Logo

Image Credit:

Microsatellite Length Polymorphism for DNA-Based Typing of Candida albicans Isolated from HIV Positive Patients in Tehran, Iran

Author(s):
Ehsan FarahbakhshEhsan Farahbakhsh1, Farzad KatiraeeFarzad KatiraeeFarzad Katiraee ORCID2, Shahla Roudbar MohammadiShahla Roudbar Mohammadi1, Shirin ShahbaziShirin Shahbazi3, Mohammad Hossein YadegariMohammad Hossein YadegariMohammad Hossein Yadegari ORCID1,*
1Department of Medical Mycology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, IR Iran
2Department of Pathobiology, Faculty of Veterinary Medicine, University of Tabriz, Tabriz, IR Iran
3Department of Medical Genetics, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, IR Iran


Jundishapur Journal of Microbiology:Vol. 11, issue 5; e64041
Published online:Apr 10, 2018
Article type:Research Article
Received:Dec 04, 2017
Accepted:Mar 04, 2018
How to Cite:Ehsan FarahbakhshFarzad KatiraeeShahla Roudbar MohammadiShirin ShahbaziMohammad Hossein YadegariMicrosatellite Length Polymorphism for DNA-Based Typing of Candida albicans Isolated from HIV Positive Patients in Tehran, Iran.Jundishapur J Microbiol.11(5):e64041.https://doi.org/10.5812/jjm.64041.

Abstract

Background:

The importance of Candida albicans as the most common cause of fungal infections in humans is undeniable. Genotyping methods have been developed as useful tools to differentiate between fungal strains isolated from various infections. Several molecular typing methods have been described for C. albicans, and fragment length analysis of microsatellites called microsatellite fragment length polymorphism (MLP) is one of the most accurate genotyping methods.

Objectives:

The present study aimed at evaluating the genetic diversity and genetic relationships among C. albicans isolates recovered from HIV-positive patients with oral candidiasis in Iran using MLP.

Methods:

We analyzed 30 isolates of C. albicans obtained from HIV-positive patients in Tehran. Genotypes of C. albicans isolates associated with oropharyngeal candidiasis were determined using microsatellite length polymorphism analysis. Three loci including EF3, CDC3, and HIS3 were amplified using multiplex PCR. After amplification, the product was run on an automated single-capillary genetic analyzer, and band sizes (known as alleles) were calculated with gene scan mapper.

Results:

PCR MLP typing of the 30 isolates under study yielded 27 different profiles, and the discriminatory power index was obtained as 0.993. Ten alleles and 18 different combinations were detected for the EF3 gene, 7 alleles and 18 combinations for the EF3 gene, and 10 alleles and 14 combinations for the HIS3 gene. Only 2 isolates were homozygous in all the 3 loci. To identify the origin of superficial infections in 6 patients, C. albicans isolates from the superficial as well as oral samples were simultaneously genotyped. Results showed the identity of genotypes in 4 of these patients. For 1 patient, the C. albicans genotype of the nails was different from the genotype observed in the oral cavity, which raised the possibility of an exogenous source for the superficial infection. Also, there were changes at only 1 or 2 alleles, which represented microevolution in some isolates.

Conclusions:

The high variation of genotypes throughout the population of C. albicans suggested that the microsatellite fragment length polymorphism using multiplex PCR-based system provided high-speed genotyping, indicating its usefulness in molecular epidemiological evaluation.

1. Background

In recent years, Candida albicans has emerged as an important fungal pathogen and a common opportunistic agent in immunocompromised patients. Candida albicans has led to the emergence of both superficial and deep infections in the past 3 decades (1-3). Considering the rising prevalence of immunosuppression, long-term hospitalization, and invasive medical treatments, Candida species have become a major group of opportunistic pathogens causing infections in humans. Prevention and treatment of candidiasis are of importance considering the prevalence of nosocomial Candida infections (4). Recurrent or persistent infections caused by Candida species are common, especially among patients with vaginal and oropharyngeal candidiasis (OPC); nonetheless, such infections have also been reported in patients with urinary tract infections (5, 6).

