 16704562]. https://doi.org/10.1111/j.1365-2796.2006.01641.x.
  • 13.
    Yeh KM, Lin JC, Yin FY, Fung CP, Hung HC, Siu LK, et al. Revisiting the importance of virulence determinant magA and its surrounding genes in Klebsiella pneumoniae causing pyogenic liver abscesses: exact role in serotype K1 capsule formation. J Infect Dis. 2010;201(8):1259-67. [PubMed ID: 19785524]. https://doi.org/10.1086/606010.
  • 14.
    Yu WL, Ko WC, Cheng KC, Lee HC, Ke DS, Lee CC, et al. Association between rmpA and magA genes and clinical syndromes caused by Klebsiella pneumoniae in Taiwan. Clin Infect Dis. 2006;42(10):1351-8. [PubMed ID: 16619144]. https://doi.org/10.1086/503420.
  • 15.
    Pan YJ, Lin TL, Chen CT, Chen YY, Hsieh PF, Hsu CR, et al. Genetic analysis of capsular polysaccharide synthesis gene clusters in 79 capsular types of Klebsiella spp. Sci Rep. 2015;5:15573. [PubMed ID: 26493302]. [PubMed Central ID: PMC4616057]. https://doi.org/10.1038/srep15573.
  • 16.
    Kidd TJ, Mills G, Sa-Pessoa J, Dumigan A, Frank CG, Insua JL, et al. A Klebsiella pneumoniae antibiotic resistance mechanism that subdues host defences and promotes virulence. EMBO Mol Med. 2017;9(4):430-47. [PubMed ID: 28202493]. [PubMed Central ID: PMC5376759]. https://doi.org/10.15252/emmm.201607336.
  • 17.
    Shaikh S, Fatima J, Shakil S, Rizvi SM, Kamal MA. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi J Biol Sci. 2015;22(1):90-101. [PubMed ID: 25561890]. [PubMed Central ID: PMC4281622]. https://doi.org/10.1016/j.sjbs.2014.08.002.
  • 18.
    Vasaikar S, Obi L, Morobe I, Bisi-Johnson M. Molecular Characteristics and Antibiotic Resistance Profiles of Klebsiella Isolates in Mthatha, Eastern Cape Province, South Africa. Int J Microbiol. 2017;2017:8486742. [PubMed ID: 28250772]. [PubMed Central ID: PMC5303861]. https://doi.org/10.1155/2017/8486742.
  • 19.
    Manoharan A, Premalatha K, Chatterjee S, Mathai D, Sari Study Group. Correlation of TEM, SHV and CTX-M extended-spectrum beta lactamases among Enterobacteriaceae with their in vitro antimicrobial susceptibility. Indian J Med Microbiol. 2011;29(2):161-4. [PubMed ID: 21654112]. https://doi.org/10.4103/0255-0857.81799.
  • 20.
    Lal P, Kapil A, Das BK, Sood S. Occurrence of TEM & SHV gene in extended spectrum beta-lactamases (ESBLs) producing Klebsiella sp. isolated from a tertiary care hospital. Indian J Med Res. 2007;125(2):173-8. [PubMed ID: 17431288].
  • 21.
    Forbes BA, Tille PM. Bailey & Scott's diagnostic microbiology. 14th ed. Elsevier; 2018.
  • 22.
    Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 24th Informational Supplement (M100-S24). USA: Wayne, PA; 2014.
  • 23.
    Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ. Small-Scale DNA Sample Preparation Method for Field PCR Detection of Microbial Cells and Spores in Soil. Appl Environ Microbiol. 1998;64(7):2463-72. [PubMed ID: 9647816]. [PubMed Central ID: PMC106412].
  • 24.
    Turton JF, Perry C, Elgohari S, Hampton CV. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010;59(Pt 5):541-7. [PubMed ID: 20110386]. https://doi.org/10.1099/jmm.0.015198-0.
  • 25.
    Shahcheraghi F, Moezi H, Feizabadi MM. Distribution of TEM and SHV beta-lactamase genes among Klebsiella pneumoniae strains isolated from patients in Tehran. Med Sci Monit. 2007;13(11):BR247-50. [PubMed ID: 17968291].
  • 26.