Through genotyping of C. albicans, we can reach the following goals: 1) determining the relationship between commensalism and infection; 2) identifying nosocomial candidiasis to determine strains associated with the outbreak of infection; 3) distinguishing epidemic from sporadic or endemic strains; 4) identifying the etiology of infection, strain transmission, and acquisition routes; 5) examining the genetic diversity of isolates from a carrier; 6) determining recurrent infections to find virulent strains; 7) evaluating the emergence of drug-resistant strains; and 8) assessing the population diversity, structure, and dynamics (7, 8). Typing methods are recognized as helpful tools in differentiating strains causing recurrent infections (7). Despite the availability of different typing methods for C. albicans (eg, PCR-RFLP, AFLP, and MLST), microsatellite length polymorphism (MLP) is known as a highly efficient method of fragment length analysis of microsatellites (9, 10), with high reproducibility and discriminatory power (11).

Various epidemiological studies have confirmed the reproducibility and efficacy of MLP analysis. As a PCR-based method, MLP typing uses high repeat variability in microsatellite sequences (described as tandem repeats of 2 - 6 nucleotides). Microsatellite markers include a definite pair of primers flanking a particular microsatellite site inside the genome. For amplifying specific loci, fluorescence-labeled primers are used, and the allele length is measured via gel electrophoresis of PCR products with an automatic sequencer. In general, MLP is a highly discriminative method for C. albicans typing. Nevertheless, the microsatellite marker affects its resolving power. In the C. albicans genome, different polymorphic microsatellite loci have been described (eg, CDC3, EF3, HIS3, ERK1; 2NF1, CCN2, EFG1, CPH2, CAI; and CAIII-CAVII). A combination of markers on different chromosomes from the same typing system facilitates a more precise classification of C. albicans with MLP (10, 12, 13).

2. Objectives

In this study, we aimed at examining the genetic diversity and relatedness among isolates of C. albicans, collected from HIV positive patients with oral candidiasis, using microsatellite fragment length polymorphism.

3. Methods

A total of 30 C. albicans isolates were collected from patients with HIV and OPC in Tehran, Iran. Moreover, C. albicans was isolated from 8 out of 30 patients with recurrent OPC in 2 different episodes. To identify the origin of cutaneous and nail infections in six patients, C. albicans isolates, as well as isolates related to OPC were analyzed. C. albicans isolates were collected from CHROMagar Candida and Sabouraud dextrose agar media after incubation for 72 hours at 35°C. Phenotypic identification was confirmed using different tests including chlamydospore production, colony morphology on CHROM agar, and carbohydrate assimilation using rapid yeast identification system (Remel Inc., USA) (14, 15).

For DNA extraction, a physicochemical method was applied. A portion of the yeast colony was washed with phosphorous-buffered saline containing 50 mM EDTA and 0.5% SDS. Afterwards, the freeze-thawing method with glass beads was applied to disrupt the yeasts. After centrifugation for 2 minutes at 12,000 g, lysis buffer (500 mL) was added to the precipitate, followed by incubation for 10 minutes. Potassium acetate buffer (150 µL, pH = 4.8; 28.5 mL of distilled water; 60 mL of 5 M potassium acetate; 11.5 mL of glacial acetic acid) was then added to the tube and vortexed for a short period.

Centrifugation (2 minutes at 12,000 g) was used to remove the precipitated proteins and cell debris. The supernatant was transferred to a microtube and centrifuged for 2 minutes at 12,000 g. After decanting the supernatant to a new microtube (1.5 mL), isopropyl alcohol was added with an equal volume. The tube was briefly mixed via inversion and centrifuged for 2 minutes at 12,000 g. After removing the supernatant, the DNA pellet was washed 3 times in 70% ethanol (300 µL). The supernatant was discarded after centrifugation for 1 minute at 12,000 g. Then, DNA was dried and dissolved in distilled water (50 µL).

To determine DNA concentration and its purification, optical density (OD) was read and run on agarose gel. To amplify the 3 loci, multiplex PCR was performed in a reaction volume of 50 µL, containing 5 mM of MgCl2, 1X PCR buffer, 0.2 mM of each dNTP, 1.25 U of Taq gold polymerase (Applied Biosystems), 5 pmol of EF3 (Chromosome 5) primers, and 2 pmol of CDC3 (Chromosome 1), and HIS3 (chromosome 2) primers. The microsatellite markers were amplified with the primers (Table 1), and different dyes were used to label a primer from each set. The EF3 antisense primer was stained using fluorescein amidite (FAM), CDC3 sense primer was labeled with hexachlorofluorescein (HEX), and HIS3 sense primer was labeled with NED (16). The PCR included initial denaturation at 95°C for 10 minutes, followed by 30 cycles at 95°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 60 seconds, followed by a final extension at 72°C for 30 minutes. After amplification, 2 µL of the PCR product was added to formamide (20 µL) and 6-TAMRA Genescan 500 size standard (0.5 µL, Applied Biosystems). The samples were run on an ABI XL 370 genetic analyzer after denaturation at 95°C for 120 seconds and were placed in an ice bath. Moreover, the GeneMapper Version 5 (Applied Biosystems) was used to determine the band size (allelic number) (13, 16, 17).

Table 1.Details of Microsatellite Markers Applied in the Molecular Analysis of C. albicans
Locus, ChromosomeGene ProductPrimerSequence 5′ - 3′DyeRepeat TypeSize Range
EF3, chr 5Elongation factor 3EF3FTTTCCTCTTCCTTTCATATAGAAFAMTTTC-TTC120 - 141
EF3RGGATTCACTAGCAGCAGACA
CDC3, chr 1Cell division cycle proteinCDC3FCAGATGATTTTTTGTATGAGAAGAAHEXAGTA112 - 140
CDC3RCAGTCACAAGATTAAAATGTTCAAG
HIS3, chr 2Imidazole glycerolHIS3FTGGCAAAAATGATATTCCAANEDTTG224 - 245
HIS3RTACACTATGCCCCAAACACA

Details of Microsatellite Markers Applied in the Molecular Analysis of C. albicans

4. Results

There were I or 2 bands based on the multiplex PCR analysis of each microsatellite marker and isolate. As C. albicans is a diploid pathogen, every marker had a single locus, and every band was attributed to an allele. Accordingly, a profile of 6 alleles characterized every isolate. Overall, 27 different profiles were obtained via PCR MLP typing of 30 isolates (discriminatory power: 0.993) (Figure 1). There were 10 alleles and 18 combinations, 10 alleles and 14 combinations, and 7 alleles and 18 combinations for EF3, HIS3, and EF3 genes, respectively. Heterogeneity was observed in allele frequency. In a particular locus, the most probabilistic number of repeats indicated an association with the increase or decrease in the number of repeats. Nevertheless, the alleles were not normally distributed, and some were overrepresented. Furthermore, most isolates were heterozygous inside at least 1 locus, whereas only 2 isolates were homozygous in all the 3 loci (Table 2). Although the haploidy of these isolates was not definite, they were described as homozygous.

Table 2.Demographic Data and Genotypes of 30 Clinical C. albicans Isolates Collected from HIV Positive Patients
Isolates Number Isolates OriginFragments Length (Bp) Identified By Gene ScanFinal GenotypeFluconazole resistanceGenderCD4 CountHAART
EF3 markerCDC3 markerHIS3 marker
Allele1Allele2Allele1Allele2Allele1Allele2
N1OPC129136116116150162GT9DDM< 200No
N10OPC129138116128154154GT1SF< 200No
N12OPC123123120120154154GT2SF< 200No
N13OPC129138116116154154GT3SF< 200No
N14OPC129137124128150167GT4DDF< 200No
N15OPC129138116128154154GT5SM< 200No
N16OPC129129116116162162GT6SM< 200No
N17OPC129141116128154154GT7RM< 200No
N18OPC129138128128154154GT8SM< 200No
N22OPC138138116140154154GT10SM< 200No
N24OPC123129112116150162GT11RM< 200Yes
N27OPC123129116124180180GT12RM< 200Yes
N28OPC123129112116150162GT11SM200 - 400No
N29OPC129138128128154154GT13RM200 - 400No
N30OPC120123120120154154GT14SF200 - 400No
N31OPC129137124128150166GT15SM200 - 400Yes
N33OPC124136120124154192GT16RM200 - 400Yes
N35OPC123137120124154166GT17SF200 - 400Yes
N42OPC120128116124162162GT18SF200 - 400Yes
N44OPC124136120120154172GT19SM200 - 400Yes
N46OPC129136116116149162GT20SM200 - 400Yes
N47OPC124138112116149149GT21SM200 - 400Yes
N51OPC123138116116179179GT22SF> 400Yes
N54OPC123137120124154166GT23RM> 400Yes
N55OPC129136116116150162GT9RM> 400Yes
N56OPC120120124124162162GT24RM> 400Yes
N57OPC129140116116150162GT25SM> 400Yes
N58OPC120125124124147166GT26DDM> 400No
N59OPC129135116128154154GT27SM> 400Yes
N60OPC129141116116154154GT7RM> 400Yes

Demographic Data and Genotypes of 30 Clinical C. albicans Isolates Collected from HIV Positive Patients

To identify the origin of cutaneous and nail infections among 6 patients, C. albicans isolates from the culture, as well as isolates related to oral cavity infections were genotyped. The genotypes were identified in 4 of these patients. The genotype of C. albicans from the nails differed from the genotype of oral cavity in 2 patients and was considered as an exogenous source of superficial infection. To evaluate microevolution and change the isolates in recurrent OPC, C. albicans was isolated from the culture of 8 patients and genotyped in 2 different episodes of disease in different intervals. The genotypes were identical in 6 patients. In addition, changes in only 1 or 2 alleles, which represent microevolution (evolutionary changes within a species or small group of organisms, especially over a short period), were observed in some isolates (Table 3).

Table 3.Comparison of 8 Pairs of Isolates from Recurrent Oral Collected at Different Time from Same Patients Underlying Alleles Related to Change in C. albicans Genotypes
Patients/EpisodeLength, bp Determined by PCR Analysis
EF3CDC3HIS3
Allele1Allele2Allele1Allele2Allele1Allele2
P1
Episode1129138116128154154
Episode2129138116128154154
P2
Episode1129138116116154154
Episode2129138116128154154
P3
Episode1120123120120154154
Episode2120123120120154154
P4
Episode1120128116124162162
Episode2120120124124162162
P6
Episode1123137120124154166
Episode2123137120124154166
P7
Episode1124136120124154192
Episode2124136120124154192
P8
Episode1129141116116154154
Episode2129141116116154154

Comparison of 8 Pairs of Isolates from Recurrent Oral Collected at Different Time from Same Patients Underlying Alleles Related to Change in C. albicans Genotypes

Genetic Diversity of 30 Dependent <i>C. albicans</i> Isolates Collected from HIV Positive Patients Via MLP Typing
Figure 1.

Genetic Diversity of 30 Dependent C. albicans Isolates Collected from HIV Positive Patients Via MLP Typing

5. Discussion

Candida albicans is capable of causing severe infections, particularly in immunocompromised patients. Consequently, researchers have attempted to develop accurate methods to discriminate between isolates. Understanding the relationship between the strains involved in Candida infections is strongly associated with the development of proper treatment methods and adds to the available epidemiological knowledge. Epidemiological studies have applied different typing methods for characterizing C. albicans isolates including electrophoretic karyotyping, southern blot hybridization using discriminating probes, RFLP, and random polymorphic DNA amplification. Microsatellites are common markers for differentiating between microorganisms, given their potential application and high diversity in automated tests besides the simplicity of PCR amplification and interpretation of the results (18, 19). Candida albicans isolates contain many loci, and accordingly, several markers have been developed for them (16, 19). However, it seems that most of microsatellites in coding regions have low levels of heterozygosity, although the use of multiplex PCR and the evaluation of more loci increase the discriminatory power (20, 21).

The analysis of 30 independent isolates recovered from HIV-positive patients with 3 loci (CDC3, EF3, and HIS3) identified 27 different genotypes (discriminatory power of 0.993). The results of multiplex PCR regarding genetic relatedness discriminated 27 out of 30 (90%) strains, which otherwise would have been considered similar. Microevolution was reported due to minor changes in the strain genotypes including changes in only 1 allele, which could be described in a single mutational step. Using this method to assess recurrent infection isolates shows similar scenarios as previously described. Among 8 recurrent cases, 6 were related to a similar strain, and 2were attributed to a similar strain undergoing microevolution (One allele was changed.). Furthermore, MLP could detect microevolutionary changes and was useful in identifying microevolution after environmental stress. Moreover, it can improve therapeutic procedures in patients due to the recurrence of refractory fungal infections. The primers, analysis techniques, and allele nomenclature for microsatellite typing systems should be standardized. Therefore, for interlaboratory comparisons, these important issues need to be considered. Moreover, the development of a global public database similar to MLST is essential for the collection of microsatellite allele data. The present study can help develop a genetic database of fungal pathogens in Iran. A relatively high divergence was found in the structure of C. albicans among HIV-positive patients. The isolates were classified into 27 genotypes, showing major redundancy in isolates from clinical samples.

In this study, various strains with similar MLP genotypes were reported (30 isolates from 27 genotypes) (Figure 1). We found isolates, which were only different in 1allele and might have evolved from a common ancestor. No association was found between fluconazole resistance and genotypes. However, to determine the molecular epidemiology of C. albicans in Iran, further research is required on C. albicans strains in other regions of the country. Based on the present findings, potentially pathogenic C. albicans have the opportunity to overgrow in the context of HIV infection. In some previous studies, mixed types were detected in some patients. In the host, the strains undergo microvariation, which often involves alterations in zygosity of diploid allele pairs, but show inadequate geographical relatedness (2, 22, 23).

6. Conclusions

Considering the high variability of genotypes in the population of C. albicans, microsatellite fragment length polymorphism analysis with multiplex PCR facilitates high-speed genotyping for molecular epidemiological evaluation.

References

  • 1.
    Sardi JC, Scorzoni L, Bernardi T, Fusco-Almeida AM, Mendes Giannini MJ. Candida species: current epidemiology, pathogenicity, biofilm formation, natural antifungal products and new therapeutic options. J Med Microbiol. 2013;62(1):10-24. [PubMed ID: 23180477]. https://doi.org/10.1099/jmm.0.045054-0.
  • 2.
    Katiraee F, Khalaj V, Khosravi AR, Hajiabdolbaghi M. Sequences type analysis of Candida albicans isolates from Iranian human immunodeficiency virus infected patients with oral candidiasis. Acta Med Iran. 2014;52(3):187-91. [PubMed ID: 24901719].
  • 3.
    Low CY, Rotstein C. Emerging fungal infections in immunocompromised patients. F1000 Med Rep. 2011;3:14. [PubMed ID: 21876720]. https://doi.org/10.3410/M3-14.
  • 4.
    Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis. 2004;39(3):309-17. [PubMed ID: 15306996]. https://doi.org/10.1086/421946.
  • 5.
    Achkar JM, Fries BC. Candida infections of the genitourinary tract. Clin Microbiol Rev. 2010;23(2):253-73. [PubMed ID: 20375352]. https://doi.org/10.1128/CMR.00076-09.
  • 6.
    Patel PK, Erlandsen JE, Kirkpatrick WR, Berg DK, Westbrook SD, Louden C, et al. The Changing Epidemiology of Oropharyngeal Candidiasis in Patients with HIV/AIDS in the Era of Antiretroviral Therapy. AIDS Res Treat. 2012;2012. e262471. [PubMed ID: 22970352]. https://doi.org/10.1155/2012/262471.
  • 7.
    Saghrouni F, Ben Abdeljelil J, Boukadida J, Ben Said M. Molecular methods for strain typing of Candida albicans: a review. J Appl Microbiol. 2013;114(6):1559-74. [PubMed ID: 23311504]. https://doi.org/10.1111/jam.12132.
  • 8.
    Soll DR. The ins and outs of DNA fingerprinting the infectious fungi. Clin Microbiol Rev. 2000;13(2):332-70. [PubMed ID: 10756003].
  • 9.
    Beretta S, Fulgencio JP, Enache-Angoulvant A, Bernard C, El Metaoua S, Ancelle T, et al. Application of microsatellite typing for the investigation of a cluster of cases of Candida albicans candidaemia. Clin Microbiol Infect. 2006;12(7):674-6. [PubMed ID: 16774566]. https://doi.org/10.1111/j.1469-0691.2006.01438.x.
  • 10.
    Shimizu K, Hattori H, Adachi H, Oshima R, Horii T, Tanaka R, et al. Microsatellite-based genotyping of Candida albicans isolated from patients with superficial candidiasis. Med Mycol J. 2011;52(2):129-38. [PubMed ID: 21788724]. https://doi.org/10.3314/jjmm.52.129.
  • 11.
    Garcia-Hermoso D, Cabaret O, Lecellier G, Desnos-Ollivier M, Hoinard D, Raoux D, et al. Comparison of microsatellite length polymorphism and multilocus sequence typing for DNA-Based typing of Candida albicans. J Clin Microbiol. 2007;45(12):3958-63. [PubMed ID: 17928418]. https://doi.org/10.1128/JCM.01261-07.
  • 12.
    Adachi H, Shimizu K, Hattori H, Tanaka R, Chibana H, Takagi Y, et al. Genotyping of Candida albicans by Fragment Analysis of Microsatellites Combined with 25S rDNA and RPS-based Strategies. Nippon Ishinkin Gakkai Zasshi. 2009;50(3):167-74. https://doi.org/10.3314/jjmm.50.167.
  • 13.
    Botterel F, Desterke C, Costa C, Bretagne S. Analysis of microsatellite markers of Candida albicans used for rapid typing. J Clin Microbiol. 2001;39(11):4076-81. [PubMed ID: 11682532]. https://doi.org/10.1128/JCM.39.11.4076-4081.2001.
  • 14.
    Liguori G, Di Onofrio V, Galle F, Lucariello A, Albano L, Catania MR, et al. Candida albicans identification: comparison among nine phenotypic systems and a multiplex PCR. J Prev Med Hyg. 2010;51(3):121-4. [PubMed ID: 21361117].
  • 15.
    Hospenthal DR, Beckius ML, Floyd KL, Horvath LL, Murray CK. Presumptive identification of Candida species other than C. albicans, C. krusei, and C. tropicalis with the chromogenic medium CHROMagar Candida. Ann Clin Microbiol Antimicrob. 2006;5(1). [PubMed ID: 16390552]. https://doi.org/10.1186/1476-0711-5-1.
  • 16.
    Sampaio P, Gusmao L, Correia A, Alves C, Rodrigues AG, Pina-Vaz C, et al. New microsatellite multiplex PCR for Candida albicans strain typing reveals microevolutionary changes. J Clin Microbiol. 2005;43(8):3869-76. [PubMed ID: 16081924]. https://doi.org/10.1128/JCM.43.8.3869-3876.2005.
  • 17.
    Eloy O, Marque S, Botterel F, Stephan F, Costa JM, Lasserre V, et al. Uniform distribution of three Candida albicans microsatellite markers in two French ICU populations supports a lack of nosocomial cross-contamination. BMC Infect Dis. 2006;6(162). [PubMed ID: 17101036]. https://doi.org/10.1186/1471-2334-6-162.
  • 18.
    Costa JM, Eloy O, Botterel F, Janbon G, Bretagne S. Use of microsatellite markers and gene dosage to quantify gene copy numbers in Candida albicans. J Clin Microbiol. 2005;43(3):1387-9. [PubMed ID: 15750114]. https://doi.org/10.1128/JCM.43.3.1387-1389.2005.
  • 19.
    Garcia-Hermoso D, Desnos-Ollivier M, Bretagne S. Typing Candida Species Using Microsatellite Length Polymorphism and Multilocus Sequence Typing. Methods Mol Biol. 2016;1356:199-214. [PubMed ID: 26519075]. https://doi.org/10.1007/978-1-4939-3052-4_15.
  • 20.
    Amouri I, Sellami H, Abbes S, Hadrich I, Mahfoudh N, Makni H, et al. Microsatellite analysis of Candida isolates from recurrent vulvovaginal candidiasis. J Med Microbiol. 2012;61(8):1091-6. [PubMed ID: 22538998]. https://doi.org/10.1099/jmm.0.043992-0.
  • 21.
    Wu Y, Zhou HJ, Che J, Li WG, Bian FN, Yu SB, et al. Multilocus microsatellite markers for molecular typing of Candida tropicalis isolates. BMC Microbiol. 2014;14(245). [PubMed ID: 25410579]. https://doi.org/10.1186/s12866-014-0245-z.
  • 22.
    Odds FC, Jacobsen MD. Multilocus sequence typing of pathogenic Candida species. Eukaryot Cell. 2008;7(7):1075-84. [PubMed ID: 18456859]. https://doi.org/10.1128/EC.00062-08.
  • 23.
    Afsarian MH, Badali H, Boekhout T, Shokohi T, Katiraee F. Multilocus sequence typing of Candida albicans isolates from a burn intensive care unit in Iran. J Med Microbiol. 2015;64(3):248-53. [PubMed ID: 25596113]. https://doi.org/10.1099/jmm.0.000015.
comments

Leave a comment here


Crossmark
Crossmark
Checking
Share on
Metrics

Purchasing Reprints

  • Copyright Clearance Center (CCC) handles bulk orders for article reprints for Brieflands. To place an order for reprints, please click here (   https://www.copyright.com/landing/reprintsinquiryform/ ). Clicking this link will bring you to a CCC request form where you can provide the details of your order. Once complete, please click the ‘Submit Request’ button and CCC’s Reprints Services team will generate a quote for your review.
Search Relations

Author(s):

Related Articles