    Peerayeh SN, Rostami E, Siadat SD, Derakhshan S. High rate of aminoglycoside resistance in CTX-M-15 producing Klebsiella pneumoniae isolates in Tehran, Iran. Lab Med. 2014;45(3):231-7. [PubMed ID: 25051075]. https://doi.org/10.1309/LMDQQW246NYAHHAD.
  • 27.
    Derakhshan S, Peerayeh SN, Bakhshi B. Genotyping and characterization of CTX-M-15 -producing Klebsiella pneumoniae isolated from an Iranian hospital. J Chemother. 2016;28(4):289-96. [PubMed ID: 25734924]. https://doi.org/10.1179/1973947815Y.0000000002.
  • 28.
    Najar Peerayeh S, Rostami E, Eslami M, Ahangarzadeh Rezaee M. High Frequency of Extended-Spectrum β-Lactamase-Producing Klebsiella pneumoniae and Escherichia coli Isolates From Male Patients’ Urine. Arch Clin Infect Dis. 2016;11(2). https://doi.org/10.5812/archcid.32696.
  • 29.
    Feizabadi MM, Delfani S, Raji N, Majnooni A, Aligholi M, Shahcheraghi F, et al. Distribution of bla(TEM), bla(SHV), bla(CTX-M) genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb Drug Resist. 2010;16(1):49-53. [PubMed ID: 19961397]. https://doi.org/10.1089/mdr.2009.0096.
  • 30.
    Tabar MM, Mirkalantari S, Amoli RI. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran. Electron Physician. 2016;8(7):2686-90. [PubMed ID: 27648198]. [PubMed Central ID: PMC5014510]. https://doi.org/10.19082/2686.
  • 31.
    Liu YM, Li BB, Zhang YY, Zhang W, Shen H, Li H, et al. Clinical and molecular characteristics of emerging hypervirulent Klebsiella pneumoniae bloodstream infections in mainland China. Antimicrob Agents Chemother. 2014;58(9):5379-85. [PubMed ID: 24982067]. [PubMed Central ID: PMC4135864]. https://doi.org/10.1128/AAC.02523-14.
  • 32.
    Lee IR, Molton JS, Wyres KL, Gorrie C, Wong J, Hoh CH, et al. Differential host susceptibility and bacterial virulence factors driving Klebsiella liver abscess in an ethnically diverse population. Sci Rep. 2016;6:29316. [PubMed ID: 27406977]. [PubMed Central ID: PMC4942785]. https://doi.org/10.1038/srep29316.
  • 33.
    Maatallah M, Vading M, Kabir MH, Bakhrouf A, Kalin M, Naucler P, et al. Klebsiella variicola is a frequent cause of bloodstream infection in the stockholm area, and associated with higher mortality compared to K. pneumoniae. PLoS One. 2014;9(11). e113539. [PubMed ID: 25426853]. [PubMed Central ID: PMC4245126]. https://doi.org/10.1371/journal.pone.0113539.
  • 34.
    Derakhshan S, Najar Peerayeh S, Bakhshi B. Association Between Presence of Virulence Genes and Antibiotic Resistance in Clinical Klebsiella Pneumoniae Isolates. Lab Med. 2016;47(4):306-11. [PubMed ID: 27498999]. https://doi.org/10.1093/labmed/lmw030.
  • 35.
    Ranjbar R, Memariani H, Sorouri R, Memariani M. Distribution of virulence genes and genotyping of CTX-M-15-producing Klebsiella pneumoniae isolated from patients with community-acquired urinary tract infection (CA-UTI). Microb Pathog. 2016;100:244-9. [PubMed ID: 27725280]. https://doi.org/10.1016/j.micpath.2016.10.002.
  • 36.
    Amraie H, Shakib P, Rouhi S, Bakhshandeh N, Zamanzad B. Prevalence assessment of magA gene and antimicrobial susceptibility of Klebsiella pneumoniae isolated from clinical specimens in Shahrekord, Iran. Iran J Microbiol. 2014;6(5):311-6. [PubMed ID: 25848520]. [PubMed Central ID: PMC4385570].
  • 37.
    Pereira SC, Vanetti MC. Potential virulence of Klebsiella sp. isolates from enteral diets. Braz J Med Biol Res. 2015;48(9):782-9. [PubMed ID: 26176307]. [PubMed Central ID: PMC4568805]. https://doi.org/10.1590/1414-431X20154316.

Crossmark
Crossmark
Checking
Share on
Cited by
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles